阅读说明：本技术 用于医治疾病的外泌体的用途 (Use of exosomes for treating diseases ) 是由 R·卡卢利 S·梅洛 于 2016-06-10 设计创作，主要内容包括：本发明提供基于脂质的纳米颗粒(例如,脂质体或外泌体),所述基于脂质的纳米颗粒具有在所述基于脂质的纳米颗粒表面上的CD47并且包含治疗剂(例如,治疗性蛋白、抗体、抑制性RNA和/或小分子药物)。此外,本发明提供这类基于脂质的纳米颗粒在治疗中的用途。(The present invention provides lipid-based nanoparticles (e.g., liposomes or exosomes) having CD47 on the surface of the lipid-based nanoparticles and comprising a therapeutic agent (e.g., a therapeutic protein, antibody, inhibitory RNA, and/or small molecule drug). Furthermore, the present invention provides the use of such lipid-based nanoparticles in therapy.)

1. A pharmaceutical composition comprising an exosome and an excipient, wherein the exosome comprises a target Kras^G12DThe inhibitory RNA of (1).

2. The composition of claim 1, wherein the exosomes comprise CD47 on their surface.

3. The composition of claim 1 or 2, wherein the inhibitory RNA is an siRNA, shRNA, miRNA, or pre-miRNA.

4. The composition of any one of claims 1-3, wherein the inhibitory RNA is an siRNA comprising the nucleotide sequence of SEQ ID NO: 1 (GUUGGAGCUGAUGGCGUAGTT).

5. The composition of any one of claims 1-3, wherein the inhibitory RNA is an shRNA comprising the amino acid sequence of SEQ ID NO: 2 (CCGGGTTGGAGCTGATGGCGTAGTTCTCGAGCTACGCCATCAGCTCCAACTTTTTTT).

6. The composition of any one of claims 1-5, wherein the composition is formulated for parenteral administration.

7. The composition of any one of claims 1-6, wherein the composition is formulated for intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

8. The composition of any one of claims 1-7, further comprising an anti-cancer agent.

9. The composition of claim 8, wherein the anti-cancer agent comprises a chemotherapeutic agent or an immunotherapeutic agent.

10. Use of a composition comprising exosomes and excipient in the manufacture of a medicament for treating disease in a patient, wherein the exosomes comprise targeting Kras^G12DThe inhibitory RNA of (1).

11. The use of claim 10, wherein the disease is cancer.

12. The use of claim 10 or 11, wherein the inhibitory RNA is an siRNA, shRNA, miRNA, or pre-miRNA.

13. The use of any one of claims 10-12, wherein the inhibitory RNA is an siRNA comprising the sequence of SEQ ID NO: 1 (GUUGGAGCUGAUGGCGUAGTT).

14. The use of any one of claims 10-12, wherein the inhibitory RNA is an shRNA comprising the amino acid sequence of SEQ ID NO: 2 (CCGGGTTGGAGCTGATGGCGTAGTTCTCGAGCTACGCCATCAGCTCCAACTTTTTTT).

15. The use of any one of claims 10-14, wherein the composition is formulated for parenteral administration.

16. The use of any one of claims 11-15, wherein the composition is formulated for intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

17. The use of any one of claims 10-16, wherein the composition is used with an anti-cancer agent composition to treat the disease.

18. The use of claim 17, wherein the anti-cancer agent comprises a chemotherapeutic agent or immunotherapy.

19. The use of any one of claims 10-18, wherein the composition is used in combination with at least a second therapy.

20. The use of claim 19, wherein the second therapy comprises surgery, chemotherapy, radiation therapy, ultra-low temperature therapy, hormonal therapy, or immunotherapy.

21. The use of any one of claims 10-20, wherein the patient is a human.

1. Field of the invention

The present invention relates generally to the fields of medicine and oncology. More particularly, it relates to the use of exosomes in a method of treatment.

2. Description of the related Art

Exosomes are small (40nm to 150nm) membrane vesicles with endosomal derived lipid bilayers that are released by whole body cells (Kowal et al, 2014; EL-Andaloussi et al, 2013; Thery et al, 2002). Exosomes contain proteins, lipids, mRNA, microrna (mirna) and genomic DNA (Valadi et al, 2007; peinad et al, 2012; Luga et al, 2012; Kahlert et al, 2014). Unlike liposomes and other synthetic drug nanoparticle carriers, exosomes contain many transmembrane and membrane-anchored proteins that may enhance endocytosis and/or fusion directly with the plasma membrane of recipient cells, thus enhancing cargo (cargo) delivery (Marcus et al, 2013; van den Boorn et al, 2013; Johnsen et al, 2014). Exosome natural plasma membrane phospholipid compositions (including phosphatidylserine and cholesterol on the cytosolic side) and membrane-associated protein compositions can also provide excellent stability on systemic circulation by reducing clearance from circulation (in part via its lack of interaction with opsonins and coagulation and complement factors recognized by macrophages for phagocytosis) and minimizing immunogenic responses (Clayton et al, 2003; van der Meel et al, 2014; Gomes-da-Silva et al, 2012) when compared to synthetic nanoparticles (such as liposomes). These features will also minimize the cytotoxic effects that might be observed when the synthetic nanoparticles are used in vivo (Simoes et al, 2005). Finally, the endosomal and intercellular vesicle trafficking mechanisms associated with the production of exosomes may also be used in exosome uptake by recipient cells, which may enhance cargo release (and integration into RNAi gene silencing mechanisms), thereby enhancing the efficacy of any therapeutic agent (e.g., gene targeting). Recent studies evaluate the efficacy of exosomes as RNAi carriers for therapy and indicate that systemic injection of exosomes enables siRNA delivery into the brain, leading to robust down-regulation of target genes (Cooper et al, 2014; Alvarez-Erviti et al, 2011). Furthermore, human plasma-derived exosomes reportedly also enable RNAi delivery to recipient cells (Wahlgren et al, 2012), supporting their potential therapeutic utility in RNAi delivery for gene expression modification in target cells.

Single nucleotide variation in KRAS (Kras)^G12D/R/VMutations) were found in up to 96% of pancreatic tumors (Chang et al, 2014), and Kras mutations were considered to be early neoplastic events that drive and maintain pancreatic malignant transformation (Ying et al, 2012; collin et al, 2012; collins et al, 2012; smakman et al, 2005). RNAi-type targeting of Kras expression and downstream signaling using nanoparticles have recently been reported to reduce tumor burden in lung and colorectal cancer models (Pecot et al, 2014; Yuan et al, 2014; Xue et al, 2014). Unlike efforts focused on specific targeting of oncogenic Kras, these approaches may induce cytotoxic effects that would require careful dosing and monitoring. Specific targeting of oncogenic Kras has been limited in xenotransplantation models of pancreatic cancer by delivery via electroporation (Reiiba et al, 2007) or biopolymer implants (Zorde Khvalevsky et al, 2013). Improved methods are needed for delivering therapeutic or diagnostic agents.

Background

Disclosure of Invention

Provided herein are methods and medicaments for treating cancer using engineered liposomes and exosomes as delivery systems.

In one embodiment, a pharmaceutical composition is provided comprising a lipid-based nanoparticle and an excipient, wherein the lipid-based nanoparticle comprises CD47 on a surface thereof and wherein the lipid-based nanoparticle comprises a therapeutic agent. In some aspects, the lipid-based nanoparticle is a liposome or exosome. In certain aspects, the exosomes are isolated from cells overexpressing CD 47. In some aspects, the exosomes are isolated from a patient in need of treatment. In some aspects, the exosomes are isolated from fibroblasts. In some aspects, the liposome is a unilamellar liposome. In some aspects, the liposome is a multilamellar liposome.

In various aspects, the therapeutic agent is a therapeutic protein, an antibody (e.g., a full-length antibody, a monoclonal antibody, an scFv, a Fab fragment, a F (ab') 2, a diabody, a triabody, or a minibody), an inhibitory RNA, or a small molecule drug. In some aspects, the therapeutic protein is a protein, such as a tumor suppressor, kinase, phosphatase, or transcription factor, the deletion or inactivation of which is known to be involved in the disease to be treated. In some aspects, the antibody binds to an intracellular antigen. Such intracellular antigens may be proteins thereof, the activity of which is required for cell proliferation and/or survival such as oncogenes. In some cases, the antibody prevents the function of the antigen. In some cases, the antibody disrupts protein-protein interactions. In some aspects, the inhibitory RNA is an siRNA, shRNA, miRNA, or pre-miRNA. In various aspects, the inhibitory RNA prevents the expression of proteins whose activity is essential for the maintenance of a disease condition, such as an oncogene. In the case where the oncogene is a mutated form of a gene, then the inhibitory RNA may preferentially prevent expression of the mutated oncogene, but not the wild-type protein. In some aspects, the small molecule drug is an imaging agent. In some aspects, the small molecule drug is a chemotherapeutic agent.

In some aspects, the composition is formulated for parenteral administration, such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

In some aspects, the composition comprises an antibacterial agent. The antimicrobial agent can be benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethanol, glycerol, aminocapropyrimidine, imidazolidinyl urea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, or thimerosal.

In some aspects, a single lipid-based nanoparticle comprises more than one agent, such as a therapeutic agent and a diagnostic agent, more than one therapeutic agent, or more than one diagnostic agent.

In one embodiment, there is provided a method for treating a disease in a patient in need thereof, the method comprising administering to the patient the composition of any of the embodiments of the invention, thereby treating the disease in the patient. In some aspects, the disease is cancer. In some aspects, the patient is a human. In some aspects, the patient has previously had a surgically removed tumor.

In some aspects, the therapeutic agent is an inhibitory RNA that targets an oncogene. In certain aspects, the inhibitory RNA targets Kras^G12D. In some aspects, the therapeutic agent is a tumor suppressor protein.

In some aspects, the method further comprises administering at least a second therapy to the patient. In various aspects, the second therapy comprises surgery, chemotherapy, radiation therapy, ultra-low temperature therapy, hormonal therapy, or immunotherapy.

In one embodiment, a method for treating a disease in a patient in need thereof is provided, the method comprising electroporating liposomes or exosomes with a therapeutic agent (e.g., a monoclonal antibody) and providing the electroporated liposome exosomes to the patient, thereby treating the disease in the patient. In some aspects, the liposome or exosome comprises CD47 on its surface. In some aspects, the disease is cancer. In some aspects, the monoclonal antibody specifically or selectively binds to an intracellular antigen.

In one embodiment, a method is provided for administering a therapeutic protein to a patient in need thereof, the method comprising transfecting an exosome with a nucleic acid (e.g., DNA or RNA) encoding a therapeutic protein (e.g., a monoclonal antibody or antigen-binding fragment thereof), incubating the transfected exosome under conditions that allow expression of the therapeutic protein within the exosome, and providing the incubated exosome to the patient, thereby administering the therapeutic protein to the patient.

In one embodiment, a method for administering a therapeutic antibody to a cell is provided, the method comprising contacting the cell with a lipid-based nanoparticle comprising an antibody, wherein the antibody specifically or selectively binds to an intracellular antigen. In some cases, the cell is contained within a patient, and the method comprises administering the lipid-based nanoparticle to the patient.

In one embodiment, a method for medical use is providedA method of treating cancer in a patient, the method comprising administering to the patient a therapeutically effective amount of a lipid-based nanoparticle, wherein the nanoparticle comprises a specific or selective targeting of a mutant Kras (e.g., Kras)^G12D) The inhibitory RNA of (1). In some aspects, the cancer is lung cancer, colorectal cancer, or pancreatic cancer. In some aspects, the cancer is pancreatic ductal adenocarcinoma. In some aspects, the lipid-based nanoparticle is a liposome or exosome. In certain aspects, the exosomes are derived from autologous cells of the patient. In some aspects, the lipid-based nanoparticle comprises CD47 on its surface. In some aspects, the inhibitory RNA is an siRNA or shRNA. In some aspects, the inhibitory RNA sequences are designed to contain specific G to A nucleotide deviations (e.g., as found in SEQ ID NO: 1) in the targeted region to facilitate Kras^G12DSpecific targeting of mRNA. In some aspects, the inhibitory RNA comprises a polypeptide having an amino acid sequence according to SEQ ID NO: 2.

In one embodiment, a composition is provided that includes lipid-based nanoparticles and an excipient for use in treating a disease in a patient. In some aspects, the lipid-based nanoparticle comprises CD47 on its surface. In some aspects, the lipid-based nanoparticle comprises a therapeutic agent. In some aspects, the disease can be cancer. In some aspects, the therapeutic agent is an inhibitory RNA that targets an oncogene. In some aspects, the inhibitory RNA targets Kras^G12D. In some aspects, the therapeutic agent is a tumor suppressor protein. In some aspects, the composition further comprises at least a second therapy. In some aspects, the second therapy comprises surgery, chemotherapy, radiation therapy, ultra-low temperature therapy, hormonal therapy, or immunotherapy. In some aspects, the patient is a human.

In some aspects, the composition is formulated for parenteral administration, such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

In some aspects, the composition comprises an antibacterial agent. The antimicrobial agent can be benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethanol, glycerol, aminocapropyrimidine, imidazolidinyl urea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, or thimerosal.

In one embodiment, there is provided a use of a lipid-based nanoparticle in the manufacture of a medicament for the treatment of a disease. In some aspects, the lipid-based nanoparticle comprises CD47 on its surface. In some aspects, the lipid-based nanoparticle comprises a therapeutic agent. In some aspects, the disease is cancer. In some aspects, the therapeutic agent is an inhibitory RNA that targets an oncogene. In some aspects, the inhibitory RNA targets Kras^G12D. In some aspects, the therapeutic agent is a tumor suppressor protein.

In some aspects, the medicament is formulated for parenteral administration, such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

In some aspects, the medicament comprises an antibacterial agent. The antimicrobial agent can be benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethanol, glycerol, aminocapropyrimidine, imidazolidinyl urea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, or thimerosal.

As used herein, "substantially free" with respect to a specified component is used herein to mean that no specified component has been purposefully formulated into a composition and/or is present only as a contaminant or in trace amounts. The total amount of the specified components caused by contamination of any undesired composition is therefore well below 0.05%, preferably below 0.01%. Most preferred are compositions wherein the amount of the specified component is not detectable using standard analytical methods.

As used herein in the specification, "a" or "an" may mean one or more. As used in one or more claims herein, the words "a(s)", when used in conjunction with the word "comprising", may mean one(s) or more than one(s).

Although this disclosure supports the definition of "and/or" in reference to an individual alternative, the term "or" as used in the claims is intended to mean "and/or" unless explicitly indicated to the contrary by reference to an individual alternative or an alternative. As used herein, "another" may mean at least a second or more.

Throughout this application, the term "about" is used to indicate that a value includes the inherent variation in error of the apparatus, method used to determine the value, or the variation that exists between study subjects.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Drawings

The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

FIG. 1A to FIG. 1F Kras mediated by siRNA/shRNA encapsulated in exosomes^G12DThe targeting of (2) induces cancer cell death. (FIG. 1A) forQuantification of confocal micrographs of Panc-1 cells stained with Green Nuclear Mark and containing the same with Alexa647 visual display of internalized exosomes (exos) and liposomes (lipos) of the labeled siRNA. Panc-1 cells were preincubated with or without proteinase K or trypsin prior to exposure to exos or lipos containing Alexa fluor 647-labeled siRNA. Unpaired two-tailed student t-test was used to determine statistical significance between groups. (FIGS. 1B to 1C) KRAS^G12D(FIG. 1B) or wild-type KRAS (FIG. 1C)Recording the level in the application of a composition containing siKras^G12DOr shKras^G12DExos or lipos containing siscorbl or shScrbl, exos or lipos containing non-electroporated (empty cargo, control exos) were treated for 3 hours for real-time PCR analysis in Panc-1 cells. Fold change is expressed relative to the expression of untreated Panc-1 cells (control), which is arbitrarily set to 1. Unpaired two-tailed student t-test was used to determine statistical significance when compared to untreated Panc-1 cell transcription levels. (FIG. 1D) lysates from untreated Panc-1 (control) lysate and from siKras treated with a peptide directed against phosphorylated AKT (p-AKT), phosphorylated ERK (p-ERK) and actin (internal control)^G12DOr shKras^G12DWestern blotting of lysates of exos-treated Panc-1 cells. (FIG. 1E) relative number of Panc-1 cells over time after exposure to the treatments listed. (FIG. 1F) quantification of immunostaining micrographs performed against the apoptosis marker TUNEL in Panc-1 cells exposed to the treatments listed. Puromycin was used as a positive control. (0) Indicating that no cells detected positive relative to TUNEL. Control substance: untreated, control exos: non-electroporated (no siRNA cargo) exos. Unpaired two-tailed student t-test was used to determine statistical significance between groups. The mean values are depicted as +/-SEM. Unless otherwise noted, one-way analysis of variance was used to determine statistical significance. P < 0.01, p < 0.001, ns: not significant.

FIGS. 2A to 2G use a catalyst containing si/shKras^G12DExosome therapy of cargo caused sustained Panc-1 in situ tumor regression. (FIG. 2A) relative light intensity of bioluminescent Panc-1 in situ tumors over time. PBS: n-7, control exos: n-6, siKras^G12D lipos：n＝3，shKras^G12D lipos：n＝3，siKras^G12D exos：n＝7，shKras^G12Dexos: n is 7. Statistical test results are shown as comparing treatment groups to PBS control group at day 42 post-cancer cell injection, except siKras^G12DIn addition to exos group, it was compared to PBS group at experimental endpoint (day 28 post cancer cell injection). The top pair of lines is PBS and control Exos; the middle pair of lines is lipos; the bottom pair of lines is exos. (FIG. 2B) bioluminescent BxPC3 in situ tumors over timeRelative brightness of the light. PBS: n-3, control exos: n-3, siKras^G12Dexos：n＝3，shKras^G12Dexos: n is 3. Statistical test results are shown comparing treatment groups at day 77 post-cancer cell injection to PBS control groups. (FIG. 2C) relative light intensity of bioluminescent Panc-1 in situ tumors over time. Experimental groups were measured in PBS: n-7, control exos: n-6, siKras^G12Dexos：n＝7，shKras^G12Dexos: n-7 started and gradually declined as mice moribund and euthanized (PBS group and control exos group). Small foci of cancer cells are seen in shKras^G12Dexos-treated pancreas, however the vast majority of the pancreas is histologically insignificant. The top pair of lines is PBS and control Exos; the bottom pair of lines is si/shKras^G12Dexos. (FIG. 2D) comparative analysis of measured radiance of bioluminescence of Panc-1 tumors in situ at day 77 post-cancer cell injection. PBS: n-7, control exos: n is 6, shKras^G12Dexos: n is 7. Unpaired two-tailed student t-test was used to determine statistical significance between groups. (FIG. 2E) quantification of p-ERK immunolabeling (scale bar: 50 μm) and percent p-ERK staining in pancreatic tumors in the experimental groups. n is 6. Note that for the application in shKras^G12DQuantification is performed on measurably smaller tumor areas in exos-treated groups. Unpaired two-tailed student t-test was used to determine statistical significance between the two groups. (FIG. 2F) in euthanasia (PBS: days 62 to 130, control exos: days 30 to 132, shKras^G12Dexos: day 200) tumor burden (relative mass of pancreas relative to body mass) in the indicated experimental group. Unpaired two-tailed student t-test was used to determine statistical significance between groups. (fig. 2G) Kaplan-Meier curve comparison of survival of mice in the indicated experimental groups and statistical differences were assessed using the log rank Mantel-Cox (Mantel-Cox) test, PBS: n-7, control exos: n is 6, shKras^G12Dexos: n is 7. The mean values are depicted as +/-SEM. Unless otherwise noted, one-way analysis of variance was used to determine statistical significance. P < 0.05, p < 0.01, p < 0.001, p < 0.0001, ns: not significant.

