NAC transcription factor gene VaNAC08 and application thereof
阅读说明：本技术 NAC转录因子基因VaNAC08及其应用 (NAC transcription factor gene VaNAC08 and application thereof ) 是由 王泽民 晋昕 杨江伟 司怀军 梁振昌 于 2021-07-13 设计创作，主要内容包括：本发明提供了葡萄NAC转录因子基因VaNAC08及其应用。具体提供了葡萄野生种山葡萄和栽培种‘玫瑰香’NAC转录因子基因NAC08序列,NAC转录因子基因NAC08克隆方法并验证了该基因功能,进一步确定该基因在调节葡萄细胞可溶性糖、提高葡萄细胞膜低温耐受能力,最终提高葡萄抗寒能力中的应用。(The invention provides a grape NAC transcription factor gene VaNAC08 and application thereof. Particularly provides a wild grape and cultivated species 'rosewood' NAC transcription factor gene NAC08 sequence of grape, NAC transcription factor gene NAC08 cloning method and verifies the gene function, further determines the application of the gene in regulating the soluble sugar of grape cell, improving the low temperature tolerance of grape cell membrane and finally improving the cold resistance of grape.)
1. Grape NAC transcription factor gene NAC08, characterized in that the full-length transcript sequence of NAC transcription factor gene NAC08 is shown in sequence table SEQ ID NO. 1.
2. Grape NAC transcription factor gene NAC08, characterized in that the CDS sequence of NAC transcription factor gene NAC08 is shown in sequence table SEQ ID NO. 2.
3. Use of the grape NAC transcription factor gene NAC08 of any one of claims 1-2 to modulate cold resistance in grapes.
4. The use of the grape NAC transcription factor gene NAC08 to increase cold resistance in grapes of claim 3, characterized in that it is achieved with overexpression of the NAC08 gene.
5. Use of the grapevine transcription factor gene NAC08 of any one of claims 1-2 to increase soluble glucose in a glucose cell.
6. Use of the grape NAC transcription factor gene NAC08 of any one of claims 1-2 to reduce relative conductivity of grape cells.
7. A vector is characterized by comprising a gene shown as a sequence table SEQ ID NO. 2.
A method for cloning a NAC transcription factor gene VaNAC08, comprising the steps of: (1) extracting total RNA and synthesizing cDNA; (2) designing a primer and cloning a gene; (3) cloning vector construction and gene sequencing.
A method for verifying the function of NAC08, a NAC transcription factor, characterized in that it comprises the following steps: (1) construction of a VaNAC08 plant overexpression vector; (2) NAC08-ED (CRISPR/Cas9 mediated gene mutation) vector construction; 3) genetic transformation of grapes; (4) detecting the expression level of the exogenous gene; (5) measuring physiological and biochemical indexes of transgenic materials and evaluating cold resistance.
Technical Field
The invention belongs to the field of germplasm resource cultivation and molecular biology, and particularly relates to a NAC transcription factor gene VaNAC08 and application thereof.
Background
Grapes (Vitis vinifera L.) are perennial deciduous vine plants of the genus Vitis of the family vitidae, are the earliest domesticated fruit crops of human beings, have a long cultivation history in China, and the long domestication process of the grapes begins as early as 8000 years ago. The grapes are the second largest fruit tree crop in the world, are widely used for fresh eating, wine brewing, drying and the like, and have important economic value. Data of the international bureau for wine (OIV) in 2019 show that the planting area of a vineyard of 847 kilo hectares is currently available in China, and the yield of grapes reaches 1366.7 million tons. The grape industry in China has an important position internationally, and in recent years, the cultivation area and the yield are increased year by year.
The transcription factor interacts with DNA sequence at transcription level to regulate the expression and regulation of gene, and is one key step in gene expression and regulation. Plays an important role in regulating the growth and development of plants and the response to biotic or abiotic stress. Meanwhile, the signal conduction network is also a signal conduction network, and some intersections exist among signal conduction paths to form multiple combinations among regulatory factors. About 7% of the coding genes in plants encode transcription factors, and most of the genes are found to be genes responding early to biotic and abiotic stress. NAC transcription factor is a family of proteins that have multiple biological functions during plant growth and development. The NAC family transcription factor not only regulates the growth and development of plants, but also plays an important regulating and controlling role in the stress (biotic or abiotic stress) response process of plants and the like, and the cold resistance of the NAC transcription factor in grapes is rarely reported.
The problems existing in the prior art are as follows: the invention aims to provide theoretical and technical basis for the exploitation and utilization of gene resources and the promotion of cold-resistant cultivation of grapes.
Disclosure of Invention
The key technical problem to be solved by the invention is to provide a NAC transcription factor gene VaNAC08 and application thereof. In order to solve the technical problems, the invention adopts the following technical scheme:
1. grape NAC transcription factor gene NAC08, wherein the CDS sequence of NAC transcription factor gene NAC08 is shown in a sequence table SEQ ID NO. 1.