FIG. 3A to FIG. 3G. encapsulating Kras^G12DInjection of exosomes of siRNA and shRNA induced slower tumor progression and increased the survival of PKT mice. (FIG. 3A) Ptf1a^cre/+；LSL-Kras^G12D/+；Tgfbr2^flox/floxSchematic representation of the tumor progression time course with experimental treatment points in (PKT) mice. With a composition comprising Kras^G12DTreatment of BJ fibroblast exosomes for RNAi began on day 33 and then continued every other day until the mice reached the experimental endpoint or moribund and required euthanasia. The control group was treated with the same concentration of non-electroporated BJ exosomes (control exos). (fig. 3B) kaplan-meier curve comparison of survival of mice in the indicated experimental groups and statistical differences were assessed using the log rank mantel-cox test. N is 5 in each group. (fig. 3C) tumor burden (relative mass of pancreas relative to body mass) in the indicated experimental group at age of 44 days. N is 3 in each group. (FIG. 3D) according to the results obtained with a composition containing siKras^G12DExos or non-electroporation control exos treated day 44 PKT mice H&Quantification of relative percentage determined from micrographs of E stained tumors, n-3. One-way anova was used for statistical comparison. (FIGS. 3E to 3F) in the indicated experimental groups (exosomes from PKT-derived fibroblasts, n-5 in each group; control Exos on the left and siKras on the right)^G12Dexos) survival of mice (fig. 3E), and (fig. 3F) tumor burden, n ═ 5. For statistical analysis of the kaplan-meier curve comparisons, a log rank mantel-cox test was performed. (fig. 3G) quantification of micrographs against Masson (Masson) trichrome staining (MTS) and immunolabeling for the apoptosis marker TUNEL, proliferation marker Ki-67 and phosphorylated ERK from the 44-day PKT pancreatic tumors in the indicated experimental group. n is 3. Data are expressed as mean ± SEM. Unpaired two-tailed student t-test was used to determine statistical significance unless otherwise noted. P < 0.01, p < 0.0001.

FIGS. 4A to 4I. specific Kras Using exosomes^G12DAnd (4) targeting. (FIG. 4A) schematic illustration of electroporation of RNAi into exosomes. Alexa for RNAi in schematic representation647 (see item 647). (FIG. 4B) exosome number and size distribution-using NanoSight. (fig. 4C to D) transmission electron micrographs of exosomes purified from BJ fibroblasts (fig. 4C) and stained for CD9 by immunogold (fig. 4D). (FIG. 4E) contains Alexa647-sucrose gradient northern blot of BJ fibroblast exosomes labeled siRNA. Alexa is depicted in the blot647 detection of fluorescence of the fluorophore. (FIG. 4F) in the use of siKras^G12DOr shKras^G12DKRAS in Panc-1 cells treated with lipos, siScrbl or shScrbl lipos for 3 hours^G12DReal-time PCR analysis of transcript levels, with increased lipos concentration (1 ×, 10 ×, 100 ×) and increased Panc-1 cell treatment time (24 hours). Fold change is expressed relative to the expression of untreated Panc-1 cells (control), which is arbitrarily set to 1. Unpaired two-tailed student t-test was used to determine statistical significance when compared to untreated Panc-1 cell transcription levels. (FIG. 4G) in the use of siKras as shown in FIG. 1B^G12DOr shKras^G12Dexos treatment of KRAS in Panc-1 cells for 3 hours^G12DReal-time PCR analysis of transcript levels and in which exos concentration was increased (-700 exosomes/cell instead of-400 exosomes/cell). Unpaired two-tailed student t-test was used to determine statistical significance when compared to untreated Panc-1 cell transcription levels. (FIG. 4H) in the use of siKras^G12DOr shKras^G12Dexos treatment for 3 hours real-time PCR analysis of wild-type KRAS transcript levels in BxPC-3 cells. Unpaired two-tailed student t-test was used to determine statistical significance when compared to the transcriptional level of untreated BxPC3 cells. (FIG. 4I) relative number of BXPC-3 cells over time after exposure to the treatments listed. Unpaired two-tailed student t-test was used at final time points, p < 0.05, p < 0.01, p < 0.001, p < 0.0001, ns: not significant.

FIG. 5A to FIG. 5D contain Kras^G12DThe exosomes of RNAi inhibit Panc-1 tumor growth in situ. (FIG. 5A) intraperitoneal injection followed by 24 hours from siKras^G12DFlow cytometric analysis of exosomes isolated from sera of exos-treated mice. Using Alexa647 labeled RNAi detect labeled exosomes containing the Alexa after binding to 0.4 μm beads647 labeled RNAi. (FIG. 5B) Alexa in the blood of mice 12 hours after intraperitoneal injection of exos or lipos containing Alexa fluorescent 647-labeled RNAi647⁺/CD11b⁺Flow cytometry analysis and quantification of the percentage of macrophages. (FIG. 5C) quantification of the percentage of p-AKT staining area in micrographs of pancreatic tumors immunolabeled against phosphorylated AKT (p-AKT). n is 6. Note that for the application in shKras^G12DQuantification was performed on relatively smaller tumor areas in the exos-treated group. (fig. 5D) kaplan-meier curve comparison of survival of mice with BxPC-3 orthotopic tumors in the indicated experimental groups, PBS: n-3, control exos: n is 3, shKras^G12Dexos：n＝3，siKras^G12Dexos: n-3 (for log rank (mantel-cox) test this analysis). Data are expressed as mean ± SEM. Unpaired two-tailed student t-test was used to determine statistical significance unless otherwise indicated. P < 0.05, p < 0.01, p < 0.001, p < 0.0001, ns: not significant.

Fig. 6A to fig.6b panc-1 tumor progression. (FIG. 6A) comparative analysis of measured luminance of bioluminescence at day 77. PBS: n-7, control exos: n is 6, shKras^G12Dexos: n is 7. Unpaired two-tailed student t-test at day 77 was used to determine statistical significance, p < 0.05, p < 0.01, p < 0.001, p < 0.0001, ns: not significant. (FIG.6B) depicts a spider web map of individual tumors. PBS (Poly Butylene succinate): n-7, control exos: n is 6, shKras^G12Dexos：n＝7。

FIG. 7A to FIG. 7D histological analysis Kras^G12DRNAi exos-treated PKT mice. (FIG. 7A) tumor burden (relative mass of pancreas relative to body mass) at the experimental end-point (control exos: median survival of 43 days, siKras^G12Dexos: median survival of 60 days). N is 5 in each group. (FIGS. 7B-7C) siKras derived at the indicated experimental endpoints and with (FIG. 7B) BJ fibroblasts and (FIG. 7C) PKT fibroblasts^G12Dexos or non-electroporated exos (control exos) treated PKT mice H&Quantification of relative percentage of histological phenotype in micrographs of E-stained tumors. n is 5. Two-way anova was used for statistical comparison. (fig. 7D) quantification of micrographs of tumors from 44-day-old PKT mice in the indicated experimental groups against phosphorylated AKT immunolabeling. Data are expressed as mean ± SEM. Unpaired two-tailed student t-test was used to determine statistical significance unless otherwise noted. P < 0.01, p < 0.0001.

Fig. 8A-8 b circulating monocytes phagocytose iLiposomes (i.e., liposomes containing a drug substance such as inhibitory RNA) more efficiently than iExosomes (i.e., exosomes containing a drug substance such as inhibitory RNA). (FIG. 8A) the top panel shows the percentage of CD11b positive cells from the total live cell population. The bottom panel shows the percentage of a647 and CD11b double positive cells from the total viable cell population. (FIG. 8B) quantification of FACS plots provided in FIG. 8A.

Fig. 9A to 9c. CD47 was detected for exosomes but not exosomes. (FIG. 9A) exosomes isolated from BJ fibroblasts. The top panel shows staining with secondary antibody only and the bottom panel shows staining for CD63 or CD 47. (FIG. 9B) liposomes (100nm) stained with secondary antibody only or with antibody against CD63 or CD 47. (FIG. 9C) expression of CD47 by exosomes isolated in two different ways from three different cell lines.

FIG. 10 anti-CD 47 antibody stimulates exosome uptake by circulating monocytes in vivo. The exosomes were treated with anti-CD 47 antibodies that allow uptake of the exosomes by circulating monocytes in vivo.

FIG. 11 is a Venturi diagram showing the proteins present in a subpopulation of pancreatic cancer cells and their corresponding exosomes. Proteins were extracted from a subpopulation of pancreatic cancer cell lines T3M4 and their corresponding exosomes. Mass spectrometry was used to identify proteins expressed in cells and corresponding exosomes. A list of proteins was identified for each sample. When compared to cells (right of each pair of circles), a comparison between a cell and a corresponding exosome identifies a protein present in the cell but not in the exosome (left of each pair of circles), a protein present in the cell and the corresponding exosome (intersection between circles), and a protein enriched in exosomes. The cell expresses a protein that is not present in the exosomes. In addition, exosomes contain enriched proteins when compared to the originating cell.

Detailed Description

Regardless of the current standard of care, Pancreatic Ductal Adenocarcinoma (PDAC) has a median survival of six months for metastatic patients, with only 6.7% of patients surviving five years later (Siegel et al, 2014; Howlader et al, 2013). Therefore, effective new therapies are urgently needed for PDACs. Genetic analysis of PDACs showed that mutations in the RAS family of small GTPases (KrasGl2/D/R/V) occur in 70% to 96% of patients (Biankin et al, 2012; Hruban et al, 1993; Almoguera et al, 1988; Chang et al, 2014) and are important drivers of tumor growth and metastasis (Ying et al, 2012; Hingorani et al, 2005; Collins et al, 2012 a; Collins et al, 2012 b; Eser et al, 2014). Gene manipulation in mice has shown that inhibition of oncogenic KRAS reverses tumor progression (Ying et al, 2012, Collins et al, 2012 a; Collins et al, 2012 b; Smakman et al, 2005). Oncogenic KRAS signaling and increased RAS activity have been shown to trigger a driver of pancreatic adenomatosis (Collins et al, 2012 a; Eser et al, 2014; Ji et al, 2009); however, RAS remains an intractable target and a therapeutic challenge (Gysin et al, 2011). Exosomes derived herein from normal fibroblasts are engineered to carry an RNA interference (RNAi) payload to the target oncogenic KRAS^G12D. Exosomes containing TT-linked siRNA or shRNA versus Kras^G12DEfficiently enter cancer cells and specifically inhibit oncogenic Ras, attenuate ERK activation, inhibit proliferation, and induce apoptosis of cancer cells. Kras when compared to si/shRNA-containing liposomes and exosomes with scrambled RNAi constructs^G12DSystemic delivery of targeting cargo exosomes showed robust pancreatic localization and suppression of pre-established orthotopic human pancreatic tumors of pancreatic cancer as well as tumors in a Genetically Engineered Mouse Model (GEMM), as well as improvement in survival. Tumors of mice treated with exosomes containing si/shRNA showed a significant reduction in downstream RAS signaling mediators and improved histopathological findings in normal pancreatic tissue structure. Human fibroblast-derived exosomes showed similar efficacy as mouse fibroblast-derived exosomes on PDAC GEMM, thus suggesting that patient-specific exosomes may not be required in order to allow efficient RNAi delivery while minimizing potential toxic side effects. Such strategies provide novel and efficient means of inhibiting oncogene expression and downstream signaling with minimal off-target effects.

CD47 (integrin-associated protein) is a transmembrane protein expressed on most tissues and cells. CD47 is a ligand for signal-regulated protein alpha (SIRP-alpha) that is expressed on phagocytes such as macrophages and dendritic cells. Activation of CD 47-SIRP-alpha triggers a signal transduction cascade that inhibits phagocytosis. Monoclonal antibodies against CD47 were injected into mice prior to exosome injection, or exosomes were both treated with CD47 neutralizing antibodies prior to injection to block CD47 and permit exosomes to be phagocytosed by macrophages or monocytes. Thus, expression of CD47 on the surface of exosomes prevents phagocytosis by macrophages.

I. Lipid-based nanoparticles

In some embodiments, the lipid-based nanoparticle is a liposome, an exosome, a lipid formulation, or another lipid-based nanoparticle, such as a lipid-based vesicle (e.g., DOTAP: cholesterol vesicle). The lipid-based nanoparticle may be positively, negatively, or neutral.

A. Liposomes

"liposomes" is a generic term encompassing a variety of mono-and multilamellar lipid vehicles formed by the generation of encapsulated lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a bilayer membrane, typically comprising a phospholipid, and an internal medium, typically comprising an aqueous composition. Liposomes provided herein include unilamellar liposomes, multilamellar liposomes, and multivesicular liposomes. Liposomes provided herein can be positively charged, negatively charged, or uncharged. In certain embodiments, the liposomes are uncharged.

Multilamellar liposomes have multiple lipid layers separated by an aqueous medium. Such liposomes form spontaneously when phospholipids-containing lipids are suspended in an excess of aqueous solution. Prior to forming the closed structure, the lipid component undergoes auto-rearrangement and water and dissolved solutes are encapsulated between the lipid bilayers. Lipophilic molecules or molecules with lipophilic regions may also be dissolved in or associated with the lipid bilayer.

In particular aspects, the polypeptide, nucleic acid, or small molecule drug can be, for example, encapsulated in the aqueous interior of a liposome, dispersed within the lipid bilayer of a liposome, attached to a liposome via a linker molecule associated with both the liposome and the polypeptide/nucleic acid, encapsulated in the liposome, complexed with the liposome, or the like.

As will be appreciated by those of ordinary skill in the art, liposomes for use in accordance with embodiments of the present invention can be made by different methods. For example, a phospholipid, such as the neutral phospholipid Dioleoylphosphatidylcholine (DOPC), is dissolved in t-butanol. The one or more lipids are then mixed with the polypeptide, nucleic acid, and/or one or more other components. Tween 20 was added to the lipid mixture such that tween 20 was about 5% by weight of the composition. Excess t-butanol is added to this mixture such that the volume of t-butanol is at least 95%. The mixture was vortexed, frozen in a dry ice/acetone bath, and lyophilized overnight. The lyophilized formulation was stored at-20 ℃ and could be used for up to three months. The lyophilized liposomes were reconstituted in 0.9% saline, as needed.

Alternatively, liposomes can be prepared by mixing the lipids in a solvent in a container such as a glass, pear-shaped flask. The container should have a volume ten times greater than the volume of the intended suspension of liposomes. The solvent was removed using a rotary evaporator at about 40 ℃ under negative pressure. The solvent is typically removed in about 5 minutes to 2 hours, depending on the desired volume of the liposome. The composition may be further dried in a desiccator under vacuum. Due to the tendency to deteriorate over time, dried lipids are typically discarded after about 1 week.

The dried lipids can be hydrated in sterile, pyrogen-free water at about 25mM to 50mM phospholipid by shaking until the entire lipid film is resuspended. The aqueous liposomes can then be divided into aliquots, each placed in a vial, lyophilized under vacuum and sealed.

The dried lipids or lyophilized liposomes prepared as described above can be dehydrated and reconstituted in a solution of protein or peptide and diluted to the appropriate concentration with a suitable solvent such as DPBS. The mixture was then vigorously shaken in a vortex mixer. Unencapsulated additional materials such as agents (including but not limited to hormones, drugs, nucleic acid constructs, etc.) were removed by centrifugation at 29,000 × g and the liposome pellet was washed. The washed liposomes are resuspended at an appropriate total phospholipid concentration, e.g., about 50mM to 200 mM. The amount of additional material or active agent encapsulated can be determined according to standard methods. After determining the amount of supplemental material or active agent encapsulated in the liposome formulation, the liposomes can be diluted to the appropriate concentration and stored at 4 ℃ until use. Pharmaceutical compositions comprising liposomes will generally include a sterile, pharmaceutically acceptable carrier or diluent, such as water or saline solution.

Additional liposomes useful in embodiments of the invention include cationic liposomes, for example, as described in WO02/100435A1, U.S. patent 5,962,016, U.S. application 2004/0208921, WO03/015757A1, WO04029213A2, U.S. patent 5,030,453, and U.S. patent 6,680,068, all of which are hereby incorporated by reference in their entirety without intending to be a disclaimer.

In preparing such liposomes, any of the protocols described herein or as would be known to one of ordinary skill in the art may be used. Additional non-limiting examples of preparing liposomes are described in U.S. patents 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505 and 4,921,706; international applications PCT/US85/01161 and PCT/US89/05040, each of which is incorporated herein by reference.

In certain embodiments, the lipid-based nanoparticle is a neutral liposome (e.g., a DOPC liposome). As used herein, "neutral liposomes" or "uncharged liposomes" are defined as liposomes having one or more lipid components that produce a substantially neutral net charge (substantially uncharged). By "substantially neutral" or "substantially uncharged", it is meant that little, if any, of the lipid components within a given population (e.g., a population of liposomes) include a charge that is not offset by the opposite charge of another component (i.e., less than 10% of the components include an unampensated charge, more preferably less than 5% and most preferably less than 1%). In certain embodiments, a neutral liposome can include a majority of lipids and/or phospholipids that are themselves neutral under physiological conditions (i.e., at about pH 7).

The liposomes and/or lipid-based nanoparticles of embodiments of the invention can comprise a phospholipid. In certain embodiments, a single phospholipid species may be used to form liposomes (e.g., neutral phospholipids such as DOPC may be used to generate neutral liposomes). In other embodiments, more than one phospholipid may be used to form the liposomes. The phospholipids may be derived from natural sources or synthetic sources. Phospholipids include, for example, phosphatidylcholine, phosphatidylglycerol and phosphatidylethanolamine; because phosphatidylethanolamine and phosphatidyl choline are uncharged under physiological conditions (i.e., at about pH 7), these compounds are particularly useful for the production of neutral liposomes. In certain embodiments, the phospholipid DOPC is used to produce uncharged liposomes. In certain embodiments, lipids other than phospholipids (e.g., cholesterol) may be used.

Phospholipids include glycerophospholipids and certain sphingolipids. Phospholipids include, but are not limited to, dioleoylphosphatidylcholine ("DOPC"), egg phosphatidylcholine ("EPC"), dilauroylphosphatidylcholine ("DLPC"), dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphatidylcholine ("DPPC"), distearoylphosphatidylcholine ("DSPC"), 1-myristoylphosphatidylcholine-2 ("MPPC"), 1-palmitoylphosphatidylcholine-2 ("PMPC"), 1-stearoylphosphatidylcholine-2 ("SPPC"), dilauroylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol ("DMPG"), and the like, Dipalmitoylphosphatidylglycerol ("DPPG"), distearoylphosphatidylglycerol ("DSPG"), distearoylsphingomyelin ("DSSP"), distearoylphosphatidylethanolamine ("DSPE"), dioleoylphosphatidylglycerol ("DOPG"), dimyristoylphosphatidylcholine ("DMPA"), dipalmitoylphosphatidylcholine ("DPPA"), dimyristoylphosphatidylethanolamine ("DMPE"), dipalmitoylphosphatidylethanolamine ("DPPE"), dimyristoylphosphatidylserine ("DMPS"), dipalmitoylphosphatidylserine ("DPPS"), cephalin ("BSP"), dipalmitoylphosphatidylcholine ("DPSP"), dimyristoylphosphatidylcholine ("DMPC"), 1, 2-distearoylphosphatidylsn-glycerol-3-phosphocholine ("DAPC") 1, 2-dianeoyl-sn-glycero-3-phosphocholine ("DBPC"), 1, 2-di (eicosenoyl) -sn-glycero-3-phosphocholine ("DEPC"), dioleoylphosphatidylethanolamine ("DOPE"), palmitoylphosphatidylcholine ("POPC"), palmitoleoylphosphatidylethanolamine ("POPE"), lysophosphatidylcholine, lysophosphatidylethanolamine, and dilinoleoylphosphatidylcholine.

B. Exosomes

The terms "microvesicle" and "exosome" as used herein refer to a membranous particle having a diameter (or largest dimension, wherein the particle is not spherical) between about 10nm and about 5000nm, more typically between 30nm and 1000nm and most typically between about 50nm and 750nm, wherein at least a portion of the membrane of the exosome is obtained directly from the cell. Most commonly, exosomes will have a size (mean diameter) that is at most 5% of the size of the donor cell. Thus, particularly contemplated exosomes include those that are shed from cells.