2. Application of grape NAC transcription factor gene NAC08 in regulating grape cold resistance.
3. The application of the grape NAC transcription factor gene NAC08 in improving the cold resistance of grapes is realized by over-expressing the NAC08 gene.
Application of NAC transcription factor VaNAC08 in improving soluble sugar of glucose cells
Under normal conditions, the soluble sugar content of the over-expression cell line and the wild cell line has no obvious difference; after low-temperature treatment (4 ℃, 4h), 35S, VaNAC08(OE-VaNAC08) over-expression transgenic cell line has obviously increased soluble sugar, and NAC08-ED mutation transgenic cells have obviously decreased. The results indicate a positive correlation of VaNAC08 with glucose soluble sugar content.
Application of NAC transcription factor VaNAC08 in reducing relative conductivity of grape cells
The OE-VaNAC08 cell line, the NAC08-ED cell line and the wild-type cell line were cryogenically treated and samples were collected to determine relative conductivity. Low temperatures can significantly increase the relative conductivities of wild-type and NAC08-ED mutant cell lines. Further analysis revealed that the relative conductivity of the OE-VaNAC08 cell line was significantly lower than that of wild type plants after 4h of low temperature (4 ℃). Each result indicates that upregulation of the VaNAC08 gene protects cells to some extent against osmotic stress-induced ion leakage, due to the reduced extent of cell injury resulting from the more potent tolerance of the OE-VaNAC08 cell line.
6. A vector contains a gene shown as a sequence table SEQ ID NO. 1.
A NAC transcription factor gene VaNAC08 and a cloning method thereof, which specifically comprise the following steps: (1) extracting total RNA and synthesizing cDNA; (2) designing a primer and cloning a gene; (3) cloning vector construction and gene sequencing.
The NAC transcription factor VaNAC08 function verification method specifically comprises the following steps: (1) construction of a VaNAC08 plant overexpression vector; (2) NAC08-ED (CRISPR/Cas9 mediated gene mutation) vector construction; 3) genetic transformation of grapes; (4) detecting the expression quantity of the exogenous gene; (5) measuring physiological and biochemical indexes of transgenic materials and evaluating cold resistance.
Has the advantages that: the application provides a wild vitis amurensis and cultivated species 'rosewood' NAC transcription factor gene NAC08 sequence of the vitis amurensis and a NAC transcription factor gene NAC08 cloning method, verifies the gene function, and further determines the application of the gene in regulating soluble sugar of grape cells, improving low-temperature tolerance capacity of grape cell membranes and finally improving the cold resistance capacity of the grapes.
Drawings
FIG. 1 shows the result of NAC08 amplification electrophoresis.
FIG. 2 is a sequence alignment of NAC 08.
FIG. 3 is a NAC08 overexpression identification. Vanac08 and NPTII insertion detection; VaNACC 08 expression assay with Actin and MDH as internal parameters. Each data is the average of 9 replicates and the error bars are standard deviations. Indicates that there was a significant difference of P <0.05 from EV (t-test).
FIG. 4 is the determination of cold resistance and physiological index of VaNAC08 over-expressing grape cells under low temperature stress. A. Freezing point of VaNAC08 overexpressing cells (LTE), phenotypic identification of overexpressing cell lines (OE-VaNAC08) and controls (empty). Each data is the average of 9 replicates and the error bars are standard deviations. Indicates that there was a significant difference of P <0.05 from EV (t-test). B. Electrolyte leaching rate; C. soluble sugar content. Each data is the average of 6 replicates and the error bars are standard deviations. Differences represent significant differences at P <0.05 (Duncan's multiple range test).
FIG. 5 is CRISPR/Cas 9-mediated identification of the mutation material NAC 08-ED.
FIG. 6 is CRISPR/Cas 9-mediated mutation analysis of the mutation material NAC 08-ED. Schematic representation of the editing sites in the nac08 gene. The blue boxes indicate exons and the green lines indicate introns. T is the target sequence position. SP-F and SP-R are primers for PCR amplification. B. Two editorial m3 and m4 sequencing peak plots. Ev material editing sequencing identification. D.30 clone amplicons. Homologous nucleotides are shaded and different colors indicate different levels of homology. Nucleotides with a homology level of 100% are indicated in blue, and nucleotides with a homology level of 75% are indicated in red. The red numbers on the right indicate the number of clones detected with the same mutation type. E. Editing results (D) corresponding to the mutant sequence of amino acid mutation.
FIG. 7 shows the measurement of the cold resistance and physiological index of NAC08-ED material. LTE of NACC 08-ED grape calli. Data are mean ± SE of 9 biological replicates. Electrolyte leakage rate (B) and soluble sugar content (C) of NAC08-ED grape and empty vector calli under cold stress (P <0.05, Duncan's multiple range assay).
Detailed description of the invention
The methods and devices used in the following examples of the present invention are conventional methods and devices unless otherwise specified; the equipment and the reagent are all conventional equipment and reagents purchased by a reagent company. In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention is provided in connection with the specific embodiments. Examples of these preferred embodiments are illustrated in the specific examples. It should be noted that, in order to avoid obscuring the technical solutions of the present invention with unnecessary details, only the technical solutions and/or processing steps closely related to the technical solutions of the present invention are shown in the embodiments, and other details that are not relevant are omitted.
Example 1
This example provides the sequence of grape NAC transcription factor gene NAC08, the CDS sequence of NAC transcription factor gene NAC08 is shown in sequence listing SEQ No. 1.
Example 2
The embodiment provides a grape NAC transcription factor gene NAC08 and a cloning method thereof, which specifically comprise the following steps:
1. total RNA extraction and cDNA Synthesis
(1) Respectively taking 100mg of young leaves of the vitis amurensis and the tissue culture seedling of the rosewood, grinding the young leaves into powder in liquid nitrogen, extracting total RNA of the grapes according to the method described in the appendix I, determining the purity and the concentration of the RNA by an ultramicro ultraviolet spectrophotometer, and taking an RNA sample with OD260/280 between 1.9 and 2.1 for reverse transcription reaction.
(2) The RNA sample is placed in an ice box to be slowly thawed, and the 1st Strand cDNA Synthesis kit is placed on ice to be thawed, vortexed and uniformly mixed, and then placed in crushed ice.
(3) Adding 1 μ g of RNA (corresponding volume calculated according to concentration) and RNase Free ddH into the micro-centrifuge tube (RNase Free)2Supplementing O to 8 μ L, heating at 65 deg.C for 5min, rapidly placing on ice, and standing for 2 min; the tube was removed and 5 XgDNA B. mu. ffer 2. mu.L was added. And placing the sample on a PCR instrument for reaction at 42 ℃ for 2min to fully degrade the DNA in the sample.
(4) The tube was removed and 10 XRT Mix 2. mu.L, HiScript III Enzyme Mix 2. mu. L, Oligo (dT) 20VN 1. mu. L, RNase-free ddH was added2O and 5. mu.L RNase Free ddH20 to 20. mu.L. Placing on a PCR instrument, reacting at 37 deg.C for 45min, and denaturing at 85 deg.C for 5 sec. The cDNA obtained by reverse transcription was taken out and diluted 10 times for subsequent PCR amplification.
2. Primer design and Gene cloning
The transcript sequence of NAC08 (GSVIVG01008839001) was downloaded from the grape genome database (https:// phytozome.jgi.doe.gov/pz/portal.html), and primers F were designed in the 5'-UTR and 3' -UTR, respectively, using Primer5.0 software: 5'-CCGGGAACCAAACATAGCCT-3', R: 5'-CGTCGGATGGAACCTGAAGC-3', the primers were synthesized by Okagaku Biotech, Beijing.
Performing PCR amplification on the coding region of the NAC08 gene by using I5 DNA high-fidelity polymerase by taking the first strand of grape cDNA as a template, wherein the reaction system is as follows: cDNA sample 1. mu.L, 2 XI 5mix 25. mu.L, Forward primer (10. mu.M) 2. mu.L, Reverse primer (10. mu.M) 2. mu.L, ddH2O to 50. mu.L and ddH2O to 50 uL. The reaction procedure is as follows: denaturation at 98 ℃ for 2min, 35 cycles (denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min), extension at 72 ℃ for 6min, and detection of specificity of the product by agarose electrophoresis, the results are shown in FIG. 1.
3. Cloning vector construction and gene sequencing
(1) The clear agarose gel was collected, NAC08 gene fragment was recovered as described in appendix II, and purity and concentration were determined using an ultraminiUV spectrophotometer.
(2) The PCR product was ligated into pLB-T Easy vector as follows: mu.L of PCR product after adding the A tail, 2.5. mu.L of 2 × Rapid Ligation Buffer, 0.5. mu.L of pLB-T Easy Vector and 0.5. mu.L of T4 DNA Ligase were added to a microcentrifuge tube, the tube was left at 4 ℃ overnight, and the product was stored at-20 ℃ for further use.