Exosomes may be detected or isolated from any suitable sample type, such as a bodily fluid. As used herein, the term "isolated" refers to separation from its natural environment and is meant to include at least partial purification and may include substantial purification. As used herein, the term "sample" refers to any sample suitable for the methods provided by the present invention. The sample may be any sample comprising exosomes suitable for detection or isolation. Sources of samples include blood, bone marrow, pleural fluid, peritoneal fluid, cerebrospinal fluid, urine, saliva, amniotic fluid, malignant ascites, bronchoalveolar lavage fluid, synovial fluid, breast milk, sweat, tears, joint fluid, and bronchial wash. In one aspect, the sample is a blood sample, including, for example, whole blood or any fraction or component thereof. Blood samples suitable for use with the present invention can be extracted from any known source, including blood cells or components thereof, such as veins, arteries, extremities, tissue, spinal cord, and the like. For example, samples may be obtained and processed using well-known and routine clinical methods (e.g., procedures for drawing and processing whole blood). In one aspect, an exemplary sample can be peripheral blood drawn from a subject with cancer.

Exosomes may also be isolated from tissue samples, such as surgical samples, biopsy samples, tissues, stool, and cultured cells. In isolating exosomes from a tissue source, it may be desirable to homogenize the tissue in order to obtain a single cell suspension, followed by lysis of the cells to release exosomes. In isolating exosomes from tissue samples, it is important to select homogenization and lysis procedures that do not result in exosome destruction. Exosomes contemplated herein are preferably isolated from bodily fluids in physiologically acceptable solutions, such as buffered saline, growth media, various aqueous media, and the like.

Exosomes may be isolated from a sample that has just been collected or from a sample that has been stored frozen or refrigerated. In some embodiments, the exosomes may be isolated from the cell culture medium. Although not required, if the liquid sample is clarified to remove any debris from the sample prior to precipitation with the volume excluding polymer, a higher purity of exosomes may be obtained. Methods of clarification include centrifugation, ultracentrifugation, filtration or ultrafiltration. Most commonly, exosomes can be isolated by a number of methods well known in the art. One preferred method is differential centrifugation from body fluids or cell culture supernatants. Exemplary methods for isolating exosomes are described (Losche et al, 2004; Mesri and Altieri, 1998; Morel et al, 2004). Alternatively, exosomes may also be isolated via flow cytometry as described in (Combes et al, 1997).

One acceptable solution for isolating exosomes includes ultracentrifugation, typically in combination with a sucrose density gradient or sucrose cushion to float relatively low density exosomes. The separation of exosomes by centrifugation in different orders is complicated by the possibility of superimposing the size distribution with other microvesicles or macromolecular complexes. Furthermore, centrifugation may not be sufficient to provide a means of separating vesicles based on vesicle size. However, sequential centrifugation can provide high enrichment of exosomes when combined with sucrose gradient ultracentrifugation.

Using an alternative to the ultracentrifugation approach, size-based separation of exosomes is another option. Successful purification of exosomes has been reported using an ultrafiltration procedure that is less time consuming than ultracentrifugation and does not require the use of special equipment. Similarly, commercial kits are available (EXOMIR)^TMThe american ball science company (bio Scientific) that allows removal of cells, platelets and cell debris on one microfilter and the use of positive pressure driven liquid on a second microfilter to capture vesicles larger than 30 nm. However, for this process, exosomes are not recovered, and their RNA content is extracted directly from the material hooking the second microfilter, which can then be used for PCR analysis. HPLC-based protocols can potentially allow individuals to obtain very pure exosomes, but these processes require specialized equipment and are difficult to scale up. A significant problem is that both blood and cell culture media contain a large number of nanoparticles (some not vesicles) in the same size range as exosomes. For example, some mirnas may be contained within extracellular protein complexes rather than exosomes; however, treatment with proteases (e.g., proteinase K) can be performed to eliminate any possible contamination via "extra exosome" proteins.

In another embodiment, cancer cell-derived exosomes may be captured by commonly used techniques to enrich samples for exosomes, such as those involving immunospecific interactions (e.g., immunomagnetic capture). Immunomagnetic capture, also known as immunomagnetic cell separation, typically involves attaching antibodies directed against proteins found on specific cell types to small paramagnetic beads. When the antibody-coated beads are mixed with a sample, such as blood, the beads attach to and surround specific cells. The sample was then placed in a strong magnetic field, causing the beads to clump to one side. After removal of the blood, the captured cells are retained with beads. Many variations of this general approach are well known in the art and are suitable for isolating exosomes. In one example, exosomes may be attached to magnetic beads (e.g., aldehyde/sulfate beads), and then antibodies are added to the mixture to recognize epitopes on the surface of exosomes attached to the beads. Exemplary proteins known to be found on cancer cell-derived exosomes include ATP-binding cassette subfamily a member 6(ABCA6), tetraspanin-4 (TSPAN4), SLIT and NTRK class protein 4(SLITRK4), putative protocadherin (protocadherin) beta-18 (PCDHB18), myeloid cell surface antigen CD33(CD33), and glypican-1 (GPCI). Cancer cell-derived exosomes may be isolated using, for example, antibodies or aptamers to one or more of these proteins.

As used herein, analysis includes any method that allows for the visual display of exosomes, directly or indirectly, and can be performed in vivo or ex vivo. For example, analysis may include, but is not limited to, ex vivo microscopic or cytological detection and visual display of exosomes bound to a solid matrix, flow cytometry, fluorescence imaging, and the like. In exemplary aspects, the cancer cell-derived exosomes are detected using antibodies directed to one or more of: ATP-binding cassette subfamily A member 6(ABCA6), tetraspanin-4 (TSPAN4), SLIT and NTRK like protein 4(SLITRK4), putative protocadherin beta-18 (PCDHB18), myeloid cell surface antigen CD33(CD33), glypican-1 (GPC1), histone H2A type 2-A (HIST1H2AA), histone H2A type 1-A (HIST1H1AA), histone H3.3(H3F A), histone H3.1(HIST1H3A), zinc finger protein 37 homolog (ZFP37), laminin subunit beta-1 (LAMB1), tubulointerstitial nephritis antigens (TINAGL1), peroxiredoxin-4 (PRDX 5), collagen alpha-2 (IV) chain (COL4A2), putative laminin C3P1 (RHP 1), tubulointerstitial nephritis antigens (RHP 599), putative extracellular matrix protein anchoring proteins (RHP 599) with putative extracellular matrix pn2 PN 2-binding domains, protein anchoring proteins (RHP 599), putative extracellular domain of extracellular protein PN 639, and protein, Triplex motif-containing protein 42(TRIM42), desmosomal plakoglobin (JUP), tubulin beta-2B chain (TUBB2B), endoribonuclease DICER (DICER1), E3 ubiquitin-protein ligase TRIM71(TRIM71), swordein p60 ATPase-containing subunit A class 2(KATNAL2), protein S100-A6(S100A6), 5' -nucleotidase domain-containing protein 3(NT5DC3), valine-tRNA ligase (VARS), Kazrin KAZN), ELAV class 4(ELAVL4), cyclophalan 166(RNF166), FERM and PDZ domain-containing protein 1(FRMPD1), 78kDa glucose regulatory protein (HSPA5), transportprotein particle complex subunit 6A (PPC 6 TRA A), squalene monooxygenase (SQ 101), SQFERM 101, TSG101, VEGF receptor negative homolog of PGA (PTCoA 28), prostaglandin-PGA receptor negative PGA 28, and PGA, Mitochondria (ACAD8), 26S protease regulatory subunit 6B (PSMC4), elongation factor 1-gamma (EEF1G), myoglobin (TTN), tyrosine-protein phosphatase type 13(PTPN13), triose phosphate isomerase (TPI1) or carboxypeptidase e (cpe), and subsequently bound to a solid matrix and/or visualized using microscopic or cytological assays.

It should be noted that not all proteins expressed in a cell are found in exosomes secreted by the cell (see fig. 11). For example, calnexin, GM130 and LAMP-2 are all proteins expressed in MCF-7 cells and not found in exosomes secreted by MCF-7 cells (Baietti et al, 2012). As another example, there are studies finding 190/190 pancreatic ductal adenocarcinoma patients have higher levels of GPC1+ exosomes than healthy controls (mlo et al, 2015, which is incorporated herein by reference in its entirety). Notably, on average, only 2.3% of healthy controls had GPC1+ exosomes.

1. Exemplary protocol for collecting exosomes from cell cultures

On day 1, enough cells (e.g., about five million cells) were seeded in medium containing 10% FBS in T225 flasks so that the next day cells would be about 70% confluent. On day 2, the media on the cells was aspirated, the cells were washed twice with PBS, and then 25mL to 30mL of basal media (i.e., no PenStrep or FBS) was added to the cells. The cells were incubated for 24 to 48 hours. 48 hours incubation is preferred, but some cell lines are more sensitive to serum-free medium, and therefore incubation times should be reduced to 24 hours. It should be noted that FBS contains exosomes that would severely bias NanoSight results.

At day 3/4, the medium was collected and centrifuged at 800 x. g for five minutes at room temperature to pellet dead cells and large debris. The supernatant was transferred to a new conical tube and the medium was centrifuged again at 2000 × g for 10 min to remove other large debris and large vesicles. The medium was passed through a 0.2 μm filter and then an aliquot was added to an ultracentrifuge tube (e.g., 25 x 89mm beckmann ultraclarification) using a 35 ml/tube. If the volume of medium per tube is less than 35mL, fill the remainder of the tube with PBS to achieve 35 mL. The medium was ultracentrifuged at 28,000 rpm for 2 to 4 hours at 4 ℃ using SW 32Ti rotor (k-factor 266.7, RCF max 133,907). The supernatant was carefully aspirated until approximately 1-inch of remaining liquid was present. The tube was tilted and the remaining media was allowed to slowly enter the aspirator pipette. If desired, the exosome pellet may be resuspended in PBS and ultracentrifuged at 28,000 rpm for a repeat of 1 to 2 hours to further purify the population of exosomes.

Finally, resuspended exosomes were pelleted in 210uL PBS. If there are multiple ultracentrifuge tubes for each sample, the same 210 μ L PBS is used to resuspend each exosome pellet in succession. For each sample, 10 μ L was collected and 990 μ L H was added₂O for nanoparticle tracking analysis. The remaining 200 μ L of exosome-containing suspension was used for downstream processes or immediately stored at-80 ℃.

2. Exemplary protocol for exosome extraction from serum samples

First, serum samples were thawed on ice. Then, 250 μ L of the cell-free serum sample was diluted in 11mL PBS; filtration through a 0.2 μm pore filter. The diluted samples were ultracentrifuged at 150,000 Xg at 4 ℃ overnight. The next day, the supernatant was carefully discarded and the exosome pellet was washed in 11mL PBS. A second round of ultracentrifugation was performed at 150,000 Xg for 2 hours at 4 ℃. Finally, the supernatant was carefully discarded and the exosome pellet was resuspended in 100 μ Ι _ PBS for analysis.

C. Exemplary protocols for electroporation of exosomes and liposomes

In 400. mu.L of electroporation buffer (1.15mM potassium phosphate, pH 7.2, 25mM potassium chloride, 21% Optiprep), 1X 10 was mixed⁸Individual exosomes (measured by NanoSight analysis) or 100nm liposomes (e.g., available from Encapsula Nano Sciences) and 1 μ g siRNA (Qiagen) or shRNA. Exosomes or liposomes were electroporated using 4mm cuvettes (see, e.g., Alvarez-Erviti et al, 2011; EL-Andaloussi et al, 2012). Following electroporation, the exosomes or liposomes are treated with rnase without protease, followed by the addition of 10 x concentrated rnase inhibitor. Finally, exosomes or liposomes were washed with PBS under ultracentrifugation method as described above.

Diagnosis, prognosis and treatment of diseases

The detection, isolation and characterization of cancer cell-derived exosomes using the methods of the present invention can be used to assess cancer prognosis and monitor efficacy of treatment, in order to detect early treatment failures that can cause disease recurrence. Furthermore, the cancer cell-derived exosome assay according to the present invention enables the detection of early relapse in pre-symptomatic patients who have completed the course of treatment. This may be because the presence of cancer cell-derived exosomes may be associated and/or correlated with tumor progression and spread, poor response to treatment, disease recurrence, and/or reduced survival over a certain period of time. Thus, enumeration and characterization of cancer cell-derived exosomes provides a means to classify patients relative to baseline features that predict initial and subsequent risk based on response to therapy.

Cancer cell-derived exosomes isolated according to the methods disclosed herein can be analyzed to diagnose or prognose cancer in a subject. Thus, the methods of the invention can be used, for example, to assess cancer patients and those at risk for cancer. In any of the methods of diagnosis or prognosis described herein, the presence or absence of one or more indicators of cancer (such as genomic mutations or cancer-specific exosome surface markers) or of any other condition may be used to generate a diagnosis or prognosis.

In one aspect, a blood sample is drawn from a patient and cancer cell-derived exosomes are detected and/or isolated as described herein. For example, the exosomes may be labeled with one or more antibodies or aptamers that bind to ATP-binding cassette subfamily a member 6(ABCA6), tetraspanin-4 (TSPAN4), SLIT and NTRK class protein 4(SLITRK4), putative protocadherin β -18(PCDHB18), myeloid cell surface antigen CD33(CD33), and/or glypican-1 (GPC1), and the antibodies may have a covalently bound fluorescent label. Analysis may then be performed to determine the number and characterization of cancer cell-derived exosomes in the sample, and from this measurement, the number of cancer cell-derived exosomes present in the initial blood sample may be determined. Exosomes identified as cancer cell-derived exosomes may thus be validated by detecting a second (or more) marker known to be selectively or specifically found in cancer cell-derived exosomes, e.g., histone H2A type 2-a (HIST1H2AA), histone H2A type 1-a (HIST1H1AA), histone H3.3(H3F3A), histone H3.1(HIST1H3A), zinc finger protein 37 homolog (ZFP37), laminin subunit beta-1 (LAMB1), tubulointerstitial nephritis antigens (TINAGL1), peroxiredoxin-4 (prprdx 4), collagen alpha-2 (IV) chain (COL4a2), putative protein C3P1(C3P1), extracellular matrix protein-1 (HMCN1), rho-binding protein of collagen alpha-2 (IV) chain (COL4a2), putative protein C3P 462 (C3P1), ankyrin-containing structural protein ankyrin 8536 (rhd 8925), ankyrin-containing structural repeat domain of protein, Triplex motif-containing protein 42(TRIM42), desmosomal plakoglobin (JUP), tubulin beta-2B chain (TUBB2B), endoribonuclease DICER (DICER1), E3 ubiquitin-protein ligase TRIM71(TRIM71), swordein p60 ATPase-containing subunit A class 2(KATNAL2), protein S100-A6(S100A6), 5' -nucleotidase domain-containing protein 3(NT5DC3), valine-tRNA ligase (VARS), Kazrin KAZN), ELAV class 4(ELAVL4), cyclophalan 166(RNF166), FERM and PDZ domain-containing protein 1(FRMPD1), 78kDa glucose regulatory protein (HSPA5), transportprotein particle complex subunit 6A (PPC 6 TRA A), squalene monooxygenase (SQ 101), SQFERM 101, TSG101, VEGF receptor negative homolog of PGA (PTCoA 28), prostaglandin-PGA receptor negative PGA 28, and PGA, Mitochondria (ACAD8), 26S protease regulatory subunit 6B (PSMC4), elongation factor 1-gamma (EEF1G), myoglobin (TTN), tyrosine-protein phosphatase type 13(PTPN13), triose phosphate isomerase (TPI1), or carboxypeptidase e (cpe). The number of cancer cell-derived exosomes can be determined by cytological or microscopic techniques to visually quantify and characterize the exosomes. Cancer cell-derived exosomes may be detected and quantified by other methods known in the art (e.g., ELISA).

In various aspects, the analysis and characterization of the number of cancer cell-derived exosomes of a subject may be performed at various intervals over a specific time course to assess the subject's progression and pathology. For example, the analysis may be performed at regular intervals, such as one day, two days, three days, one week, two weeks, one month, two months, three months, six months, or one year, in order to track the level and characterization of cancer cell-derived exosomes as a function of time. In the case of existing cancer patients, this provides a useful indication of the progression of the disease and helps the practitioner make appropriate treatment options based on the increase, decrease or lack of alteration of cancer cell-derived exosomes. Any increase in cancer cell-derived exosomes over time (2-fold, 5-fold, 10-fold or more) reduces the patient's prognosis and is an early indicator that the patient should change treatment. Similarly, any increase (2-fold, 5-fold, 10-fold or greater) indicates that the patient should undergo further testing such as imaging to further assess prognosis and response to treatment. Any decrease in cancer cell-derived exosomes over time (2-fold, 5-fold, 10-fold or higher) indicates stable disease and patient response to treatment, and is an indicator of no change in treatment. For those at risk of cancer, a sudden increase in the number of detected cancer cell-derived exosomes may provide an early warning that the patient has developed a tumor, and thus provide an early diagnosis. In one embodiment, the detection of cancer cell-derived exosomes increases with the stage of the cancer.

In any of the methods provided herein, additional analysis may also be performed to characterize cancer cell-derived exosomes to provide additional clinical assessments. For example, in addition to image analysis and mass quantitative measurements, PCR techniques can be employed, such as multiplex amplification with primers specific for specific cancer markers, to obtain information such as the type of tumor from which the cancer cell-derived exosomes originated, metastatic state, and extent of malignancy. Furthermore, as a means of assessing additional information regarding the characterization of a patient's cancer, DNA or RNA analysis, proteomic analysis, or metabolomic analysis may be performed.

For example, the additional analysis may provide data sufficient to perform a determination of the responsiveness of a subject to a particular therapeutic regimen, or for determining the effect of a candidate agent in treating cancer. Accordingly, the present invention provides methods for determining responsiveness of a subject to a particular therapeutic regimen or determining the effect of a candidate agent in treating cancer by detecting/isolating cancer cell-derived exosomes of a subject as described herein and analyzing the cancer cell-derived exosomes. For example, once a drug treatment is administered to a patient, it is possible to determine the efficacy of the drug treatment using the methods of the present invention. For example, a sample taken from a patient prior to a drug treatment, and one or more samples taken from a patient simultaneously with or after a drug treatment, may be processed using the methods of the invention. By comparing the results of the analysis for each of the treated samples, the efficacy of the drug treatment or the responsiveness of the patient to the agent can be determined. In this way, early identification may consist of failed compounds, or early confirmation may consist of promising compounds.

Certain aspects of the invention provide for treating a patient with exosomes expressing or comprising a therapeutic or diagnostic agent. As used herein, a "therapeutic agent" is an atom, molecule or compound that can be used to treat cancer or other conditions. Examples of therapeutic agents include, but are not limited to, drugs, chemotherapeutic agents, therapeutic antibodies and antibody fragments, toxins, radioisotopes, enzymes, nucleases, hormones, immunomodulators, antisense oligonucleotides, chelators, boron compounds, photosensitive agents and dyes. As used herein, a "diagnostic agent" is an atom, molecule or compound that can be used to diagnose, detect or observe a disease. According to embodiments described herein, diagnostic agents may include, but are not limited to, radioactive substances (e.g., radioisotopes, radionuclides, radioisotope labels, or radiotracers), dyes, contrast agents, fluorescent compounds or molecules, bioluminescent compounds or molecules, enzymes, and enhancers (e.g., paramagnetic ions).

In some aspects, the therapeutic recombinant protein can be a protein having an activity that has been lost in a cell of a patient, a protein having a desired enzymatic activity, a protein having a desired inhibitory activity, or the like. For example, the protein may be a transcription factor, an enzyme, a protein toxin, an antibody, a monoclonal antibody, and the like. Monoclonal antibodies can specifically or selectively bind to intracellular antigens. Monoclonal antibodies can inhibit the function of intracellular antigens and/or disrupt protein-protein interactions. Other aspects of the invention provide for diagnosing a disease based on the presence of cancer cell-derived exosomes in a patient sample.

Because exosomes are known to contain the mechanisms necessary for complete mRNA transcription and protein translation (see PCT/US2014/068630, which is incorporated herein by reference in its entirety), mRNA or DNA nucleic acids encoding therapeutic proteins can be transfected into exosomes. Alternatively, the therapeutic protein itself may be electroporated into the exosomes or incorporated directly into the liposomes. Exemplary therapeutic proteins include, but are not limited to, tumor suppressor proteins, peptides, wild-type protein counterparts to muteins, DNA repair proteins, proteolytic enzymes, protein toxins, proteins that can inhibit the activity of an intracellular protein, proteins that can activate the activity of an intracellular protein, or any protein whose loss of function requires reconstitution. Specific examples of exemplary therapeutic proteins include 123F2, Abcb4, Abcc1, Abcg2, Actb, Ada, Ahr, Akt2, Amhr2, Anxa 2, Apc, Ar, Atm, Axin2, B2 2, Bard 2, Bcl211, Becn 2, Bhlha 2, Bin 2, Blum, Braff, Brca2, Bracafta 2, Brinccs 2, Brip 2, Buwscr 12, Cadm 2, Ccc 2, Ccp 2, Cdp 2, Cdfrd 2, Cdfrc 2, Cdfrd, Hexa, Hic1, Hin1, Hmmr, Hnpcc8, Hprt, Hras, Htatip2, Il1b, Il10, Il2, Il6, Il8Rb Inha, Itgav, Jun, Jak3, Kit, Klf4, Kras 4, Kras 24, Lig4, ligg 4, Lmo 4, Lncr4, Pncr 4, Ppoch 4, Pfpr 4, Ptc 4, Pfpr 4, Ptc 4, Megan 4, Nbth 4, Pfpr 4, P4, Pfpr 4, P4, Pfpr 4, P4, Pfpr 4, P4, Pfpr 4, P4, Pfpr 4, P4, P4, Pfpr 4, Pfpr 4, P4, P4, Pfpr 4, P4, Pfpr 4, P4, Pfpr 4, P4, P4, P4, P4, Pfpr 4, P4, P4, P4, Pfpr 4, P4, 36, Rb12, Recg14, Ret, Rgs5, Rhoc, Rint1, Robo1, Rpl38, S100A4, SCGB1A1, Skp2, Smad2, Smad3, Smad4, Smartb 1, Smo, Snx25, Spata13, Srpx, Ssic1, Sstr2, Sstr5, Stat3, St5, St7, St14, Stk11, Suds3, Tap 3, Tbx 3, Terc, Tnf, 3, Tp 3, Tpc 3, Tsc 3, Tsch 3, Vvh 3, Wrn 3, Wt 3, Xrcc 3, and Zrcc 3.

One particular type of protein that may be expected to be introduced into the intracellular space of diseased cells is an antibody (e.g., a monoclonal antibody). Such antibodies may disrupt the function of intracellular proteins and/or disrupt intracellular protein-protein interactions. Exemplary targets for such monoclonal antibodies include, but are not limited to, proteins associated with the RNAi pathway, telomerase, transcription factors that control disease processes, kinases, phosphatases, proteins required for DNA synthesis, proteins required for protein translation. Specific examples of exemplary therapeutic antibody targets include proteins encoded by the following genes: dicer, Ago1, Ago2, Trbp, Ras, raf, wnt, btk, Bcl-2, Akt, Sis, src, Notch, Stathmin, mdm2, ab1, hTERT, c-fos, c-jun, c-myc, erbB, HER2/Neu, HER3, VEGFR, PDGFR, c-kit, c-met, c-ret, flt3, API, AML1, 1, alk, fins, fps, gip, lck, Stat, Hox, MLM, PRAD-I and trk. In addition to monoclonal antibodies, any antigen binding fragment is contemplated herein, such as scFv, Fab fragments, Fab ', F (ab') 2, Fv, peptibodies, diabodies, triabodies, or minibodies. Any such antibody or antibody fragment may be glycosylated or aglycosylated.

Because exosomes are known to comprise DICER and active RNA-processing RISC complexes (see PCT publication WO 2014/152622, which is incorporated herein by reference in its entirety), shrnas transfected into exosomes can mature into RISC-complexes that bind siRNA to the exosomes themselves. Alternatively, the mature siRNA itself may be transfected into exosomes or liposomes. Thus, by way of example, the following are classes of potential target genes that may be used in the methods of the invention to modulate or attenuate target gene expression: wild-type or mutant forms of developmental genes (e.g., adhesion molecules, cyclin kinase inhibitors, Wnt family members, Pax family members, winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth or differentiation factors and their receptors, neurotransmitters and their receptors), tumor suppressor genes (e.g., APC, CYLD, HIN-1, KRAS2b, p16, p19, p21, p27, p27mt, p53, PTEN, Rb, globin, Skp 53, BRCA-1, BRCA-2, CHK 53, CDKN2 53, DCC, DPC 53, MADR 53/JV 53, MEN 53, CACS 53, NF 53, WRL, WT 53, CFTR, C-361, HYZAC 53, MRASC 53, MEN 53, MCAS 53, BCA-7, BCA-53, BCA-7, BCA-53, BCA-7, BCA-3, BCA-53, BCA-3, BCA-X-7, BCA-X-3, BCA (BCA-X-B-X-B-X-B, BCA, BC, Gene 21(NPRL2), or a gene encoding SEM A3 polypeptide), a pro-apoptotic gene (e.g., CD95, caspase-3, Bax, Bag-1, CRADD, TSSC3, Bax, hid, Bak, MKP-7, PARP, bad, bcl-2, MST1, bbc3, Sax, BIK, and BID), a cytokine (e.g., GM-CSF, G-CSF, IL-1 α, IL-1 β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, and IL-17, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IFN- α, IFN-p, IFN- γ, MIP-1 α, MIP-1 β, TGF-p, TNF- α, TNF- β, PDGF, and mda7), oncogenes (e.g., ABLI, BLC1, BCL6, CBFA1, CBL, CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS1, ETV6, FGR, FOX, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS, 1, PML, RET, SRC, TAL1, TCL3, and YES), and enzymes (e.g., desaturase and hydroxylase, glucase, glucosidase, ADP, peroxidase, ADP, DNA decarboxylase, amylase, and xylanase, amylase, xylanase, and beta, xylanase, Galactosidase, glucanase, glucose oxidase, gtpase, helicase, hemicellulase, integrase, invertase, isomerase, kinase, lactase, lipase, lipoxygenase, lysozyme, nuclease, pectinesterase, peroxidase, phosphatase, phospholipase, phosphorylase, polygalacturonase, protease and peptidase, pullulanase, recombinase, reverse transcriptase, topoisomerase, xylanase). In some cases, the sh/siRNA can be designed to specifically target a mutant form of a gene expressed in cancer cells, while not affecting the expression of the corresponding wild-type form. Indeed, any inhibitory nucleic acid that can be used in the compositions and methods of the invention if such inhibitory nucleic acid has been found by any source to be a proven down regulator of the protein of interest.

In designing RNAi, there are several factors to consider, such as the nature of the siRNA, the persistence of the silencing effect and the choice of delivery system. To produce an RNAi effect, the siRNA introduced into an organism will typically contain an exon sequence. In addition, the RNAi process is homology dependent, so the sequences must be carefully selected to maximize gene specificity while minimizing the possibility of cross-interference between homologous, rather than gene-specific, sequences. Preferably, the siRNA exhibits greater than 80%, 85%, 90%, 95%, 98% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences that are less than about 80% identical to the target gene are substantially less effective. Thus, the higher the degree of homology between the siRNA and the gene to be inhibited, the less likely it will be to affect expression of an unrelated gene.

In addition to protein-based and nucleic acid-based therapeutic agents, exosomes may be used to deliver small molecule drugs, alone or in combination with any protein-based or nucleic acid-based therapeutic agent. Exemplary small molecule drugs contemplated for use in embodiments of the invention include, but are not limited to, toxins, chemotherapeutic agents, agents that inhibit the activity of intracellular proteins, agents that activate the activity of intracellular proteins, agents for preventing restenosis, agents for treating kidney disease, agents for intermittent claudication, agents used in treating hypotension and shock, angiotensin converting enzyme inhibitors, anti-angina agents, anti-arrhythmias, anti-hypertensive agents, angiotensin ii receptor antagonists, anti-platelet drugs, b-blockers selective to b1, beta blockers, plant products for cardiovascular indications, calcium channel blockers, cardiovascular/diagnostic agents, central alpha-2 promoters, coronary vasodilators, diuretics and renal tubule inhibitors, neutral endopeptidase/angiotensin converting enzyme inhibitors, Peripheral vasodilators, potassium channel openers, potassium salts, anticonvulsants, antiemetics, anti-cardiopathies, anti-Parkinson's (anti-parkinson) agents, antispasmodics, cerebral stimulants, agents applicable to the treatment of trauma, agents applicable to the treatment of Alzheimer's (Alzheimer's) disease or dementia, agents applicable to the treatment of migraine, agents applicable to the treatment of neurodegenerative disease, agents applicable to the treatment of Kaposi's (Kaposi) sarcoma, agents applicable to the treatment of AIDS, cancer chemotherapeutics, agents applicable to the treatment of immunological disorders, agents applicable to the treatment of psychiatric disorders, analgesics, epidural and intrathecal anesthetics, general, local, regional neuromuscular blocking sedatives, adrenocorticotropic/corticotropic hormones before anesthesia, anabolic steroids, anti-spasmodics, anti-Parkinson's (anti-Parkinson's) agents, anti-spasmodics, cerebral stimulants, agents applicable to the treatment of trauma, agents, anti-seizure agents, anti-inflammatory agents, anti-neurodegenerative agents, anti-inflammatory agents, anti-seizure agents, anti-inflammatory drugs for treating Alzheimer's disease, anti-inflammatory drugs for treating Alzheimer's, anti-inflammatory drugs for treating neurodegenerative diseases, anti-inflammatory drugs for treating conditions, anti-inflammatory drugs for treating, Agents that can be used in the treatment of diabetes, dopamine agonists, growth hormones and analogues, hyperglycemic agents, hypoglycemic agents, oral insulin, high volume injections (1vps), lipid altering agents, metabolic studies and inborn errors of metabolism, nutrients/amino acids, nutritional 1vps, antiobesity agents (anorectics), somatostatin, thyroid agents, vasopressin, vitamins, corticosteroids, mucolytic agents, pulmonary anti-inflammatory agents, lung surfactants, antacids, anticholinergics, antidiarrheals, antiemetics, cholelithiasis agents, inflammatory bowel disease agents, irritable bowel disease agents, liver agents, metal chelators, miscellaneous gastric secretion agents, pancreatitis agents, pancreatic enzymes, prostaglandins, proton pump inhibitors, sclerosing agents, sucralfate, antiprogestin, contraceptives, oral insulin, bolus injections, mucolytic agents, and gastric cancer, Oral contraceptives, non-oral dopamine agonists, estrogens, gonadotropins, GNRH agonists, GHRH antagonists, oxytocics, progestins, uterine agents, anti-anemia agents, anticoagulants, anti-fibrinolytics, antiplatelet agents, antithrombin agents, coagulants, fibrinolytics, hematologic disorders, heparin inhibitors, metal chelators, prostaglandins, vitamin K, antiandrogens, aminoglycosides, antibacterial agents, sulfonamides, cephalosporins, clindamycin, dermatological agents, cleansers, erythromycin, anthelmintic agents, antifungal agents, antimalarials, antimycobacterial agents, antiparasitic agents, antiprotozoal agents, antichlortols, immunomodulators, immunostimulants, macrolides, antiparasitic agents, corticosteroids, cyclooxygenase inhibitors, enzyme blockers for immune modulators of rheumatism, Metalloproteinase inhibitors, non-steroidal anti-inflammatory agents, analgesics, antipyretics, alpha adrenergic agonists/blockers, antibiotics, antivirals, beta adrenergic blockers, carbonic anhydrase inhibitors, corticosteroids, immune system modulators, mast cell inhibitors, non-steroidal anti-inflammatory agents, and prostaglandins.

Exosomes may also be used to deliver diagnostic agents. Exemplary diagnostic agents include, but are not limited to, magnetic resonance image enhancing agents, positron emission tomography products, radiodiagnostic agents, radiotherapeutic agents, radioopaque contrast agents, radiopharmaceuticals, ultrasound imaging agents, and angiographic diagnostic agents.

The term "subject" as used herein refers to any individual or patient on whom the methods of the invention are performed. Typically the subject is a human, but as will be appreciated by those skilled in the art, the subject may be an animal. Thus, other animals, including mammals such as rodents (including mice, rats, hamsters, and guinea pigs), cats, dogs, rabbits, farm animals (including cows, horses, goats, sheep, pigs, and the like), and primates (including monkeys, chimpanzees, orangutans, and gorillas) are included within the definition of subject.

"treating" and "treated" refer to administering or administering a therapeutic agent to a subject, or performing surgery or instrumental treatment on a subject in order to obtain a therapeutic benefit for a disease or health-related disorder. For example, the treatment may include administration of chemotherapy, immunotherapy, or radiotherapy, performance of surgery, or any combination thereof.

The term "therapeutic benefit" or "therapeutically effective" as used herein refers to anything that promotes or enhances the health of a subject with respect to a pharmaceutical treatment for this condition. This includes, but is not limited to, a reduction in the frequency or severity of signs or symptoms of disease. For example, treatment of cancer may involve, for example, reduction in tumor invasiveness, reduction in cancer growth rate, or prevention of metastasis. Treatment of cancer may also involve prolonging the survival of a subject with cancer.

As used herein, the term "cancer" may be used to describe a solid tumor, a metastatic cancer or a non-metastatic cancer. In certain embodiments, the cancer may arise in the bladder, blood, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gingiva, head, kidney, liver, lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus.

The cancer may be specifically of the following histological types, but is not limited to these: neoplasma; a malignant tumor; cancer and tumor; cancer and tumor; undifferentiated carcinoma; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphatic epithelial cancer; basal cell carcinoma; hair matrix cancer; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinomas; bile duct cancer; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; adenocarcinoma, familial polyposis escherichia coli; a solid cancer; malignant carcinoid tumors; bronchioloadenocarcinoma; papillary adenocarcinoma; a cancer of the chromophobe; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic leukemia; clear cell adenocarcinoma; a crystalline cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; non-encapsulated sclerosing carcinomas; adrenal cortex carcinoma; endometrioid carcinoma; skin adnexal carcinoma; apocrine adenocarcinoma; sebaceous gland cancer; cerumen adenocarcinoma; mucoepidermoid carcinoma; cystic carcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive ductal carcinoma; medullary cancer; lobular carcinoma; inflammatory cancer; paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; malignant thymoma; malignant ovarian stromal tumors; malignant blastocyst cell tumors; malignant granulosa cell tumors; malignant testicular blastoma; seltory cell carcinoma; malignant leydig cell tumors; malignant lipid cell tumors; malignant paraganglioma; malignant external paraganglioma of mammary gland; pheochromocytoma; fascial fibrosarcoma; malignant melanoma; achrominomatous melanoma; superficial diffusible melanoma; malignant melanoma in giant pigmented nevi; epithelial-like cell melanoma; malignant blue nevus; a sarcoma; fibrosarcoma; malignant fibrous histiocytoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mullerian (mullerian) hybridomas; renal blastoma; hepatoblastoma; a carcinosarcoma; malignant mesenchymal tumor; malignant tumor of brenner's disease; malignant phyllo-tumor; synovial sarcoma; malignant mesothelioma; clonal cell tumors; an embryonic carcinoma; malignant teratoma; malignant ovarian thyroid tumors; choriocarcinoma; malignant mesonephroma; vascular endothelioma; malignant vascular endothelioma; kaposi's sarcoma; malignant extravascular dermatoma; lymphangioleiomyosarcoma; osteosarcoma; compact paraosteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal cell chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; malignant odontogenic tumors; amelogenic cell dental sarcoma; malignant ameloblastic tumors; glazed fibrosarcoma; malignant pineal tumor; chordoma; malignant glioma; ependymoma; astrocytoma; primary plasma astrocytoma; myofibrillar astrocytomas; astrocytomas; glioblastoma; oligodendroglioma; oligodendroglioma; primary neuroectoderm; cerebellar sarcoma; nodal neuroblastoma; neuroblastoma; retinoblastoma; a nasal neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant schwannoma; malignant crystalline cell tumors; malignant lymphoma; hodgkin's disease; hodgkin's; granuloma paratuberis; malignant small lymphocytic lymphoma; malignant large cell, diffuse lymphoma; malignant follicular lymphoma; mycosis fungoides; other non-hodgkin's lymphoma designated; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small bowel disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. However, it is also to be appreciated that the invention can also be used to treat non-cancerous diseases (e.g., fungal infections, bacterial infections, viral infections, neurodegenerative diseases, and/or genetic disorders).

The terms "contacting" and "exposing," as applied to a cell, are used herein to describe the process by which a therapeutic agent is delivered to or placed in direct juxtaposition with a target cell. To achieve cell killing, for example, one or more agents are delivered to the cells in an amount effective to kill the cells or prevent them from dividing.

An effective response by a patient or "responsiveness" of a patient to a treatment refers to conferring a clinical or therapeutic benefit to a patient at risk for or suffering from a disease or disorder. Such benefits may include a cellular or biological response, a complete response, a partial response, stable disease (no progression or relapse), or a response with a later relapse. For example, an effective response may reduce tumor size or progression-free survival of a patient diagnosed with cancer.

The outcome of a treatment can be predicted and monitored and/or patients who benefit from such treatment can be identified or selected via the methods described herein.

With respect to the treatment of neoplastic disorders, depending on the stage of the neoplastic disorder, treatment of neoplastic disorders involves one or a combination of the following therapies: surgery to remove neoplastic tissue, radiation therapy, and chemotherapy. Other therapeutic regimens may be combined with administration of anti-cancer agents, such as therapeutic compositions and chemotherapeutic agents. For example, a patient to be treated with such an anti-cancer agent may also receive radiation therapy and/or may undergo surgery.

For the treatment of a disease, the appropriate dosage of the therapeutic composition will depend on the type of disease to be treated, as defined above, the severity and course of the disease, the patient's clinical history and response to the agent, and the judgment of the attending physician. The agent is suitably administered to the patient once or over a series of treatments.

Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect. The tissue, tumor, or cell may be contacted with one or more compositions or one or more pharmacological formulations comprising one or more of the agents, or by contacting the tissue, tumor, and/or cell with two or more different compositions or formulations. In addition, it is contemplated that such combination therapies may be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy.

Administration in a combined manner may include simultaneous administration of two or more agents in the same dosage form, simultaneous administration in separate dosage forms, and separate administration. That is, the therapeutic composition of the present invention and the other therapeutic agent may be formulated together in the same dosage form and administered simultaneously. Alternatively, the therapeutic composition of the invention and another therapeutic agent may be administered simultaneously, wherein both agents are present in separate formulations. In another alternative, a therapeutic agent may be administered immediately following another therapeutic agent, or vice versa. In a separate administration regimen, the therapeutic composition of the invention and the other therapeutic agent may be administered minutes apart or hours apart or days apart.

The first anti-cancer treatment (e.g., exosomes expressing recombinant proteins or having recombinant proteins isolated from exosomes) may be administered before, during, after, or in various combinations relative to the second anti-cancer treatment. The administration may be at intervals ranging from simultaneous to minutes to days to weeks. In embodiments where the first treatment is provided to the patient independently of the second treatment, it will generally be ensured that there will be no significant period of time between each delivery time so that the two compounds will still be able to exert a favorable combined effect on the patient. In such cases, it is contemplated that the first and second therapies may be provided to the patient within about 12 hours to 24 hours or 72 hours of each other, and, more specifically, within about 6 hours to 12 hours of each other. In some cases, it may be desirable to significantly extend the treatment period, with days (2, 3, 4,5, 6, or 7) to weeks (1, 2, 3, 4,5, 6, 7, or 8) elapsing between separate administrations.