(3) LB plates were prepared. Adding a proper amount of ampicillin (Amp, 100mg/mL) into sterilized 100mL of LB solid culture medium at a proper temperature, uniformly mixing the culture medium and antibiotics, and pouring the mixture into a sterile culture dish to be cooled;
(4) slowly melting escherichia coli 5 alpha competent cells on ice, adding the connected product, softly and uniformly mixing by using a pipette, and placing on ice for 30 min;
(5) water bath at 42 deg.C for 60sec, and immediately ice-cooling for 2 min;
(6) adding 700 mu L of LB liquid culture medium without antibiotics into each experimental tube, and carrying out shake culture at 37 ℃ and 220rpm for 45-60 min;
(7) sucking a proper amount of bacterial liquid, adding the bacterial liquid to a selective culture medium, and uniformly spreading the bacterial liquid by using a spreader;
(8) after the surface bacterial liquid of the culture medium is dried, the culture medium is inverted and placed in a constant temperature incubator at 37 ℃ for culture for 12-16 h;
(9) selecting a clone with normal growth from an LB plate, inoculating the clone into 1mL of LB liquid culture medium containing Amp (100mg L-1), carrying out shake culture at 220rpm at 37 ℃ for 6h, and then taking 1 mu L of bacterial liquid for PCR detection;
(10) picking a white single colony by using a sterile gun head, adding the white single colony into 1mL of LB culture medium (containing 50ng/mL Amp), and carrying out shake culture at 37 ℃ and 220r/min for 16 h;
(11) taking 1 mu L of bacterial liquid, carrying out PCR identification on the bacterial liquid by adopting the PCR reaction conditions of 5.2.3, and detecting the amplification specificity by agarose electrophoresis.
(12) And (3) the bacterial liquid containing the target fragment identified by PCR is sent to Beijing Optimalaceae biological sequencing (universal primer PLB-F/R is adopted for sequencing), the integrity of the gene sequence is further identified, and the sequence result is compared with the corresponding sequence of the melanono genome in the grape database. The NAC08 sequence is shown in fig. 2 and the accompanying list. The positive clones that were correctly detected were then sent to the company for sequencing, the results of which are shown in FIG. 2.
Example 3
This example provides applications of the VaNAC08 gene, including:
1. construction of plant expression vector p2300-VaNAC08
(1) The ORF region of the VaNAC08 gene is obtained by amplification with primer NAC08-F/NAC08-R using cloning vector plasmid (ligated with VaNAC08) as template, and the obtained PCR product is purified for use.
(2) The pCAMBIA2300 vector plasmid is subjected to single enzyme digestion by KpnI similarly, electrophoresis detection is carried out, and a vector large fragment is recovered. A single cleavage with KpnI was performed to prepare the following reaction: pCAMBIA 23001. mu.g, KpnI 1. mu.L, 10 × CutSmart Buffer 5. mu.L, ddH2O to 50. mu.L. And (5) placing at 37 ℃ for 8h, then carrying out electrophoresis detection, and recovering and purifying to obtain the linear plasmid.
(3) The recovered VaNAC08 fragment was ligated with pCAMBIA2300 vector using homologous recombinase, and 3. mu.L of the VaNAC08 fragment, 2. mu.L of pCAMBIA 23001. mu.L, 2. mu.L of Sosoo mix, and 3. mu.L of ddH2O 5. mu.L were added to a microcentrifuge tube. The reaction solution was incubated at 50 ℃ for 30 min.
(4) The ligation product is transformed into Escherichia coli DH5 alpha by a heat shock method, and the bacterial liquid is smeared on a corresponding resistance screening LB culture medium, is cultured at 37 ℃ overnight and is inverted.
(5) After PCR and sequencing verification, the constructed expression vector was named p2300-VaNAC 08.
2. CRISPR/cas9 gene editing vector construction
(1) Inputting NAC08 gene gDNA sequence of a target gene into a targetDesign online tool (http:// skl. scau. edu. cn/targetDesign /), searching a potential Cas9 target site, and selecting the output target site to design target sgRNAs according to the position of the target site in the gene and the off-target possibility. The 20bp sgRNA sequence was ligated into the p1c.4 (gyrobium) vector as follows: (1) target site primer design GCGGAGTTGCAGTTACCTCCAGG; the forward universal primer sequences were as follows: U6p.4-F: 5 '_ CAGGAAACAGCTATGACCATATTCATTCGGAGTTTTTG TATC _ 3', reverse primer NAC08cas 9-R: NAC08cas 9-R: 5 '_ GCTATTTCTAGCTCTAAAAC- (GGAGGTAACTGCAAC TCCGC) -AATCACTACTTCGACTCT _ 3', the designed sequence was synthesized by a company and purified on the PAGE level.
(2) The pP1C.4 vector is subjected to double digestion by restriction enzymes EcoRI and XbaI, and the product after digestion is subjected to gel electrophoresis and then is cut into gel for recovery.
(3) And (5) constructing and verifying a vector. The recombinant products were transformed into E.coli competent cells by heat shock method, the experimental procedures for transformation were referred to 2.1.12. The screening is divided into two steps: firstly, a universal primer U6p.4-F/gRNA-R is used for PCR detection, and the size of a target fragment recovered by gel electrophoresis is about 400 bp. And (4) carrying out enzyme digestion detection on the recovered fragment restriction enzyme XbaI, wherein the clone which is not cut by the restriction enzyme is a positive clone. The positive clones were then sent to the company for sequencing to verify the correctness of the sequence. The sequencing primer is M13F (-47), and the sequencing of the target fragment is reverse. After the positive clone verification is finished, performing PCR detection on the other two elements in the vector by using the primer Hygjc2-F/R and the primer related to Cas9, and obtaining the final vector if the detection is positive.
3. Agrobacterium-mediated transformation method for grape callus
After positive cloning vectors are determined, the corresponding vectors are respectively transferred into cells of grape 41B suspension culture, and empty vectors are transformed to be used as a control. The specific operation method comprises the following steps:
preparation of agrobacterium suspension:
(1) activation for the 1st time. Activating agrobacterium liquid stored at-20 ℃: 5mL of LB liquid (5mL of LB pH 7.2+ 25. mu.L of 1M MgSO 2)4+10μL 50g L-1Rif+2.5μL 100g L-1Kan), inoculating 200. mu.L of bacterial liquid, culturing at 28 ℃ and 200rpm overnight until the liquid becomes turbid;
(2) and (5) activating for the 2 nd time. Adding 300-500 μ L of the activated bacterial liquid of the 1st time into 25mL of fresh liquid LB (25mL LB pH 7.2+125 μ L1M MgSO 2)4+50μL 50g L-1Rif+12.5μL 100g L-1Kan), culturing overnight at 28 ℃ and 200rpm until the thalli are shaken up again until the OD600 is 0.6-0.8;
(3) centrifuging at 4 deg.C and 5000rpm for 10min, removing supernatant, and collecting thallus;
(4) using 25mL LB medium (pH5.6, adding 125. mu.L 1M MgSO4) Resuspending, adding 25. mu.L 100mM AS, shaking at 28 deg.C and 200rpm for more than 3 hr;
(5) centrifuging at 4 ℃ and 5000rpm for 10min to collect thalli, adding 25mL of GM, and washing for 2 times; (Note: when the cells were washed and resuspended, the cells were gently shaken by hand, and the tip was not used for repeated aspiration)
(6) Adding 10mL of GM re-suspended bacteria, sucking 1mL of the re-suspended bacteria liquid, and measuring the OD value x;
(7) the volume of the somatic cell suspension liquid required to be added during infection is as follows: (0.2/x) mL.
Preparation of infection system:
(8) firstly, adding 10mL of GM culture medium into a sterile triangular flask;
(9) adding 0.5-1mL of suspension culture grape cells;
(10) finally, agrobacterium tumefaciens suspension cells (calculated in volume of 7) are added;
infection and co-culture:
(11) placing the triangular flask at 28 deg.C, and shaking gently at 120rpm for 30 min;
(12) sucking out all cells in the triangular flask by using a pipette, and transferring the cells into a sterile culture dish;
(13) sucking out all the redundant liquid, and sucking the liquid as dry as possible;
(14) transferring the cells to filter paper;
(15) gently spreading the cells evenly to make each cell contact the culture medium as much as possible, but not excessively disperse;
(16) co-culturing the culture dish in a constant temperature incubator at 28 ℃ for 2-3 days (according to the specific co-culture condition);
washing and screening agrobacterium:
(17) eluting the cells on the filter paper into a 100mL triangular flask by using 25mL GM culture medium, and slightly shaking by hand for 1-2 min;
(18) washing was repeated 1 time with 25mL GM;
(19) transfer the cells to a new Erlenmeyer flask with a 5mL pipette, add 50mL GM (containing the corresponding antibiotic)
(20) Culturing at 25 deg.C and 120rpm in dark condition, and changing culture medium every 7 days for 1 time until new cells grow out;
(21) an NAC08 ORF fragment, a pCAMBIA2300 vector neomycin (NPTII/Kan) resistance gene and a pP1C.4 hygromycin (Hyg) resistance gene sequence are selected, Primer design software Primer5.0 is utilized to design and identify primers (NAC 08-ORF-F: 5'-ATGACAGCGGAGTTGCAGTTA-3', NAC 08-ORF-R: 5'-GAAGGGCTT CTGCAGGTACA-3'; NPTII-F: 5'-ATTACCTTATCCGCAACTTCTTTACC-3', Hyg-R: 5'-AGCCCCTGATGCTCTTCGTC-3'; HPTII-F: 5'-CTTCTGCGGGCGATTTGT-3', Hyg-R: 5'-GCCGTGGTTGGCTTGTATG-3'), and the optimal primers are selected to be synthesized by Beijing Openkegaceae New industries biology company.