In certain embodiments, the healing process will last from 1 day to 90 days or longer (such ranges include intervening days). It is contemplated that one agent may be administered on any one of or any combination of days 1 through 90 (such range includes intervening days), and that another agent is administered on any one of or any combination of days 1 through 90 (such range includes intervening days). One or more administrations of one or more agents may be given to the patient over a single day (24 hour period). Furthermore, following the healing process, it is expected that there will be a period of time when no anti-cancer treatment is administered. Depending on the condition of the patient, such as its prognosis, intensity, health, etc., this period may last from 1 day to 7 days, and/or from 1 week to 5 weeks, and/or from 1 month to 12 months or longer (such ranges include intervening days). It is contemplated that the treatment cycle will be repeated as needed.

Various combinations may be employed. For the following examples, the first anti-cancer therapy is "a" and the second anti-cancer therapy is "B":

A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A

administration of any compound or therapy of the invention to a patient will follow a general protocol for administration of such compounds, taking into account the toxicity of the agent, if present. Thus, in some embodiments, there is a step of monitoring toxicity attributable to the combination therapy.

1. Chemotherapy

Various chemotherapeutic agents may be used in accordance with the present invention. The term "chemotherapy" refers to the use of drugs to treat cancer. "chemotherapeutic agent" is used to mean a compound or composition that is administered in the treatment of cancer. These agents or drugs are classified by their activity pattern within the cell, e.g., whether they affect the cell cycle and at what stage they affect the cell cycle. Alternatively, agents can be characterized based on their ability to directly cross-link DNA, insert into DNA, or induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis.

Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines, such as bendazol, carboquone, miltdopa, and ulidopa; ethyleneimine and methyl melamine, including hexamethylmelamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylolmelamine; acetogenins (especially bullatacin and bullatacin ketone); camptothecin (including the synthetic analog topotecan); bryodin; a colistin; CC-1065 (including its aldorexin, kazelaixin, and bizelaixin synthetic analogs); nostoc cyclopeptides (specifically nostoc cyclopeptide 1 and nostoc cyclopeptide 8); dolastatin; duocarmycins (including synthetic analogs, KW-2189 and CB1-TM 1); an exercinogen; discordatin; a statin of salbutamol; a sponge toxin; nitrogen mustards, such as chlorambucil, napthalamine, cholorfamide, estramustine, ifosfamide, mechlorethamine hydrochloride, melphalan, neomechlorethamine, mechlorethamine, prednimustine, trofosfamide and uracil mustard; nitrosoureas such as carmustine, chlorouramicin, fotemustine, lomustine, nimustine and ranimustine; antibiotics, such as enediyne antibiotics (e.g., calicheamicin, especially calicheamicin γ lI and calicheamicin QI 1); damicine, including damicine a; bisphosphonates, such as clodronate; an esperamicin; and neooncostatin chromophore and related chromoprotein enediyne antibiotic chromophores, aclacinomycin, actinomycin, autharnycin, azaserine, bleomycin, actinomycin C, carubicin, carminomycin, canceromycin, tryptophycetin D, daunorubicin, ditobicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholinyl-doxorubicin, cyanomorpholinyl-doxorubicin, 2-pyrrolinyl-doxorubicin, and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, sisomicin, mitomycins such as mitomycin C, mycophenolic acid, nogaxomycin, olivomycin, pelubicin, doxycycline, puromycin, quinomycin, roxobicin, streptonigrin, streptonigromycin, tubercidin, ubenicidin, ubenicillin, ubenimex, actinomycin, bleomycin, actinomycin, bleomycin, and the like, Netastatin and levorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as dinotefuran, pteropterin, and trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiaguanine and thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, bisdeoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens such as dimethyltestosterone, methylandrostanolone propionate, epithioandrostanol, meiandrostane, and testolactone; anti-adrenal glands, such as mitotane and trilostane; folic acid replenisher such as folinic acid; acetic acid glucurolactone; an aldehydic phosphoramide glycoside; aminolevulinic acid; eniluracil; amsacrine; double Sita cloth; bishan mountain group; idaquke; obtaining the flumetralin; colchicine; diazaquinone; alfasin; eletronium acetate; an epothilone; etoglut; gallium nitrate; a hydroxyurea; lentinan; ronidaning; maytansinoids, such as maytansine and ansamitocins; propionylaminohydrazone; mitoxantrone; mopidanol; nitravirin; gustatostatin; vannamine; pirarubicin; losoxanthraquinone; podophyllinic acid; 2-acethydrazide; (ii) procarbazine; PSK polysaccharide complex; lezoxan; rhizomycin; (ii) a cilostant; helical germanium; alternarionic acid; a tri-imine quinone; 2, 2', 2 "-trichlorotriethylamine; trichothecene toxins (especially T-2 toxin, verrucosin A, bacillocin A and serpentine); uratan; vindesine; dacarbazine; mannomustine; dibromomannitol; dibromodulcitol; pipobroman; methacin; arabinoside ("Ara-C"); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; mitoxantrone; teniposide; edatrexae; daunomycin; aminopterin; (ii) Hirodad; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluoromethyl ornithine (DMFO); retinoids, such as retinoic acid; capecitabine; carboplatin, procarbazine, plicamycin, gemcitabine, noviben, farnesyl-protein transferase inhibitors, antiplatin, and pharmaceutically acceptable salts, acids, or derivatives of any of the above.

2. Radiation therapy

Other factors that cause DNA damage and have been widely used include factors commonly referred to as gamma rays, X-rays, and/or radioisotopes delivered directly to tumor cells. Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam radiation (U.S. Pat. nos. 5,760,395 and 4,870,287), and ultraviolet radiation. Most likely all of these factors cause extensive damage to DNA, DNA precursors, replication and repair of DNA, and assembly and maintenance of chromosomes. The dose of X-rays ranges from a daily dose of 50 to 200 roentgens for a long period of time (3 to 4 weeks) to a single dose of 2000 to 6000 roentgens. The dosage range of radioisotopes varies widely, and depends on the half-life of the isotope, the intensity and type of radiation emitted, and the uptake by neoplastic cells.

3. Immunotherapy

One skilled in the art will appreciate that additional immunotherapy may be used in combination or conjunction with the methods of the present invention. In the context of cancer treatment, immunotherapeutics generally rely on the use of immune effector cells and molecules that target and destroy cancer cells. RituximabAre examples of this type. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may be used as an effector of the therapy or it may recruit other cells to actually effect cell killing. Antibodies can also bind to drugs or toxins (chemotherapeutics, radionuclides, ricin a chain, cholera toxin, pertussis toxin, etc.) and serve only as targeting agents. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts directly or indirectly with the tumor cell target. A variety of effector cells include cytotoxic T cells and NK cells.

In one aspect of immunotherapy, tumor cells must bear some suitable markers for targeting (i.e., not present on most other cells). There are many tumor markers and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, sialyl Lewis antigen, MucA, MucB, PLAP, laminin receptor, erb B, and p 155. An alternative aspect of immunotherapy is to combine an anti-cancer effect with an immunostimulatory effect. Immunostimulatory molecules also exist, including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, γ -IFN, chemokines such as MIP-1, MCP-1, IL-8, and growth factors such as FLT3 ligand.

Examples of immunotherapies currently under investigation or in use are immune adjuvants, such as Mycobacterium bovis (Mycobacterium bovis), Plasmodium falciparum (Plasmodium falciparum), dinitrochlorobenzene and aromatics (U.S. Pat. Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al, 1998); cytokine therapies, e.g., interferon alpha, beta, and gamma, IL-1, GM-CSF and TNF (Bukowski et al, 1998; Davidson et al, 1998; Hellstrand et al, 1998); gene therapy, for example, TNF, IL-1, IL-2 and p53(Qin et al, 1998; Austin-Ward and Villaseca, 1998; U.S. Pat. Nos. 5,830,880 and 5,846,945); and monoclonal antibodies, e.g., anti-CD 20, anti-ganglioside GM2, and anti-p 185(Hollander, 2013; Hanibuchi et al, 1998; U.S. Pat. No. 5,824,311). One or more anti-cancer therapies are contemplated that can be employed with the antibody therapies described herein.

4. Surgery

About 60% of people with cancer will undergo some type of surgery, including preventative, diagnostic or staging, curative and palliative surgery. Curative surgery includes resection, in which all or part of the cancerous tissue is physically removed, excised, and/or destroyed, and may be used in conjunction with other therapies, such as the treatments, chemotherapies, radiation therapies, hormonal therapies, gene therapies, immunotherapies, and/or replacement therapies of the present invention. Tumor resection refers to the physical removal of at least a portion of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery).

Upon excision of some or all of the cancer cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be achieved by perfusion to an area, direct injection, or topical administration of an additional anti-cancer therapy. Such treatments may be repeated, for example, every 1, 2, 3, 4,5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks, or every 1, 2, 3, 4,5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may also have varying dosages.

5. Other agents

It is contemplated that other agents may be used in combination with certain aspects of the present invention to improve the therapeutic efficacy of the treatment. These additional agents include agents that affect upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, cell adhesion inhibitors, agents that increase the sensitivity of hyperproliferative cells to apoptosis-inducing agents, or other biological agents. Increasing intercellular signaling by increasing the number of GAP junctions will increase the anti-hyperproliferative effect on the adjacent hyperproliferative cell population. In other embodiments, cytostatic or differentiating agents may be used in combination with certain aspects of the invention to improve the anti-hyperproliferative efficacy of treatments. Cell adhesion inhibitors are expected to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are inhibitors of local adhesion kinase (FAK) and Lovastatin (Lovastatin). It is further contemplated that other agents that increase the sensitivity of hyperproliferative cells to apoptosis (e.g., antibody c225) may be used in combination with certain aspects of the invention to improve the therapeutic efficacy.

Pharmaceutical compositions

It is contemplated that exosomes expressing or comprising recombinant proteins, inhibitory RNAs and/or small molecule drugs may be administered systemically or locally to inhibit tumor cell growth and, most preferably, kill cancer cells in cancer patients with locally advanced or metastatic cancer. They may be administered intravenously, intrathecally and/or intraperitoneally. They can be administered alone or in combination with antiproliferative drugs. In one embodiment, they are administered to reduce the cancer burden in a patient prior to surgery or other procedure. Alternatively, they may be administered after surgery to ensure that any remaining cancer (e.g., cancer that cannot be eliminated by surgery) does not survive.

It is not intended that the present invention be limited by the specific nature of the therapeutic formulation. For example, such compositions may be provided in the form of formulations as well as in the form of physiologically tolerable liquids, gels, solid carriers, diluents or excipients. For veterinary use, these therapeutic formulations can be administered to mammals such as livestock and used clinically in humans in a manner similar to other therapeutic agents. In general, the dosage required for therapeutic efficacy will vary depending upon the type of use and mode of administration, as well as the specific needs of the individual subject.

In the case of the intended clinical application, it may be necessary to prepare a pharmaceutical composition comprising the recombinant protein and/or exosomes in a form suitable for the intended administration. Typically, a pharmaceutical composition, which may be an parenteral formulation, may comprise an effective amount of one or more recombinant proteins and/or exosomes and/or adjuncts dissolved or dispersed in a pharmaceutically acceptable carrier. The phrase "pharmaceutically or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as a human, as desired. Formulations of Pharmaceutical compositions comprising recombinant proteins and/or exosomes or additional active ingredients as disclosed herein are exemplified by remington's Pharmaceutical Sciences, 1990, 18 th edition, which is incorporated herein by reference in its entirety for all purposes. Furthermore, for animal (e.g., human) administration, it is understood that the formulation should meet sterility, pyrogenicity, general safety and purity Standards as required by the FDA Office of Biological Standards.

In addition, according to certain aspects of the present invention, compositions suitable for administration may be provided in a pharmaceutically acceptable carrier, with or without an inert diluent. As used herein, "pharmaceutically acceptable carrier" includes any and all aqueous solvents (e.g., water, alcohol/water solutions, ethanol, saline solutions, parenteral vehicles such as sodium chloride, ringer's dextrose, and the like), non-aqueous solvents (e.g., fats, oils, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycols, and the like), vegetable oils, and injectable organic esters such as ethyl oleate), lipids, liposomes, dispersion media, coatings (e.g., lecithin), surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, antioxidants, chelating agents, inert gases, parabens (e.g., methylparaben, propylparaben), chlorobutanol, phenol, sorbic acid, thimerosal, or combinations thereof), isotonic agents (e.g., sugars and sodium chloride), absorption delaying agents (e.g., aluminum monostearate and gelatin), salts, drugs, drug stabilizers, gels, resins, fillers, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, fluids, and nutritional supplements, such as such materials and combinations thereof, as will be known to those of ordinary skill in the art. The carrier should be absorbable and include liquid, semi-solid (i.e., paste) or solid carriers. In addition, if desired, the compositions may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, stabilizers, or pH buffering agents. The pH and exact concentration of the various components in the pharmaceutical composition are adjusted according to well known parameters. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

A pharmaceutically acceptable carrier is specifically formulated for administration to a human, although in certain embodiments, it may be desirable to use a pharmaceutically acceptable carrier that is formulated for administration to a non-human animal but would not be acceptable for administration to a human (e.g., due to governmental regulations). Unless any conventional carrier is incompatible with the active ingredient (e.g., detrimental to the therapeutic effect of the recipient or the composition contained therein), it is contemplated that the carrier will be used in a therapeutic or pharmaceutical composition. According to certain aspects of the present invention, the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsification, admixture, encapsulation, absorption, and the like. Such procedures are routine to those skilled in the art.

Certain embodiments of the present invention may comprise different types of carriers depending on whether the carrier is administered in solid, liquid or aerosol form and whether sterilization is required for the route of administration, e.g., injection. The compositions can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, intramuscularly, subcutaneously, transmucosally, orally, topically, by inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by bathing target cells locally directly, via a catheter, via lavage, in the form of a lipid composition (e.g., liposomes), or by other methods, or by any combination of the foregoing, as described, for example, in the remington's pharmaceutical sciences, 1990, 18 th edition, incorporated herein by reference.

The active compounds may be formulated for parenteral administration, e.g., for injection via the intravenous, intramuscular, subcutaneous or even intraperitoneal routes. Thus, examples include parenteral formulations. Typically, such compositions may be prepared as liquid solutions or suspensions; solid forms suitable for preparing solutions or suspensions upon addition of liquid prior to injection can also be prepared; and the formulation may also be emulsified.

According to embodiments of the present invention, parenteral formulations may include exosomes as disclosed herein and one or more solutes and/or solvents, one or more buffers and/or one or more antibacterial agents, or any combination thereof. In some aspects, the solvent may comprise water, a water miscible solvent, e.g., ethanol, liquid polyethylene glycol and/or propylene glycol, and/or a water immiscible solvent, such as a non-volatile oil, including, e.g., corn oil, cottonseed oil, peanut oil and/or sesame oil. In certain forms, the solute may include one or more of an antimicrobial agent, a buffer, an antioxidant, a tonicity agent, a cryoprotectant, and/or a lyoprotectant.

Antibacterial agents according to the present disclosure may include those provided elsewhere in the present disclosure as well as benzyl alcohol, phenol, mercurial, and/or parabens. The antimicrobial agent may include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethanol, glycerol, aminocapropyrimidine, imidazolidinyl urea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and/or thimerosal, or any combination thereof. In various aspects, the antimicrobial agent may be present in a concentration necessary to ensure the required inherent sterility of the pharmaceutical agent. For example, the agent may be present in the formulation in a bacteriostatic or fungistatic concentration, e.g., contained in a variety of dosage containers. In various embodiments, the pharmaceutical agent can be a preservative and/or can be present at the time of use in a sufficient concentration to prevent the proliferation of microorganisms (such as those inadvertently introduced to the formulation) while, for example, a portion of the contents is removed with a hypodermic needle and syringe. In various aspects, the agent has the largest volume and/or concentration limits (e.g., phenylmercuric nitrate and thimerosal 0.01%, benzethonium chloride and benzalkonium chloride 0.01%, phenol or cresol 0.5%, and chlorobutanol 0.5%). In various examples, agents such as phenylmercuric nitrate are employed at a concentration of 0.002%. Methyl p-hydroxybenzoate 0.18% and propyl p-hydroxybenzoate 0.02% and benzyl alcohol 2% in combination may also be applied according to the examples. The antimicrobial agent may also include hexylresorcinol 0.5%, phenylmercuric benzoate 0.1%, and/or a therapeutic compound.

Antioxidants according to the present disclosure may include ascorbic acid and/or salts thereof, and/or sodium salts of ethylenediaminetetraacetic acid (EDTA). Tonicity agents as described herein may include electrolytes and/or mono-or disaccharides. Cryoprotectants and/or lyoprotectants are additives that protect biopharmaceuticals from adverse effects due to freezing and/or drying of the product during the freeze-drying process. Cryoprotectants and/or lyoprotectants may include sugars (non-reducing) such as sucrose or trehalose, amino acids such as glycine or lysine, polymers such as liquid polyethylene glycol or polydextrose, and polyols such as mannitol or sorbitol, all being possible cryoprotectants or lyoprotectants. Embodiments of the present invention may also include antifungal agents such as butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, potassium sorbate, sodium benzoate, sodium propionate, and/or sorbic acid, or any combination thereof. Aspects of additional solutes and antibacterial agents, buffers, antioxidants, tonicity agents, cryoprotectants and/or lyoprotectants and features thereof that may be employed according to the present disclosure, and methods of making parenteral formulations of the invention are described, for example, in Remington's pharmaceutical sciences, 2005, 21 st edition, e.g., chapter 41, which is incorporated herein by reference in its entirety for all purposes.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the ready-to-use preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that it can be readily injected. It should be stable under the conditions of preparation and storage and must be preserved against contaminating action by microorganisms such as bacteria and fungi.

The therapeutic agents can be formulated into the compositions in free base, neutral, or salt form. Pharmaceutically acceptable salts include acid addition salts, such as those formed with free amino groups of the protein composition, or with inorganic acids (e.g., hydrochloric or phosphoric acids) or such organic acids (e.g., acetic, oxalic, tartaric, mandelic, and the like). Salts formed with free carboxyl groups may also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or iron hydroxide; or such organic bases as isopropylamine, trimethylamine, histidine or procaine, and the like. Upon formulation, the solution will be administered in a manner compatible with the dosage formulation and in such an amount as is therapeutically effective. The formulations are readily administered in a variety of dosage forms, such as formulated for parenteral administration as an injectable solution, or as an aerosol for delivery to the lung, or as formulated for administration via the alimentary tract, such as drug-releasing capsules and the like.

In particular embodiments of the invention, the composition is combined or mixed intimately with a semi-solid or solid carrier. The mixing can be carried out in any convenient manner, such as milling. Stabilizers may also be added during mixing in order to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach. Examples of stabilizers for use in the composition include buffers, amino acids (such as glycine and lysine), carbohydrates (such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, and the like).

In further embodiments, the present invention may relate to the use of a pharmaceutical lipid vehicle composition comprising one or more lipids and an aqueous solvent. As used herein, the term "lipid" will be defined to include any of a wide range of substances that are characteristically insoluble in water and extractable with organic solvents. This broad class of compounds is well known to those skilled in the art, and as the term "lipid" is used herein, it is not limited to any particular structure. Examples include compounds containing long chain aliphatic hydrocarbons and derivatives thereof. Lipids can be naturally occurring or synthetic (i.e., designed or produced by humans). However, lipids are typically biological substances. Biolipids are well known in the art and include, for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulfatides, lipids with ether-and ester-linked fatty acids, polymerizable lipids, and combinations thereof. Of course, compounds other than those specifically described herein, which are understood by those of skill in the art to be lipids, are also encompassed by the compositions and methods.

One of ordinary skill in the art will be familiar with the range of techniques that can be used to disperse the composition in the lipid vehicle. For example, the therapeutic agent may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bound to a lipid, contained in a suspension in a lipid, contained or complexed with micelles or liposomes, or otherwise associated with a lipid or lipid structure by any means known to one of ordinary skill in the art. Dispersion may or may not cause liposome formation.