(22) Extracting DNA of the transgenic cells according to the method described in appendix III, and performing PCR detection by using an identifying primer, wherein the reaction procedure is as follows: pre-denaturation at 98 ℃ for 2min, 30 cycles (98 ℃ for 10sec, 60 ℃ for 30sec, 72 ℃ for 1min extension), and 72 ℃ for 6min extension), and final detection analysis by 1% agarose gel electrophoresis, the results are shown in FIGS. 3 and 5.
4. Analysis of Gene expression level
(1) The NAC08 ORF fragment was truncated to avoid the NAM conserved domain and qRT-PCR primers (qNAC 08-F: 5'-GAGCCCAAGTGGAAGGAGTG-3', qNAC 08-R: 5'-GATTATTC GGGAACTGAGACAAAA-3') were designed and synthesized using Primer design software Primer 5.0. Meanwhile, primer sequences of an Actin gene (GenBank access NO. EC969944, Actin-F: 5'-CTTGCATCCCTCAGCACCTT-3', Action-R: 5'-TCCTGTGGACAATGGATGGA-3') of a grape internal reference gene and an MDH (GenBank access NO. EC921711, MDH-F: 5'-CCATGCATCATCACCCACAA-3', MDH-R: 5'-GTCAACCATGCTAC TGTCAAAACC-3') of the grape internal reference gene are designed and synthesized.
(2) Extracting the RNA of the transgenic cell according to the method described in appendix I, adopting a Nordheim quantitative kit and carrying out reverse transcription according to a reverse transcription real-time fluorescence quantitative special reverse transcription reagent q-RT SuperMix, wherein the specific operation steps are as follows: removal of genomic DNA first: 4 XgDNA wiper Mix 2. mu.L, RNA 1. mu.g, RNase-free ddH2Supplementing O to 16 μ L, and standing at 42 deg.C for 2 min; then, 4. mu.L of 5 XHiScript II qRT Supermix II was added to the mixture in the previous step, and the mixture was left at 50 ℃ for 15min and at 85 ℃ for 5sec, and the product was stored at-20 ℃ for further use.
(3) cDNA for fluorescent quantitative PCR detection according to 1:10 plus ddH2Diluting for later use, and establishing a fluorescent quantitative PCR reaction system as followsThe following steps are required: 2 XSSYBR Green I Master Mix 10. mu.L, primer Mix 0.8. mu.L, cDNA 1.0. mu.L, ddH2O8.2. mu.L. The experimental apparatus used a CF96 fluorescent quantitative PCR instrument from BIORAD company, the reaction conditions used a standard model, and the reaction procedure was: pre-denaturation at 95 ℃ for 10min, 39 cycles (95 ℃ for 10sec, 60 ℃ for 30sec annealing, 72 ℃ for 30sec extension). Ct values were collected for each reaction and taken as 2-△△CtThe method analyzes relative expression amount of genes. The results are shown in FIG. 3.
5. Determination of physiological index of transgenic cell line and evaluation of cold resistance
(1) Three cell lines with the largest over-expression relative expression change and three cell lines with the highest relative expression amount of the Cas gene in the gene mutation (wild type cell lines and no-load control cell lines are cultured simultaneously, the editing and analyzing result of the gene mutation lines is shown in figure 6) are respectively selected, 3 bottles of each cell line are subjected to subculture for 7d, and then the cold resistance of the grape suspension cells is evaluated by adopting a differential thermal analysis system (DTA). A Keithley Data Acquisition System (DAS) (model 2700-DAQ-40) was connected to a programmable freezer (Tenney environmental test chamber (model T2℃) for measuring and collecting voltage outputs. callus was placed directly on thermoelectric modules (TEMs) with Empty Vehicle (EV) as a control, the refrigerator was programmed after 30min down to 4 deg.C by dropping to-16 deg.C at a cooling rate of 10h (2 deg.C h-1), maintaining at-16 deg.C for 1h, then returning to 4 deg.C within 45 min. DAS recorded a signal every 15 seconds from each TEM. Heat release was identified by a plot of thermistor output (x-axis) versus loaded TEM output minus unloaded TEM output (y-axis). Cold tolerance was evaluated using low temperature Release (LTEs) and the results are shown in FIGS. 4A and 7A.
(2) Selecting three cell lines with the largest overexpression relative expression change and three cell lines with the highest relative expression quantity of the Cas gene in gene mutation (simultaneously culturing a wild cell line and a no-load control cell line), carrying out subculture for 7d in 3 bottles for each cell line, collecting materials for relative conductivity measurement after normal growth condition and low temperature (4 ℃ for 4h), and obtaining results shown in FIGS. 4B and 7B; the results of the soluble sugar assay are shown in fig. 4C and 7C. The relative conductivity was measured by the soaking method, and the soluble sugar content was measured by the solibao soluble sugar measurement kit (BC 0030).