The term "unit dose" or "dose" refers to a physically single unit suitable for use in a subject, each unit containing a predetermined amount of a calculated therapeutic composition to produce the desired response discussed above in association with its administration (i.e., the appropriate route and regimen). The amount to be administered (both in terms of treatment and the number of unit doses) depends on the desired efficacy. The actual dose of the composition of the present invention administered to a patient or subject can be determined by physical and physiological factors such as the weight, age, health and sex of the subject, the type of disease treated, the extent of disease penetration, previous or concurrent therapeutic interventions, the patient's primary symptoms, the route of administration and the potency, stability and toxicity of the particular therapeutic substance. For example, a dose may also comprise from about 1 microgram per kilogram body weight to about 1000 milligrams per kilogram body weight per administration (such ranges include intermediate doses) or more, and any range derivable therein. In non-limiting examples of ranges derivable from the values listed herein, a range of about 5 micrograms per kilogram of body weight to about 100 milligrams per kilogram of body weight, about 5 micrograms per kilogram of body weight to about 500 milligrams per kilogram of body weight, and the like, can be administered. The physician in charge of administration will in any event determine the concentration of the active ingredient or ingredients in the composition and the appropriate dose or doses for the individual subject.

The actual dosage of the composition administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of the condition, type of disease being treated, previous or concurrent therapeutic intervention, the patient's underlying condition, and the route of administration. Depending on the dose and route of administration, the preferred dose and/or the number of administrations of an effective amount may vary according to the subject's response. The physician in charge of administration will in any event determine the concentration of the active ingredient or ingredients in the composition and the appropriate dose or doses for the individual subject.

In certain embodiments, the pharmaceutical composition may comprise, for example, at least about 0.1% active compound. In other embodiments, the active compound may comprise between about 2% unit weight to about 75% unit weight, or for example, between about 25% to about 60%, and any range derivable therein. As a matter of course, the amount of active compound or compounds in each therapeutically useful composition can be prepared in such a way that a suitable dose will be obtained in any administration unit dose of the compound. Those skilled in the art of preparing such pharmaceutical formulations will expect factors such as solubility, bioavailability, biological half-life, route of administration, product shelf-life, and other pharmacological considerations, and thus, a wide variety of dosages and treatment regimens may be desirable.

In other non-limiting examples, the dose can further comprise about 1 microgram per kilogram of body weight, about 5 micrograms per kilogram of body weight, about 10 micrograms per kilogram of body weight, about 50 micrograms per kilogram of body weight, about 100 micrograms per kilogram of body weight, about 200 micrograms per kilogram of body weight, about 350 micrograms per kilogram of body weight, about 500 micrograms per kilogram of body weight, about 1 milligram per kilogram of body weight, about 5 milligrams per kilogram of body weight, about 10 milligrams per kilogram of body weight, about 50 milligrams per kilogram of body weight, about 100 milligrams per kilogram of body weight, about 200 milligrams per kilogram of body weight, about 350 milligrams per kilogram of body weight, about 500 milligrams per kilogram of body weight to about 1000 milligrams per kilogram of body weight or more per administration, and any range derivable therein. In non-limiting examples of ranges derivable from the values listed herein, based on the values described above, ranges of about 5 milligrams per kilogram of body weight to about 100 milligrams per kilogram of body weight, about 5 micrograms per kilogram of body weight to about 500 milligrams per kilogram of body weight, and the like can be administered.

Nucleic acids and vectors

In certain aspects of the invention, nucleic acid sequences encoding therapeutic proteins or fusion proteins containing therapeutic proteins may be disclosed. The nucleic acid sequence may be selected based on conventional methods, depending on which expression system is used. For example, the corresponding gene or variant thereof may be a codon optimized for expression in a certain system. Various vectors can also be used to express the protein of interest. Exemplary vectors include, but are not limited to, plasmid vectors, viral vectors, transposons, or liposome-based vectors.

V. recombinant proteins and inhibitory RNAs

Some embodiments relate to recombinant proteins and polypeptides. Particular embodiments relate to recombinant proteins or polypeptides exhibiting at least one therapeutic activity. In some embodiments, the recombinant protein or polypeptide can be a therapeutic antibody. In some aspects, the therapeutic antibody can be an antibody that specifically or selectively binds to an intracellular protein. In other aspects, the protein or polypeptide may be modified to increase serum stability. Thus, where the application refers to a function or activity of a "modified protein" or a "modified polypeptide", one of ordinary skill in the art will appreciate that this includes, for example, proteins or polypeptides that have additional advantages within the unmodified protein or polypeptide. It is specifically contemplated that embodiments relating to "modified proteins" may be practiced with respect to "modified polypeptides" and vice versa.

The recombinant protein may have a deletion and/or substitution of amino acids; thus, proteins with deletions, proteins with substitutions, and proteins with deletions and substitutions are modified proteins. In some embodiments, these proteins may also include inserted or added amino acids, such as fusion proteins or proteins with linkers. A "modified deleted protein" does not contain one or more residues of the original protein, but may have the specificity and/or activity of the original protein. The "modified deletion protein" may also have reduced immunogenicity or antigenicity. An example of a modified deleted protein is a protein having amino acid residues deleted from at least one antigenic region (i.e., a region of the protein identified as an antigen in a particular organism, such as the class of organisms to which the modified protein can be administered).

Substitution or substitution variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide, in particular its effector function and/or bioavailability. Substitutions may or may not be conservative, i.e., one amino acid is replaced with one of a similar shape and charge. Conservative substitutions are well known in the art and include, for example, the following changes: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glutamine to asparagine; glutamic to aspartic acids; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.

In addition to deletions or substitutions, the modified protein may have an insertion of residues, which typically involves the addition of at least one residue in the polypeptide. This may include insertion of a targeting peptide or polypeptide, or only a single residue. End additions referred to as fusion proteins are discussed below.

The term "biofunctional equivalent" is well understood in the art and is further defined herein in detail. Thus, sequences having between about 70% and about 80%, or between about 81% and about 90%, or even between about 91% and about 99% of the amino acids that are the same or functionally equivalent to those of a control polypeptide are included, provided that the biological activity of the protein is maintained. A recombinant protein may in some aspects be biologically functionally equivalent to its original counterpart.

It will also be understood that the amino acid and nucleic acid sequences may include additional residues, such as additional N-or C-terminal amino acids or 5 'or 3' sequences, and still be substantially as set forth in one of the sequences disclosed herein, so long as the sequence meets the above criteria, including maintaining biological protein activity in which protein expression is involved. The addition of terminal sequences applies specifically to nucleic acid sequences, which may, for example, include various non-coding sequences flanking either the 5 'or 3' portion of the coding region or may include various internal sequences, i.e., introns, known to be present within the gene.

As used herein, a protein or peptide generally refers to, but is not limited to, a protein of greater than about 200 amino acids, up to the full-length sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of about 3 to about 100 amino acids. For convenience, the terms "protein," "polypeptide," and "peptide" are used interchangeably herein.

As used herein, "amino acid residue" refers to any naturally occurring amino acid, any amino acid derivative, or any amino acid mimetic known in the art. In certain embodiments, the residues of the protein or peptide are sequential, without any sequence of non-amino acid intervening amino acid residues. In other embodiments, the sequence may comprise one or more non-amino acid portions. In particular embodiments, the sequence of residues of a protein or peptide may be interspersed with one or more non-amino acid moieties.

Thus, the term "protein or peptide" encompasses an amino acid sequence comprising at least one of the 20 common amino acids found in naturally occurring proteins or at least one modified or common amino acid.

Certain embodiments of the invention relate to fusion proteins. These molecules may have a therapeutic protein linked at the N-or C-terminus to a heterologous domain. For example, fusions may also employ leader sequences from other species to allow recombinant expression of proteins in heterologous hosts. Another useful fusion includes the addition of a protein affinity tag such as a serum albumin affinity tag or six histidine residues, or an immunologically active domain such as an antibody epitope (preferably cleavable) to facilitate purification of the fusion protein. Non-limiting affinity tags include polyhistidine, Chitin Binding Protein (CBP), Maltose Binding Protein (MBP), and glutathione-S-transferase (GST).

In particular embodiments, the therapeutic protein may be linked to a peptide that increases half-life in vivo, such as an XTEN polypeptide (Schellenberger et al, 2009), an IgG Fc domain, albumin, or an albumin binding peptide.

Methods for producing fusion proteins are well known to those skilled in the art. Such proteins can be prepared, for example, by de novo synthesis of the entire fusion protein or by attachment of a DNA sequence encoding a heterologous domain followed by expression of the entire fusion protein.

The preparation of functionally active fusion proteins that reduce parent proteins can be facilitated by linking the genes to bridging DNA segments encoding peptide linkers spliced between tandem-linked polypeptides. The linker will be of sufficient length to allow proper folding of the resulting fusion protein.

siNA (e.g., siRNA) are well known in the art. For example, siRNA and double stranded RNA have been described in U.S. patent nos. 6,506,559 and 6,573,099 and U.S. patent application nos. 2003/0051263, 2003/0055020, 2004/0265839, 2002/0168707, 2003/0159161 and 2004/0064842, all of which are incorporated herein by reference in their entirety.

Within a siNA, the components of the nucleic acid need not be of the same type or homogeneous throughout (e.g., a siNA can comprise nucleotides and nucleic acids or nucleotide analogs). Typically, siNA forms a double-stranded structure; the double-stranded structure may be produced from two separate nucleic acids that are partially or fully complementary. In certain embodiments of the invention, a siNA may comprise only a single nucleic acid (polynucleotide) or nucleic acid mimetic and form a double-stranded structure by being complementary to itself (e.g., forming a hairpin loop). The double-stranded structure of the siNA may comprise 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500 or more consecutive nucleobases, including all ranges therein. The siNA may comprise 17 to 35 consecutive nucleobases, more preferably 18 to 30 consecutive nucleobases, more preferably 19 to 25 nucleobases, more preferably 20 to 23 consecutive nucleobases, or 20 to 22 consecutive nucleobases, or 21 consecutive nucleobases that hybridize to a complementary nucleic acid (which may be another portion of the same nucleic acid or an independent complementary nucleic acid) to form a double-stranded structure.

Agents of the invention that can be used to practice the methods of the invention include, but are not limited to, siRNA. In general, the introduction of double-stranded RNA (dsrna), which is alternatively referred to herein as small interfering RNA (sirna), induces potent and specific gene silencing, a phenomenon referred to as RNA interference or RNAi.

In designing RNAi, there are several factors to consider, such as the nature of the siRNA, the persistence of the silencing effect and the choice of delivery system. To produce an RNAi effect, the siRNA introduced into an organism will typically contain an exon sequence. In addition, the RNAi process is homology dependent, so the sequences must be carefully selected to maximize gene specificity while minimizing the possibility of cross-interference between homologous, rather than gene-specific, sequences. Preferably, the siRNA exhibits greater than 80%, 85%, 90%, 95%, 98% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences that are less than about 80% identical to the target gene are substantially less effective. Thus, the higher the degree of homology between the siRNA and the gene to be inhibited, the less likely it will be to affect expression of an unrelated gene.

In addition, the size of the siRNA is an important consideration. In some embodiments, the invention relates to siRNA molecules comprising at least about 19 to 25 nucleotides and capable of modulating gene expression. In the context of the present invention, the siRNA is preferably less than 500, 200, 100, 50 or 25 nucleotides in length. More preferably, the siRNA is about 19 nucleotides to about 25 nucleotides in length.

A target gene generally means a polynucleotide comprising a region encoding a polypeptide, or a region of a polynucleotide that modulates replication, transcription or translation or other processes important for expressing a polypeptide, or a polynucleotide comprising both a region encoding a polypeptide and a region operably linked to regulate expression therein. Any gene expressed in the cell can be targeted. Preferably, the target gene is a gene that is of great interest in connection with or associated with the progression of cellular activity important for the disease or as a subject of study.

The siRNA may be obtained from commercial sources, natural sources, or may be synthesized using any of a number of techniques well known to those of ordinary skill in the art. For example, one commercial source of pre-designed siRNA is Austin (Tex.) of AustinThe other is(Valencia, Calif.) Valencia, California. The inhibitory nucleic acid that may be employed in the compositions and methods of the invention may be any nucleic acid sequence that has been found by any source to be a proven down regulator of a protein of interest. Without undue experimentation and use of the present disclosure, it is understood that additional sirnas may be designed and used to practice the methods of the present invention.

The siRNA may also comprise a change of one or more nucleotides. Such changes may include the addition of non-nucleotide material to one or more ends or into (at one or more nucleotides of the RNA), e.g., 19 to 25 nucleotide RNA. In certain aspects, the RNA molecule contains a 3' -hydroxyl group. The nucleotides in the RNA molecules of the invention may also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, such as a phosphorothioate, phosphorodithioate, or other modified backbone known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNA (e.g., 2 ' -O-methyl ribonucleotides, 2 ' -deoxy-2 ' -fluoro ribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and inverted deoxy residues in combination) can be found in U.S. application publication 2004/0019001 and U.S. patent No. 6,673,611, each of which is incorporated by reference in its entirety. Collectively, all such altered nucleic acids or RNAs described above are referred to as modified sirnas.

Kits and diagnostic agents

In various aspects of the invention, kits are contemplated that contain components necessary for purification of exosomes from a bodily fluid or tissue culture medium. In other aspects, kits are contemplated that contain isolated exosomes and the necessary components to transfect them with a therapeutic nucleic acid, a therapeutic protein, or a nucleic acid encoding a therapeutic protein therein. In other aspects, kits are envisioned that contain the isolated exosomes and components necessary to determine the presence of a cancer cell-derived exosome-specific marker within the isolated exosomes.

The kit may comprise one or more sealed vials containing any of such components. In some embodiments, the kit may further comprise a suitable container device, which is a container that will not react with a component of the kit, such as an ebb tube, assay plate, syringe, bottle, or test tube. The container may be made of a sterilizable material such as plastic or glass.

The kit may also include a sheet of instructions summarizing the procedural steps of the methods set forth herein and will follow substantially the same procedures as described herein or known to one of ordinary skill in the art. The specification information may be in a computer readable medium containing machine readable instructions which when executed using a computer cause the display of the following real or virtual program: purifying exosomes from a sample and transfecting therapeutic nucleic acids therein, expressing recombinant proteins therein, electroporating recombinant proteins therein, or identifying cancer cell-derived markers thereon or therein.

Examples VII. examples

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Materials and methods

And (4) separating and purifying exosome. Exosomes were purified by differential centrifugation processes as previously described (Alvarez-Erviti et al, 2011; EL-Andaloussi et al, 2012). Supernatants were collected from cells cultured for 48 hours in medium containing FBS with exosome consumed, and the supernatants were subsequently subjected to sequential centrifugation steps of 800g for 5 minutes, and 2000g for 10 minutes. This resulting supernatant was then filtered in culture flasks using a 0.2 μm filter and after 2 hours of ultracentrifugation (Beckman), the pellet was recovered at 28,000g in a SW 32Ti rotor. The supernatant was aspirated and the pellet resuspended in PBS and then ultracentrifuged for 2 hours again. The purified exosomes were then analyzed and used in experimental procedures.

Electroporation of exosomes and liposomes. In 400. mu.l of electroporation buffer (1.15mM potassium phosphate, pH 7.2, 25mM potassium chloride, 21% Optiprep)^TM) In, mix 1X 10⁸Individual exosomes (measured by nanosight analysis) and 1 μ g siRNA (qiagen) or shRNA. As described previously, using a 4mm cuvette, using a gene pulser Xcell^TMElectroporation System (BioRad)) electroporates exosomes (Alvarez-Erviti et al, 2011; EL-Andaloussi et al, 2012). A similar procedure was performed using liposomes (100nm, available from Encapsula Nanocociences). After electroporation exosomes were treated with protease free rnase a (Sigma Aldrich) followed by the addition of 10 x concentrated rnase inhibitor (Ambion) and washed with PBS under ultracentrifugation method as described above.

Immunogold labeling and electron microscopy. The fixed specimen at the optimal concentration was placed on a 300 mesh carbon/fimwatt coated grid and allowed to absorb fimwatt for a minimum of one minute. For immunogold staining, the grids were placed in blocking buffer forThe blocking/permeabilization step was one hour. Without washing, the grid was immediately placed in the primary antibody at the appropriate dilution at 4 ℃ overnight (monoclonal anti-CD 9, 1: 10, Ebol corporation (Abcam)). As a control, some grids were not exposed to primary antibody. The next day, all grids were washed with PBS and then floated for two hours at room temperature on droplets of the appropriate secondary antibody attached with 10nm gold particles (AURION, Hatfield, PA). The grid was washed with PBS and placed in 2.5% glutaraldehyde in 0.1M phosphate buffer for 15 minutes. After rinsing with PBS and distilled water, the grids were dried and stained with uranyl acetate for comparison. Using Tecnai^TMBiological double transmission electron microscopes (Bio Twin transmission electron microscope) (FEI, Hillsboro, OR) of hilsbury, oregon view the sample and acquire images with AMT CCD cameras (Advanced Microscopy technologies, danders, MA).

Quantification of Alexa fluor 647 in cells treated with exosomes or liposomes. Exosomes isolated from BJ fibroblasts using Alexa647-labeled siRNA (Qiagen, SEQ ID NO: 1) electroporation and PBS, proteinase K (Qiagen, at room temperature 1 x, 15 minutes and at 4 ℃ with PBS ultracentrifugation for 1 hour), or trypsin (Life Technologies), at room temperature 10 x, 15 minutes and at 4 ℃ with PBS ultracentrifugation for 1 hour), washing with PBS for 2 hours, and adding to the glass coverslip Panc-1 cell culture medium for 3 hours. Cells were then fixed by washing with cold PBS and incubation with 4% PFA for 20 min at room temperature. Then, cells were washed with PBS, incubated with 0.05% Triton X for 10 minutes, washed with PBS and incubated with PBSStaining with green nuclear stain (Invitrogen). The coverslip is then mounted to the slide via the fluorescent mounting medium. Alexa647 focal accumulation was visualized using a Zeiss (Zeiss) observer Z1 inverted microscope. Count per field of view (400 x) with Alexa647 number of cells labeled and the results expressed as the percentage of cells with positive markers counted in the total number of cells per field of view.

Real-time PCR analysis. The primers were Applied using multislice reverse transcriptase (Applied Biosystems) and followed according to the manufacturer's instructionsTotal RNA purified oligo-d (T) primers (Invitrogen) to reverse transcribe RNA. Use ofGreen Master mix (applied biosystems Co.) in ABIReal-time PCR analysis was performed on a 7300HT sequence detection system instrument. Transcripts of interest were normalized to 18S transcript levels. For Kras^G12DThe primers of (1) were designed as described (Rachagani et al, 2011) and the Kras wild-type primers were designed as described (Poliseno et al, 2010). Each measurement was performed in triplicate. Determining a threshold cycle (number of fragment cycles at which the amount of amplification target reaches a fixed threshold), and using 2-^ΔCtChemical formula (xxxvi) expression was measured. The primer sequences are listed in table 1.

TABLE 1 primer sequences for RT-PCR

And (5) culturing the cells. Human packs were cultured in DMEM supplemented with 20% exosome-depleted FBS and 1% penicillin-streptomycinDermal fibroblast (BJ) cells. Panc-1 and BxPC-3 cells (from American Type Culture Collection) [ ATCC ] were cultured in RPMI 10% FBS]Obtained). Panc-1 and BxPC3 cells (transfected with luciferase promoter) were a good gift from dr. Ptf1acre/+, by mincing isolated tumors in unsupplemented DMEM and collagenase 4(400 units/ml) and incubating overnight; LSL-KRas^G12D/+；Tgfbr2^flox/floxMouse (PKT) fibroblasts were isolated from the pancreas of PKT mice. Then, the next day, the medium was aspirated, after which the cells were cultured in DMEM supplemented with 20% exosome-depleted FBS and 1% penicillin-streptomycin-ampicillin.

RNAi strategy. Kras^G12DsiRNA sequence (GUUGGAGCUG)AUGGCGUAGTT(SEQ ID NO: 1)) and Kras^G12DshRNA sequence (CCGGGTTGGAGCTGATGGCGTAGTTCTCGAGCTACGCCATCAGCTCCAACTTTTTTT (SEQ ID NO: 2)) simultaneously reflects the G-to-A nucleotide bias from the wild-type Kras gene sequence in order to specifically target Kras^G12DGlycine to aspartic acid amino acid substitutions in the mutations and included TT nucleotide projections to promote silencing efficacy. Kras herein with respect to wild-type mRNA sequence^G12DThe central site of nucleotide abnormalities in the siRNA enhances its specificity. This was also labeled with Alexa at the 3' end on the sense strand647 fluorophore to follow its delivery. siRNA was obtained from Qiagen (Cat. No. 1027424). For use as scrambling siRNAs, all star negative siRNAs were obtained from Qiagen (Cat. No. 1027287). shRNA targeting GFP was used as a scrambled shRNA.

And (3) carrying out exosomal transfection. For in vitro transfection using exosomes and liposomes, both were electroporated and washed with PBS as described above, and 200,000 cells in 6-well plates were treated with exosomes and liposomes for the time required and subsequently washed with PBS and used for further analysis as described for each assay.

Kinetics of growthAnd apoptosis assays. Panc-1 and BxPC-3 cells were seeded in 6-well plates (2.5X 10)⁵) And allowed to grow for 12 hours, after which they were treated with si/shRNA electroporated exosomes. Subsequently, every 24 hours, the number of viable cells was counted by treating the cells with trypsin and mixing with trypan blue prior to cell counting using a hemocytometer. This procedure was repeated every 24 hours until 84 hours after inoculation. Apoptosis by TUNEL was assessed using the in situ cell death kit, tmrred (Roche), according to the manufacturer's instructions. The cells are fixed as described above, andgreen (Invitrogen, 1: 10,000 in PBS, 10 minutes at room temperature) was used to stain the nuclei. Images were acquired using a zeiss LSM510 confocal microscope and images were quantified by counting the number of cells with TUNEL positive per field of view (400 ×), and the results were expressed as the percentage of cells with positive markers in the total number of cells counted per field of view.

Western blotting. To infer protein expression of cells after 24 hours of treatment with exosomes, Panc-1 cells were collected in RIPA buffer and protein lysates were normalized using Bradford (Bradford) quantification. 40 μ g of lysate was loaded onto an acrylamide gel for electrophoretic separation of proteins under denaturing conditions and transferred onto a PVDF membrane (Immobilon P) by wet electrophoretic transfer. Then, membranes were blocked with 5% skim milk powder in PBS/0.05% tween-20 for 1 hour at room temperature and incubated overnight at 4 ℃ with the following primary antibody: anti-rabbit p-Erk-p44/p42MAPK (Erk1/2) (Thr202/Tyr 204) (Cell Signaling, 4376, 1: 1000), anti-rabbit p-AKT-anti-AKT 1 (phospho S473) (aiboc, ab81283, 1: 5000), anti-rabbit β -actin (saikommunity, 4967, 1: 1000). The secondary antibody was incubated at room temperature for 1 hour. Washing after antibody incubation with 1 XPBS 0.05% on an orbital shakerThree times at 15 minute intervals. According toManufacturer's instructions to develop the membrane with a chemiluminescent reactant from Pierce and capture the chemiluminescence on the membrane.

Northern blotting. At 95 ℃, urea/acrylamide 15% gel was used to load 20 μ g of sucrose gradient exosome RNA and pigment-loaded 1 × RNA for 2 minutes, followed by 2 minutes on ice. The microrna markers were used according to the manufacturer's instructions (N2102, New England BioLabs). Electrophoresis was performed at 4 ℃ for 3 hours using 1 XTBE. At 4 ℃ with 0.5 XTBE, using Wattman (Whatman) blotting paper andtransfer was performed for 2 hours on a positively charged nylon membrane (arbison). The RNA was cross-linked to the membrane using a UV transilluminator over a 20 minute period. By the company AmbisonMembranes were prehybridized in hybridization solution (Aminoson) by spinning at 42 ℃ for 1 hour. Then, the probe was thawed on ice and after 5 minutes incubation at 95 ℃, 150ng per mL of hybridization buffer was added, after which the membrane was kept spinning overnight at 42 ℃. The following washing steps were carried out: 2 XSSPE/0.5% SDS-twice for 15 minutes; 0.2 XSSPE/0.5% SDS-twice for 30 minutes, and 2 XSSPE-for 5 minutes. These initial washing steps are followed by more washes and then used according to the manufacturer's instructions (Amison Corp.)BioDetect^TMThe kit develops the blot. The blot was exposed overnight with four laminated membranes. Direct detection of Alexa using the Audrey infrared imaging System from LI-COR Biosciences647 fluorophore.

Immunocytochemistry. Cells were coated onto coverslips and washed with Kras^G12DsiRNA electroporated exosomes or lipidsThe body was treated for 3 hours. Then, the coverslip with cold 1 x PBS washing and room temperature with 4% paraformaldehyde fixed cells for 20 minutes, room temperature in PBS 0.5% Triton^TMX-100 was pre-permeabilized for 10 min and nuclei were stained with Sytox green resuspended in 2% BSA. Images were obtained using a zeiss LSM510 vertical confocal system, maintaining the same settings using a recycling tool. Comprises647-polymeric exosomes of labeled siRNA allow visual visualization of focal accumulation markers detectable by confocal microscopy. For data analysis, images were selected from a library drawn from at least two independent experiments. The number of cells labeled with Alexa fluor 647 was counted per field of view (× 400) and the results expressed as the percentage of cells with positive label in the total number of cells counted per field of view.

Mice and imaging. Female athymic nu/nu mice aged between 4 and 6 weeks (Charles Rivers laboratories) were housed in individually ventilated cages at 21 ℃ to 23 ℃, 12 hours light-dark cycles and 40% -60% humidity. Mice were allowed free access to irradiated feed and sterilized water. Under general anesthesia, Panc-1 or BXPC-3 cells (10) were injected using a 27-gauge syringe⁶Resuspended in 10 μ l PBS) into the tail of the pancreas. For luciferase expression detection, mice were injected intraperitoneally with 100mg/kg luciferin (200 μ l at 10mg/ml in PBS), anesthetized with isoflurane, and imaged using IVIS (Xenogen spectroscopy) 12 to 15 minutes prior to imaging. For in situ tumor analysis, live imaging version 4.4 (Caliper Life Sciences) was used for quantitative all tumor calculations circular regions of interest (ROI) surrounding pancreas and tumor were defined and set as a standard to compare all images within the same experimental groupAnd mice were randomly divided into groups for treatment. Mice received 2X 10 intraperitoneally every other day with a volume of 100. mu.l PBS⁸Individual exosomes or liposomes. Exosomes or liposomes were electroporated with 2 μ g siRNA or shRNA and washed with PBS prior to injection. In the presence of PKT (Ptf1 acre/+; LSL-KrasG 12D/+; Tgfbr2flox/flox) ((R))Et al, 2014) in mice, exosome therapy was started at age 33 days when PaNIN and PDAC lesions were present in the mice. All Animal procedures were reviewed and approved by the Animal Care and Use Committee (Institute for Animal Care and Use Committee) at the MD anderson cancer center, texas university.

Macrophage clearing effect. Immunity-competent adult mice injected intraperitoneally with Alexa-containing formulations647-exosomes or liposomes of labeled siRNA. Blood from these mice was collected 12 hours after injection and processed for flow cytometry analysis. RBC were consumed using ACK lysis buffer (Invitrogen) and peripheral cells were blocked with FC blocking agent (1: 1000, BD Pharmingen), stained with Sytox green (1: 200, Invitrogen) and CD11b (1: 200, BD Pharmingen, PerCP/Cye 5.5.5) antibodies for 30 minutes, washed with PBS, and used LSR Fortessa^TMAnd (4) analyzing by an X-20 cell analyzer. Preincubation of the mouse cell suspension with FC blocking agent for several minutes prior to staining with specific antibody ensures that any observed staining is due to interaction of the antigen binding portion of the antibody with the antigen on the cell surface.

Tissue structure, histopathology, and immunohistochemistry. The tissues were fixed in formalin and processed with paraffin embedding. Tissue sections of 5 μm thickness were cut and stained with hematoxylin and eosin (H & E) and Masson Trichrome Stain (MTS) (Leica). For histopathological scoring, H & E stained sections were scored based on the morphological stage of pancreatic cancer: normal, pancreatic intraepithelial adenomatosis (PaNIN) and Pancreatic Ductal Adenocarcinoma (PDAC). For each tissue section, the percentage score for each of the three phases (normal, PaNIN, PDAC) was manually obtained by experts in pancreatic tissue architecture in a blinded manner, and then the scores were averaged to obtain the total score for each cohort 100. Then, for each mouse in the corresponding population, the average of these percentage scores was taken.

To analyze fibrosis in mice, eight 200 x fields of view were randomly selected for each MTS-stained pancreatic section and fibrosis was manually assessed by grid intersection analysis using Adobe Photoshop. For each picture evaluation, a grid of 100 squares was superimposed on each picture, and each intersection was counted as blue (fibrotic region) and purple/red (non-fibrotic region). Then, a percentage score for each tissue section is obtained. Prior to immunostaining, tissue sections were also subjected to antigen retrieval (15 min in 10nM citrate buffer at pH 6 and 98 ℃). Tissue sections were incubated with 4% CWFS gelatin (Aurion) in TBS or PBS for 1 hour before overnight incubation with primary antibody. The following primary antibodies were used for staining: anti-rabbit p-Erk-p44/p42MAPK (Erk1/2) (Thr202/Tyr 204) (Saybon, 4376, 1: 400), anti-rabbit p-AKT-anti-AKT 1 (phospho S473) (Ebol, ab81283, 1: 100), anti-rabbit Ki-67 (Thermo Scientific, RM-9106-S, 1: 400). For all staining, sections were incubated with biotin-labeled goat anti-rabbit and streptavidin HRP (Biocare Medical), each for 10 minutes, and counterstained with hematoxylin violet. DAB positive was analyzed. Ki-67 staining was quantified by counting the number of positively stained nuclei per field of view (400 ×), while p-Erk and p-AKT staining were quantified with ImageJ by designing macros that included only the dark stained part of the picture, which was then considered as the positively stained area for the corresponding antibody. This was performed in eight 200 x pictures of each tissue section and the average of the positive scores of each tissue section was obtained. TUNEL assays were performed using the in situ cell death detection kit, TMR Red (Roche) according to the manufacturer's instructions. By usingAlexa 647 was detected on frozen tissue sections by green staining of the nuclei of the tissue (1: 10,000 in PBS for 10 minutes). Images were acquired using a zeiss LSM510 confocal microscope and images were quantified by counting the number of cells with TUNEL positive per field of view (x 400) and the results were expressed as the percentage of cells with positive markers in the total number of cells counted per field of view.

And (5) carrying out statistical analysis. The statistical analysis used is detailed in the legend. One-way anova using GraphPad Prism (graffpadder Software corporation) or unpaired two-tailed student's t-test was used to establish statistical significance. For survival analysis, Kaplan-Meier (Kaplan-Meier) curves were plotted and statistical differences were assessed using the log rank mantel-cox test. p values < 0.05 were considered statistically significant.

Example 1 antitumor Properties of exosomes containing inhibitory RNA

siRNA and shRNA constructs designed to specifically target Kras^G12D. siRNA sequence (GUUGGAGCUG)AUGGCGUAGTT(ii) a SEQ ID NO: 1) reflecting the G to A nucleotide bias (underlined and bolded) to wild-type Kras gene sequence in order to specifically target Kras found in cell lines and animal models^G12DGlycine to aspartate amino acid substitutions in mutations, and TT nucleotide projections (underlined) to promote silencing efficacy (Rejiba et al, 2007; Ma et al, 2004; Du et al, 2005). In this Kras, relative to the wild-type mRNA sequence^G12DCentral site of nucleotide abnormality in siRNA enhances Kras^G12Dspecificity of siRNA (Du et al, 2005). shRNA sequences (SEQ ID NO: 2) were designed to contain a specific G to A nucleotide bias in seed sequences to facilitate Kras^G12DSpecific targeting of mRNA. For Kras^G12DThe siRNA oligonucleotide of (1) is further labeled with Alexa647 fluorophore to follow its delivery (FIG. 4A).

A novel electroporation method was developed and optimized to insert shRNA and siRNA constructs into exosomes (siKras)^G12D/shKras^G12Dexos) without functionally damaging the exosomes (fig. 4A to 4C). For this purpose, exosomes were isolated from human foreskin fibroblasts (BJ fibroblasts) using the established ultracentrifugation method (Kahlert et al, 2014). The purity and homogeneity of the exosomes (80nm to 150nm diameter particles) was confirmed by nanosight (tm) measurements (fig. 4B), transmission electron microscopy (fig. 4C) and CD9 immuno-gold labeling (fig. 4D). Sucrose gradient ultracentrifugation and northern blotting also confirmed the purity of the exosome extract and the presence of Alexa fluor 647 in the exosomes (fig. 4E). Exosomes (siScrbl/shScrbl exos) containing scrambled siRNA and shRNA, liposomes (siScrbl/shScrbl) containing scrambled siRNA and shRNA, and liposomes (Kras) containing^G12DLiposomes of siRNA/shRNA (siKras)^G12D/shKras^G12Dlipos). Tumorigenic human pancreas Panc-1 (Kras)^asp12(Reiiba et al, 2007; Sun et al, 2001)) cells with Alexa-containing cells647 exosomes of labeled siRNA were incubated with liposomes for 3 hours and immunofluorescence imaging revealed a considerable amount of focal accumulation of the marker in exosome-treated cells compared to liposome-treated cells (fig. 1A). Treatment with exosomes of proteinase K or trypsin reduced cell staining, while proteinase K or trypsin treatment of liposomes maintained low cell staining, supporting exosome surface proteins enhancing delivery of labeled siRNA into cells (fig. 1A). siKras compared to siScrbl/shScrbl exos or to exos without electroporation (control, no RNAi payload)^G12DAnd shKras^G12Dexos treatment reduces Kras in Panc-1 cells^G12DmRNA levels (70% and 50% reduction, respectively) (FIG. 1B). Compared with siScrb1/shScrb liposome, siKras^G12DAnd shKras^G12Dlipos treatment also reduced Kras in Panc-1 cells^G12DmRNA content levels (decrease of-20% each) (fig. 1B). Using amplification by specificityKras^G12DQuantitative real-time PCR (qPCR) measurement of primers other than wild-type Kras^G12DSpecific gene knock-outs of transcripts (Table 1), and siKras^G12DAnd shKras^G12Dexos treatment did not reduce levels of wild-type Kras mRNA, supporting Kras by the method of the invention^G12DmRNA specific targeting (fig. 1C). Mutant Kras when exosomes were used instead of liposomes (FIG. 1B)^G12DThe gene knock-out effect of the transcript was better, reflecting the attenuated delivery of liposomes compared to exosomes (fig. 1A). Increasing siKras^G12DAnd shKras^G12DThe concentration of lipos or incubation time of liposomes with Panc-1 cells did not improve Kras^G12DThe potency of mRNA targeting (fig. 4F), supporting the superior intrinsic properties of exosomes compared to liposomes in delivering RNAi cargo for effective mRNA targeting. Additional experimental optimization revealed that a ratio of about 400 exosomes/Panc-1 cells was inhibiting Kras compared to a ratio of 700 exosomes/Panc-1 cells^G12DThe transcript level was excellent (fig. 4G). Finally, without Kras^G12DMutation (Kras)^wt，Gly(Sun et al, 2001)) of BxPC3 pancreatic cancer cells were used as controls, and siKras^G12DAnd shKras^G12Dexos treatment did not inhibit wild-type Kras expression in these cells (fig. 4H), further supporting Kras^G12DsiRNA and shRNA constructs inhibit the specificity of oncogenic Kras mRNA levels. In the use of siKras^G12DOr shKras^G12DInhibition of oncogenic Kras in exos-treated Panc-1 cells was associated with decreased levels of phosphorylated-ERK and phosphorylated-AKT proteins, supporting the attenuation of downstream signaling of oncogenic Kras (fig. 1D). siKras compared to Panc-1 cells with treated shScrbl exos or non-electroporated control exos^G12DOr shKras^G12DProliferation of exos-cultured Panc-1 cells was significantly reduced (fig. 1E). In contrast, BxPC3 cells did not proliferate by siKras^G12DOr shKras^G12Dexos treatment effect (fig. 4I). Finally, siKras^G12DOr shKras^G12DDecreased proliferation of exos-treated Panc-1 cells was associated with enhanced apoptosis as measured by TUNEL assay, demonstrating that siKras is being used^G12DOr shKras^G12DProliferation of these cells was reduced upon exos treatment (fig. 1E).

In vitro experiments show that siKras^G12DOr shKras^G12Dexos specifically targets oncogenic Kras and induces apoptosis via attenuation of downstream oncogenic Kras signaling. Next, search for siKras-containing compounds^G12DOr shKras^G12DThe exosomes of (A) cause Kras in pancreatic tumors^G12DAbility to silence expression. Focal accumulation of Alexa fluor 647-labeled siRNA from exosomes injected intraperitoneally in mice was detected in pancreatic tissue 24 hours after injection. In addition, exosomes containing Alexa fluor 647-labeled siRNA were detected in the serum of mice 24 hours after intraperitoneal injection using flow cytometry (fig. 5A). These results indicate that exosomes administered intraperitoneally in mice enter the systemic circulation and reach the pancreas. After identifying a considerable number of exosomes close to the pancreatic soft tissue, 1 × 10⁶Individual Panc-1 human pancreas (Panc-1-1uc) cells expressing luciferase were implanted in situ in nude mice treated with intraperitoneal injections of exosomes or liposomes. 10 days after injection of cancer cells, all mice appeared to have a detectable band by bioluminescence imaging ranging from 1 × 10⁵And 1X 10⁶Photons/sec/cm/steradian/tumor. Mice were randomly grouped and subjected to 1 × 10 replicates every 48 hours⁶Exosomes or liposomes were injected intraperitoneally. Notably, the liposomes used were 100nm in size (close to the size range of exosomes) and were injected at the same concentration and dose as the exosomes. Mice in the population were also injected with PBS vehicle and non-electroporated exosomes. Although tumors of mice administered PBS or non-electroporated exosomes grew at an exponential rate, 30 days after treatment initiation, with siKras^G12DOr shKras^G12DTumors of exos-treated mice were significantly reduced to baseline bioluminescence assay levels (fig. 2A). In the use of siKras^G12DOr shKras^G12DTumor growth in lipos-treated mice was also blunted, however, to a much lesser extent than when exosomes were used (fig. 2A). In addition, detection lipidIncreased macrophage clearance of plastids compared to exosomes, where a greater number of macrophages containing Alexa fluor 647-labeled RNAi were noted in the systemic circulation of mice treated with liposomes containing labeled RNAi compared to mice treated with exosomes containing labeled RNAi (fig. 5A). Notably, siKras^G12DOr shKras^G12Dexos did not affect in situ BxPC3 tumor growth (fig. 2B) nor overall survival (fig. 5D), supporting siKras^G12DOr shKras^G12Dexos processing pair with Kras^G12DSpecific anti-tumor effects of the mutated cancer cells. PBS and siKras matched in days as early as 26 days after cancer cell injection^G12DHistopathological findings in exos-treated mice showed that siKras was transient (day 16)^G12DSignificant reduction of pancreatic cancer disease after exos treatment. At 77 days post cancer cell injection, PBS-treated control mice showed a large tumor burden as determined by bioluminescence imaging, whereas shKras^G12Dexos-treated mice had tumor burden reduced to levels of barely detectable content (fig. 2C, fig. 6B). Using shKras^G12Dexos for long-term treatment and all Panc-1 tumor mice treated with PBS and control exos required euthanasia based on moribund criteria or excessive tumor burden, but with shKras 130 days after cancer cell injection^G12DAll exos treated mice were healthy 200 days after cancer cell injection and exhibited minimal tumor burden as detected by bioluminescence imaging (fig. 2D, fig. 6B). Immunolabeling of tumors for p-ERK (FIG. 2E) and p-AKT (FIG. 5C) also revealed that shKras was being administered in contrast to control (PBS-treated) mice^G12DKras signaling was inhibited in tumors of exos-treated mice. These data represent shKras^G12DProvides a reduction in tumor growth and maintains inhibition of tumor growth. Histopathological analysis of the pancreas at these time points showed that all of the pancreas in PBS-treated mice (130 days) was involved in advanced tumors, in contrast to shKras^G12DIn exos-treated mice (fig. 2D), for the vast majority of the pancreas, no small tumor foci were involved. In shKras^G12DAfter exos, tumor burdenThe percentage (based on pancreatic mass at experimental end-point) (fig. 2F) and survival (fig. 2G) also improved greatly in Panc-1 tumor-bearing mice, while all control mice failed to withstand the pancreatic tumor burden. At 88 to 130 days after cancer cell implantation, mice in the PBS group and the control exos-treated group were euthanized when the moribund state was reached, while in shKras^G12DIn exos-treated groups, almost all mice were well-lived 200 days after cancer cell implantation (one mouse was found to die at day 59, however necropsy analysis revealed minimal tumor burden in this mouse and necropsy analysis supported death unrelated to cancer).