The foregoing is directed to embodiments of the present application and it is noted that numerous modifications and adaptations may be made by those skilled in the art without departing from the principles of the present application and are intended to be within the scope of the present application.
Appendix I: method for extracting total RNA of plant
The method is operated (with deletion) according to the instruction of the TIANGEN RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit, and comprises the following specific steps:
about 1.100mg of plant material was rapidly ground into powder in liquid nitrogen, 500. mu.L of lysate SL was added, immediately vortexed and mixed well.
2.12,000rpm for 2 min.
3. The supernatant was transferred to the filtration column CS, centrifuged at 12,000rpm for 2min, and the supernatant in the collection tube was pipetted into a new RNase-Free centrifuge tube.
4. Slowly adding 0.4 times of the volume of the supernatant of anhydrous ethanol, mixing, transferring the obtained solution and the precipitate into CR3, centrifuging at 12,000rpm for 15sec, pouring off the waste liquid, and placing the adsorption column CR3 back into the collection tube.
5. The adsorption column CR3 was centrifuged at 12,000rpm for 15sec with the deproteinizing solution RW1 (350. mu.L) added thereto, and the waste liquid was discarded, and the adsorption column CR3 was returned to the collection tube.
6. Preparing DNase I working solution: the DNase I stock solution is put into a new centrifuge tube (RNase-Free), 70 mu L of buffer RDD is added into each 10 mu L of the DNase I stock solution, and the mixture is gently mixed.
7. 80. mu.L of DNase I working solution was added to the adsorption column CR3, and the mixture was left at room temperature for 15 min.
8. The adsorption column CR3 was centrifuged at 12,000rpm for 15sec with the deproteinizing solution RW1 (350. mu.L) added thereto, and the waste liquid was discarded, and the adsorption column CR3 was returned to the collection tube.
9. To the adsorption column CR3, 500. mu.L of the rinsing solution RW was added, centrifuged at 12,000rpm for 15sec, the waste liquid was discarded, and the adsorption column CR3 was returned to the collection tube. And repeating the steps once.
10.12,000rpm for 2min, placing the adsorption column CR3 into a new centrifuge tube (RNase-Free), suspending 30-50 μ L RNase-Free ddH2O in the middle part of the adsorption membrane, standing at room temperature for 2-3min, and centrifuging at 12,000rpm for 2min to obtain RNA solution.
11. And (3) determining the concentration of RNA, detecting the quality of the RNA by electrophoresis, and storing the RNA in a refrigerator at the ultralow temperature of-70 ℃ for later use after the RNA is qualified.
Appendix II: agarose gel electrophoresis for recovering target DNA fragment
The method is operated according to the instruction (with deletion) of the Beijing Zhuang alliance micro-column concentrated agarose gel recovery kit, and comprises the following specific steps:
1. cutting out agarose gel containing target fragments, and putting the agarose gel into a 1.5mL centrifuge tube;
2. weighing the weight of the glue block, calculating according to 0.L g and 300 mul of sol solution, carrying out water bath at 55 ℃ for 10min, and turning upside down and mixing uniformly for several times in the process to ensure that the glue block is fully dissolved;
3. adding the glue solution into an adsorption column, standing at room temperature for 2min, centrifuging at 12000rpm for 30-60sec, and removing the filtrate;
4. add 600. mu.L of the rinsing solution PW to the adsorption column, centrifuge at 12000rpm for 30-60sec, and discard the filtrate. Repeating the steps once;
5. putting the adsorption column back into the collection tube, and centrifuging at 12000rpm for 2 min;
6. placing the adsorption column in a new centrifuge tube, standing at room temperature for 5min, adding 10 μ L of 65 deg.C preheated ddH2O dropwise to the middle position of the adsorption membrane, standing at room temperature for 2-3min, centrifuging at 12000rpm for 2min, collecting DNA solution, and storing at-20 deg.C for use.
Appendix iii: plant genome DNA extraction method
The method is carried out according to the instruction (with deletion) of the kit of the Edley DNA extraction kit, and comprises the following specific operation steps:
1. taking fresh leaves of transgenic arabidopsis thaliana about 100mg, taking wild type and idle load as controls, adding 700 mu L of buffer solution GP1, and fully grinding;
2. the ground homogenate was transferred to a 1.5mL centrifuge tube and placed in a water bath at 65 ℃ for 20min, and the mixture was inverted and mixed several times during the water bath.
3. Adding 700 μ L chloroform, shaking vigorously to mix well, centrifuging at 13523g for 5 min;
4. taking the supernatant, then adding 700 mu L of buffer solution GP2, and fully and uniformly mixing;
5. transferring the mixed solution into an adsorption column CB3, centrifuging for 30sec at 13523g, and removing the filtrate;
6. adding 500 μ L of buffer GD into adsorption column CB3, centrifuging for 30sec at 13523g, and discarding the filtrate;
7. adding 600 μ L of rinsing solution PW 3 into adsorption column CB3, centrifuging for 30sec at 13523g, discarding the filtrate, and repeating once;
8. putting the adsorption column CB3 back into the collecting pipe, centrifuging for 2min at 13523g, pouring off the filtrate, and then putting the adsorption column CB3 at room temperature for airing;
9. transferring the adsorption column CB3 into a new centrifuge tube, dripping 100 mu L of sterile water into the middle part of the adsorption membrane, standing for 2min at room temperature, centrifuging for 2min at 13523g, and collecting the DNA solution into the centrifuge tube;
and (4) detecting the quality of the DNA by electrophoresis, and performing PCR verification by taking the qualified DNA as a template.
Appendix iv: determination of soluble sugar content
The method is operated (with deletion) according to the specification of a Solebao plant soluble sugar content detection kit (BC0030), and comprises the following specific steps:
1. extraction of soluble sugars from the sample: weighing about 0.1-0.2 g of sample, adding 1mL of distilled water, grinding into homogenate, pouring into a centrifuge tube with a cover, boiling in a water bath for 10min (tightly covering to prevent water loss), cooling, 8000g, centrifuging at normal temperature for 10min, taking supernatant into a 15mL centrifuge tube, adding distilled water to constant volume of 10mL, and shaking uniformly for later use.
2. Preparation of assay: a. preheating the spectrophotometer for more than 30min, adjusting the wavelength to 620nm, and adjusting the distilled water to zero. b. The water bath was adjusted to 95 ℃. c. Preparing a working solution: adding 5mL of a second reagent into the first reagent, and using the mixture after the second reagent is fully dissolved, if the second reagent is difficult to dissolve, heating and stirring the mixture.
3. Adding the sample according to the sample adding table, mixing uniformly, covering the tube cover tightly, placing in a water bath at 95 ℃ for 10min, cooling to room temperature, and reading the light absorption values of a blank tube and a measuring tube respectively at 620nm, wherein delta A is A and the measuring tube is A blank tube. Establishment of a standard curve: and (4) adjusting the distilled water to zero at the position of 620nm, reading the light absorption value of the standard tube, and taking A as A standard tube-A blank tube. A standard curve was established with the concentration (y) as the ordinate and the absorbance A (x) as the abscissa. Note that: a. the blank tube only needs to be made into one tube. b. If Δ a is greater than 1, the sample needs to be diluted with distilled water and multiplied by the corresponding dilution factor in the formula. c. Please be cautious to operate concentrated sulfuric acid because of its strong corrosiveness.
Soluble sugar content calculation: a. substituting the Delta A into the formula (x) according to the standard curve to calculate the sample concentration y (mg/mL); b. Calculating according to the fresh weight of the sample: soluble sugar (mg/g fresh weight) — (y × V1) ÷ (W × V1 ÷ V2) — 10 × y ÷ W.
<110> university of agriculture in Gansu province
<120> NAC transcription factor gene VaNAC08 and application thereof
<160> 1
<210> 1
<211> 899
<212> DNA
<213> grape (vitas vinifera)
<400> 1
1 atgacagcgg agttgcagtt acctccaggc ttcaggttcc atccgacgga tgaggagctt
61 gtgatgcact atctgtgccg taaatgtgca tcgcaatcga tctctgtgcc gatcattgcc
121 gaaattgatc tctacaaatt cgatccctgg cagcttcctg agatggcctt gtacggagag
181 aaagagtggt acttcttttc gccgagagat cggaaatatc cgaacggttc aaggccgaac
241 cgggcagcgg gaacagggta ctggaaggcc accggagcgg ataagcctat tgggcatccg
301 aagccggttg ggattaagaa ggctttggtt ttttatgccg gaaaagcccc caggggagag
361 aagacaaatt ggattatgca tgaataccgg ctggcagacg tggaccggtc ggctcgcaag
421 aagaataata gcttaaggtt ggacgattgg gttctgtgcc gcatatacaa caagaagggg
481 attgtcgaga aacaacacac cgctgcccgg aaatcagatt gctccgatgt tgaggatcaa
541 aagcctggac ctcttgctct aagcaggaag gcaggtgcga tgcctccacc tccgccgccg
601 tcgtcctcta cggcaccaac tgcgacagcg gcactggacg atttggtgta cttcgactca
661 tcggattcgg tgccgcgcct ccacaccgac tcgagctgtt cggagcacgt ggtgtcgccg
721 gagttcacgt gcgagaggga ggtgcagagc gagcccaagt ggaaggagtg ggaaaatccc
781 atggactttt cgtacaatta catggatgcc acagttgaca acgcattttt gtctcagttc
841 ccgaataatc agatgtcgcc attgcaggac atgtttatgt acctgcagaa gcccttctg