The antitumor properties of siRNA iExosomes (i.e., exosomes containing drug substances such as siRNA) treatment in nude mice bearing Panc-1 tumors warrant further evaluation in a Genetically Engineered Mouse Model (GEMM) of PDAC. Rapidly progressing Ptf1 acre/+; LSL-KRasG 12D/+; tgfbr2flox/flox mice (PKT mice: (R))Et al, 2014)) from siKras^G12Dexos treatment. These mice spontaneously develop pancreatic cancer that reliably recapitulates the clinical and histopathology of human pancreatic cancer ()Et al, 2014). The model is completely permeable and disease progression is highly similar in mice (Et al, 2014). PKT mice suffer from a pancreatic intraepithelial adenomatosis (PaNIN) stage at about 28 days of age, invasive adenocarcinoma at about 32 days of age and die at 45 to 55 days of age. Mice were injected intraperitoneally with either non-electroporated control exosomes or siKras every 48 hours, starting at age 33 days (mice with PDAC)^G12DOr shKras^G12Dexos (fig. 3A). Alexa from exos containing labeled siRNA after sacrifice647 the focal accumulation of the marker is detected in a mouse pancreatic tumor. siKras^G12DOr shKras^G12Dexos-treated mice showed a significant prolongation of lifespan, when compared to control exos-treated mice (which showed an average survival of 43 days), for shKras^G12Dexos-treated mice had an average survival of 50 days versus siKras^G12Dexos treated mice were 60 days (fig. 3B). Increased survival compared to control exos-treated mice at age-matched time points (fig. 3C) and corresponding experimental endpoints^G12DSignificant reduction in tumor burden in exos-treated mice was associated (fig. 7A). In addition to the significant survival advantage (FIG. 3B), siKras^G12DHistopathological characteristics of tumors of exos-treated mice (age matched to control exos-treated mice at age 44 days) revealed a relative increase in normal parenchymal lesions and PaNIN stage lesions, in contrast to almost complete transformation of pancreas to cancer tissue with invasive characteristics in control mice at age 44 days (fig. 3D). siKras when compared to control mice^G12DThe pancreas of exos treated mice at the median age of 60 days (experimental endpoint) still demonstrated improved histopathological features (fig. 7B). Experiments with GEMM were initially performed using exosomes derived from BJ human fibroblasts. To address the potential effect of material differences on the effect of siRNA exos in GEMM, isogenic fibroblasts were isolated from the pancreas of PKT mice and siKras^G12Dexos were generated from these primary cell cultures. The same improvements in survival, tumor burden and histopathological characteristics were noted when using the mouse fibroblast-derived siRNA exos as when using BJ fibroblast-derived siRNA exos and when compared to mice treated with control exos (fig. 3E-3F; fig. 7C). siKras^G12Dexos treatment significantly reduced the desmoplastic response associated with pancreatic cancer progression in PKT mice (reduced extracellular matrix deposition associated with fibrosis in PKT tumors, increased cancer cell apoptosis as determined by TUNEL staining, reduced cancer cell proliferation (reduced Ki67 staining)), and reduced phospho-ERK and phospho-AKT staining in tumorsColor (fig. 3G, fig. 7D).

Example 2-CD47 prevention of exosome uptake by circulating monocytes

Circulating monocytes were found to phagocytose liposomes (100 nm; purchased from Encapsula nanosciences) rather than exosomes (fig. 8A-8B). It was found that exosomes isolated from BJ fibroblasts contained CD47 on their surface (fig. 9A and 9C), but liposomes were identified as lacking CD47 on their surface (fig. 9B). It was found that treatment with exosomes of anti-CD 47 antibody stimulated uptake of exosomes by circulating monocytes in vivo (fig. 10).

***

All methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. It will be apparent to those skilled in the art that all such similar substitutes and modifications are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Reference to the literature

The following references are hereby incorporated by reference to the extent they provide exemplary procedural or other details supplementary to those set forth herein.

U.S. Pat. No. 4,870,287

U.S. Pat. No. 5,739,169

U.S. Pat. No. 5,760,395

U.S. Pat. No. 5,801,005

U.S. Pat. No. 5,824,311

U.S. Pat. No. 5,830,880

U.S. Pat. No. 5,846,945

Almoguera et al, Most human exocrine pancreatic carcinomas contain a mutant c-K-ras gene (best human carcinomas of the exocrine pancreas cancer Cell genes), "Cell (Cell)," 53: 549-554, 1988.

Alvarez-Erviti et al, Delivery of siRNA to the mouse brain by systemic injection of siRNA to the exosomes (Delivery of siRNA to the mouse brain by system injection of targeted exosomes), "Nature Biotechnology (Nature Biotechnology), 29: 341-345, 2011.

Austin-Ward and Villaseca, Gene therapy and its applications (Gene therapy and its applications), the journal of chile's medical care (rev. med. child.), 126: 838-845, 1998.

Baietti et al, Syndecan-endoproteins-ALIX regulated biosynthesis of exosomes, nature-cell biology (nat. cell Biol), 14: 677-685, 2012.

Biankin et al, Pancreatic cancer genome reveals aberrations in axon-guided pathway genes (functional cancer genes in axon guiding pathway genes), Nature (Nature), 491: 399-405, 2012.

Bukowski et al, signal transduction abnormalities in T lymphocytes from patients with advanced renal cancer: clinical relevance and efficacy of cytokine therapy (Signal transduction antigens in T lymphocytes from tissues with advanced secondary receptors: clinical release and effects of cytokine therapy), "clinical cancer research (clin. cancer Res.), 4: 2337-2347, 1998.

Chang et al, Pancreatic cancer genomics (Pancreatic cancer genomics), "Current Opinion in Genetics & Development," 24: 74-81, 2014.

Christodoulides et al, immunization with recombinant class 1 outer membrane proteins from Neisseria meningitis: the effect of liposomes and adjuvants on antibody affinity, recognition of native proteins and induction of bactericidal immune responses to meningococci in phase (Immunization with recombinant class 1 outer-membrane protein from neisserial immunity: infection of lipids and antigens on antibiotic activity, reproduction of native protein and the induction of bacterial immune response acquisition vaccine), "Microbiology (Microbiology), 144: 3027-3037, 1998.

Clayton et al, protect Antigen-presenting cell exosomes from complementary-mediated lysis by expression of CD55 and CD59 (anti-presenting cell exosomes area protected from complementary lysis by expression of CD55 and CD59), European Journal of Immunology (European Journal of Immunology), 33: 522-531, 2003.

Collins et al, require carcinogenic Kras for both initiation and maintenance of pancreatic cancer in mice (oncogeneic Kras is required for The initiation and maintenance of pancreatic cancer), "Journal of Clinical Investigation (The Journal of Clinical Investigation)," 122: 639 and 653, 2012a.

Collins et al, metastatic pancreatic cancer depends on the carcinogenic Kras in mice (Metastatic pancreatic cancer is dependent on oncogenic Kras in mice), "Integrated papers in the public library of sciences (PLoS One), 7: e49707, 2012b.

Combes et al, a new flow cytometry method of platelet-derived microvesicle quantification in plasma (a new flow cytometry method of platelet-derived microscopic quantification in plasma), "thrombosis and hemostasis (blood, 77: 220, 1997.

Cooper et al, Systemic exosome siRNA delivery reduces alpha-synuclein aggregates in the brains of transgenic mice (Systemic exosomal siRNA delivery reduced alpha-synuclein aggregates of transgenic mice, & J dyskinesias (Movement Disorders), 29: 1476-1485, 2014.

Davidson et al, intralesional cytokine therapy in cancer: examination of GM-CSF infusion in mesothelioma (oral cytokine therapy in cancer: a pilot study of GM-CSF infusion in mesothelioma), "J.Immunotherapy", 21: 389-398, 1998.

Du et al, systematic analysis of silencing effects of active siRNA at all single nucleotide mismatched target sites (a systematic analysis of the silencing effects of an active siRNA at an all single-nucleotide mismatched target site), "Nucleic Acids Research (Nucleic Acids Research"), 33: 1671-1677, 2005.

E1-Andaloussi et al, extracellular vesicles: biology and emerging therapeutic opportunities (excellar visities: biology and empirical therapeutic opportunities), "natural reviews: discovery of drugs (Nature Reviews Drug Discovery), 12: 347-357, 2013.

El-Andaloussi et al, Exosome-mediated delivery of siRNAs in vitro and in vivo (Exosome-mediated delivery of siRNAs in vitro and in vivo), "Nature Protocols", 7: 2112-2126, 2012.

Eser et al, Oncogenic KRAS signaling in pancreatic Cancer, Journal of Cancer in the United kingdom (British Journal of Cancer), 111: 817-822, 2014.

Gomes-da-Silva et al, lipid-based nanoparticles for siRNA delivery in cancer therapy: examples and challenges (Lipid-based nanoparticles for siRNA delivery in cancer therapy: parts and catalysts.) Chemical Research review (Accounts of Chemical Research), 45: 1163-1171, 2012.

Gysin et al, Therapeutic strategies for targeting ras proteins (Therapeutic strategies for targeting ras proteins), "Genes and cancers" (Genes & Cancer), 2: 359-372, 2011.

Curative effects of the mouse-human chimeric anti-ganglioside GM2 monoclonal antibody against multiple organ micrometastases of human lung cancer in NK cell-depleted SCID mice (Therapeutic efficacy of mouse-human polymeric anti-metastatic GM2 monomeric antigenic antibodies against human lung cancer in NK cell-depleted SCID mice, J.International cancer (Iht. J.cancer), 78: 480-485, 1998.

Hellstrand et al, Histamine and cytokine therapy (histamines and cytokines therapy), proceedings of oncology (Acta Oncol), 37: 347-353, 1998.

Hingorani et al, Trp53R172H and KrasG12D, in cooperation promote chromosomal instability and extensive metastatic pancreatic ductal adenocarcinoma (Trp53R 172H and KrasG12D Cooperate to metastatic ductal adenocarcinoma and without metastatic pancreatic ductal adenocarcinoma in mice, & Cancer cells (Cancer Cell), 7: 469-483, 2005.

Hollander, immunotherapy for B-cell lymphomas: current state and expected development (Immunotherapy for B-cell lymphoma: current status and reactive enhancements), Front Immunol, 3: 3,2013.

Howlader et al, "SEER Cancer Statistics Review (SEER Cancer Statistics Review)," 1975- "2011, National Cancer Institute (National Cancer Institute), Besserda, Md., at the world Wide Web at Seercancogov/csr/19752011/(" the world wide Web at Seercancerov/csr/1975- "2011 /), 2013.

Hruban et al, K-ras oncogene activation in adenocarcinomas of The human pancreas, study of 82 carcinomas using a combination of mutation-rich polymerase chain reaction analysis and allele-specific oligonucleotide hybridization (A study of 82 cancer using a combination of mutant-enhanced polymerase chain reaction analysis and allele-specific oligonucleotide hybridization), Journal of American Pathology (The American Journal of Pathology), 143: 545-554, 1993.

Hui and Hashimoto, a pathway for enhancing Immunogenicity during immunization Assisted with adjuvants for Plasmodium falciparum Major schizosporozoite Surface Protein 1 (Pathways for immunization during Adjuvant-Assisted immunization with Plasmodium falciparum Major Merozoite Surface Protein 1, infection and immunization (infectious. Immun.), 66: 5329-5336, 1998.

Ji et al, Ras activity level controls the development of pancreatic disease (Ras activity levels control of pancreatic diseases), "Gastroenterology (Gastroenterology"), 137: 1072-1082, 82e1-6, 2009.

Johnsen et al, exosomes as drug delivery vehicles-an overview of endogenous nanocarriers for targeted cancer therapy (A comprehensive overview of exosomes as drug delivery vehicles-endogenous nanocarriers for targeted cancer therapy, "biochemistry and biophysics Acta, 1846: 75-87, 2014.

Kahlert et al, Identification of Double-Stranded Genomic DNA Spanning all Chromosomes with Mutated KRAS and p53 DNA in Serum Exosomes of Patients with Pancreatic Cancer (Identification of Double Stranded Genomic DNA partitioning all Chromosomes with Mutated KRAS and p53 DNA in The Serum Exosomes of Patents with functional Cancer) 2014 biochemistry (The Journal of biological chemistry).

Kowal et al, biosynthesis and secretion of exosomes (Biogenesis and secretion of exosomes), "Current Opinion in Cell Biology," 29: 116-125, 2014.

Luga et al, Exosomes that autocrine Wnt-PCP signaling in breast cancer cell migration regulate matrix movement (Exosomes medium metabolism of autocrine Wnt-PCP signaling in Breast cancer cell migration), "cells", 151: 1542-1556, 2012.

Ma et al, Structural basis for overhang-specific small interfering RNA recognition by the PAZ domain (Structural basis for overlap-specific small interfering RNA recognition by the PAZ domain) Nature 429: 318-322, 2004.

Marcus and Leonard, fedex: truly delivered engineered Therapeutic Biological Nanoparticles (FedExosomes: Engineering Biological Nanoparticles that result from the delivery of drug substances (Basel), 6: 659-680, 2013.

Melo et al, Glypican-1 identified cancer exosomes and detected early pancreatic cancers (Glypican-1 identities and detectors early pancreatic cancer), "Nature", 523: 177-.

Ozdemir et al, Depletion and fibrosis of cancer-associated fibroblasts induces immunosuppression and promotes decreased pancreatic cancer survival (Depletion of cancer-associated fibroblasts and fibrosis antigens with reduced survival; cancer cells, 25: 719 734, 2014.

Pecot et al, Therapeutic Silencing of KRAS using Systemically Delivered siRNA (Therapeutic Silencing of KRAS using systemic Delivered siRNAs), "Molecular Cancer therapies (Molecular Cancer Therapeutics), 13: 2876-2885, 2014.

Peniado et al, Melanoma exosomes direct myeloid progenitor cells to a metastasis-promoting phenotype (melanomas exosomes bone marrow promoter cells) via MET, natural Medicine (Nature Medicine), 18: 883-891, 2012.

Polisono et al, functional regulation of genes and pseudogene mRNAs regulating tumor biology for unrelated coding of genes and pseudogene mRNAs (Nature, 465: 1033-1038, 2010.

Qin et al, Interferon-beta gene therapy inhibits tumor formation and causes regression of tumors formed in immunodeficient mice (interference-beta gene therapy inhibition tumors formation and tumors regression of ischemic tumors in immune-deficient mice, proce. 14411-14416, 1998.

Rachagani et al, Activated KrasG12D has been linked to pancreatic cancer cell invasion and metastasis by inhibiting E-cadherin (Activated KrasG12D is associated with pancreatic cancer cell invasion and metastasis of E-cadherin), "J.M.CANCER" (Br.J.cancer), 104: 1038-1048, 2011.

Rejiba et al, K-ras oncogene silencing strategy reduces tumor growth and enhances the chemotherapeutic efficacy of gemcitabine for pancreatic Cancer treatment (K-ras oncogene cloning treatment and enhancement of Cancer chemotherapy efficacy), Cancer Science (98: 1128-1136, 2007.

Siegel et al, Cancer statistics, 2014, CA: journal of cancer clinicians (CA: A cancer journal for clinicalans), 64: 9-29, 2014.

Simoes et al, Cationic liposomes for gene Delivery (Cationic lipids for gene Delivery), Expert Opinion on Drug Delivery, 2: 237-254, 2005.

Smakman et al, the double effect of Kras (D12) gene knock-out on tumorigenicity: increasing immune-mediated tumor clearance and abrogating tumor malignancies (Dual effect of Kras (D12) established tumor-mediated tumor clearance and abrogation of tumor pathology), "oncogenes (oncogenes)," 24: 8338-8342, 2005.

Sun et al, Characterization of mutations in the K-ras, p53, p16, and SMAD4 genes in 15 human pancreatic cancer cell lines (Characterization of the mutations of the K-ras, p53, pl6, and SMAD4 genes in 15 human cosmetic cancer cells), Oncology Reports (Oncology Reports), 8: 89-92, 2001.

Thery et al, exosomes: compositions, biosynthesis, and function (Exosomes: composition, biogenesis and function), "Nature review Immunology (Nature Reviews Immunology)," 2: 569-579, 2002.

Valadi et al, Exosome-mediated transfer of mRNA and microRNA is a novel mechanism of gene exchange between cells (Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells, Nature: cell Biology (Nature Cell Biology), 9: 654-659, 2007.

van den book et al, Exosomes as nucleic acid nanocarriers, "Advanced Drug Delivery Reviews", 65: 331-335, 2013.

van der Meel et al, extracellular vesicles as drug delivery systems: teachings from the field of liposome technology (excellular delivery as drug delivery systems: beads from the liposome field), "Journal of Controlled Release (Journal of Controlled Release), 195: 72-85, 2014.

Wahlgren et al, Plasma exosomes can deliver exogenous transient interfering RNAs to monocytes and lymphocytes (Plasma exosomes with driver exogenous short interfering RNAs to monocytes and lymphocytes), "nucleic acids research", 40: e130, 2012.

Xue et al, Small RNA combination therapy for lung cancer (Small RNA combination therapy for lung cancer), "Proceedings of the National Academy of Sciences USA," 111: e3553-3561, 2014.

Ying et al, carcinogenic Kras maintains pancreatic tumors by regulating anabolic glucose metabolism (Oncogenic Kras main pancreatic tumor regulation of anabolic glucose metabolism), cell 149: 656-670, 2012.

Yuan et al, Development of siRNA payload to target KRAS-mutant cancer, (Development of siRNA payloads to target KRAS-mutant cancer), "cancer discovery (cancer discovery"), 4: 1182-1197, 2014.

Zorde Khvalevsky et al, Mutant KRAS being a pharmaceutiques target for pancreatic cancer (Mutant KRAS is a drug target for pancreatic cancer), Proc. Natl.Acad.Sci., USA, 110: 20723-20728, 2013.

Sequence listing

<110> board of system president of university of Texas

<120> use of exosomes for treating diseases

<130> UTFC.P1261WO

<140> is still unknown

<141> 2016-06-10

<150> US 62/173,838

<151> 2015-06-10

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 1

guuggagcug auggcguagt t 21

<210> 2

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 2

ccgggttgga gctgatggcg tagttctcga gctacgccat cagctccaac ttttttt 57

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 3

acttgtggta gttggagcag a 21

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 4

ttggatcata ttcgtccaca a 21

<210> 5

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 5

attgtgaatg ttggtgt 17

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 6

gaaggtctca actgaaatt 19

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 7

gtaacccgtt gaaccccatt 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Synthesis of oligonucleotide

<400> 8

ccatccaatc ggtagtagcg 20