阅读说明：本技术 用于治疗癌症的免疫调控性组合物和方法 (Immunomodulatory compositions and methods for treating cancer ) 是由 李立新 于 2020-03-13 设计创作，主要内容包括：本公开涉及使用联合疗法来治疗癌症的免疫调控性组合物和方法。(The present disclosure relates to immunomodulatory compositions and methods for treating cancer using combination therapy.)

1. A combination, comprising:

(i) an effective amount of an immunomodulatory chemotherapeutic agent; and

(ii) an effective amount of an immunotherapeutic agent comprising TLR7 and/or TLR8 agonist activity.

2. The combination of claim 1, wherein the immunotherapeutic agent has the structure of formula (I):

wherein the dotted line represents a bond or the absence of a bond;

x is S or-NR₁，R₁is-W₀—W₁—W₂—W₃—W₄，

W₀Is a bond, alkyl, alkenyl, alkynyl, alkoxy or-alkyl-S-alkyl-,

W₁is a bond, -O-or-NR₂-, wherein R₂Is hydrogen, an alkyl or an alkenyl group,

W₂is a bond, -O-, -C (O) -, -C (S) -, or-S (O)₂—，

W₃Is a bond, -NR₃-, wherein R₃Is hydrogen, an alkyl or an alkenyl group,

W₄is hydrogen, alkyl, alkenyl,Alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl or heterocyclyl, each of which is optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkyl-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–S-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R4, -alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN, -NO₂and-SH, wherein R₄Independently hydrogen, alkyl, alkenyl, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halo, cyano, nitro, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -O-C (O) -alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl, wherein each R is₅Independently hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl;

r is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkaneRadical-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄、–C(O)-NH-R₄、–C(O)-NR₄R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–O-C(O)-R₄、–S-R₄、–C(O)-S-R₄、–S-C(O)-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R₄-alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN and-SH, wherein R₄Independently is hydrogen, alkyl, alkenyl, alkoxy, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

n is 0, 1,2,3 or 4;

y is-NR₆R₇、–CR₆R₇R₈or-alkyl-NH₂Each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, -NH₂Halogen, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl,

wherein R is₆、R₇And R₈Independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, -alkyl-hydroxy, -alkyl-C (O) -O-R₉-alkyl-C (O) -R₉or-alkyl-O-C (O) -R₉Wherein each R is₅Independently is hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl, wherein R is₉Is hydrogen, alkyl, alkenyl, halogen or haloalkyl;

x and Z together may optionally form a (5-9) membered ring.

3. The combination according to claim 1, wherein the immunotherapeutic agent is a compound selected from the group consisting of:

2-propylthiazolo [4,5-c ] quinolin-4-amine,

1- (2-methylpropyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

4-amino-2- (ethoxymethyl) -aa-dimethyl-1H-imidazo [4,5-c ] quinoline-1-ethanol,

1- (4-amino-2-ethylaminomethylimidazo- [4,5-c ] quinolin-1-yl) -2-methylpropan-2-ol,

N- [4- (4-amino-2-ethyl-1H-imidazo [4,5-c ] quinolin-1-yl) butyl- ] methanesulfonamide,

4-amino-2-ethoxymethyl-aa-dimethyl-6, 7,8, 9-tetrahydro-1 h-imidazo [4,5-c ] quinoline-1-ethanol,

4-amino-aa-dimethyl-2-methoxyethyl-1 h-imidazo [4,5-c ] quinoline-1-ethanol,

1- {2- [3- (benzyloxy) propoxy ] ethyl } -2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

1- (2-amino-2-methylpropyl) -2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

1- {4- [ (3, 5-dichlorophenyl) sulfonyl ] butyl } -2-ethyl-1H-imidazo [4,5-c ] quinolin-4-amine,

N- {3- [ 4-amino-2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] propyl } -N' - (3-cyanophenyl) thiourea,

N- [3- (4-amino-2-butyl-1H-imidazo [4,5-c ] quinolin-1-yl) -2, 2-dimethylpropyl ] benzamide,

2-butyl-1- [3- (methylsulfonyl) propyl ] -1H-imidazo [4,5-c ] quinolin-4-amine,

N- {2- [ 4-amino-2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -1, 1-dimethylethyl } -2-ethoxyacetamide,

1- [ 4-amino-2-ethoxymethyl-7- (pyridin-4-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

1- [ 4-amino-2- (ethoxymethyl) -7- (pyridin-3-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

N- {3- [ 4-amino-1- (2-hydroxy-2-methylpropyl) -2- (methoxyethyl) -1H-imidazo [4,5-c ] quinolin-7-yl ] phenyl } methanesulfonamide,

1- [ 4-amino-7- (5-hydroxymethylpyridin-3-yl) -2- (2-methoxyethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

3- [ 4-amino-2- (ethoxymethyl) -7- (pyridin-3-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] propane-1, 2-diol,

1- [2- (4-amino-2-ethoxymethyl-1H-imidazo [4,5-c ] quinolin-1-yl) -1, 1-dimethylethyl ] -3-propylurea,

1- [2- (4-amino-2-ethoxymethyl-1H-imidazo [4,5-c ] quinolin-1-yl) -1, 1-dimethylethyl ] -3-cyclopentylurea,

1- [ (2, 2-dimethyl-1, 3-dioxolan-4-yl) methyl ] -2- (ethoxymethyl) -7- (4-hydroxymethylphenyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

4- [ 4-amino-2-ethoxymethyl-1- (2-hydroxy-2-methylpropyl) -1H-imidazo [4,5-c ] quinolin-7-yl ] -N-methoxy-N-methylbenzamide,

2-ethoxymethyl-N1-isopropyl-6, 7,8, 9-tetrahydro-1H-imidazo [4,5-c ] quinoline-1, 4-diamine,

1- [ 4-amino-2-ethyl-7- (pyridin-4-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol and

n- [4- (4-amino-2-ethyl-1H-imidazo [4,5-c ] quinolin-1-yl) butyl ] methanesulfonamide.

4. The combination of claim 1, wherein the immunotherapeutic agent comprises resiquimod.

5. The combination of claim 1, wherein the amount of the immunotherapeutic agent is capable of:

(1) inducing IFN- α in enriched human blood DC;

(2) inducing TNF- α in enriched human blood DC; and/or

(3) IL-12-alpha is induced in enriched human blood DCs.

6. The combination of claim 1, wherein the immunomodulatory chemotherapeutic agent comprises an anti-neoplastic agent.

7. The combination of claim 6, wherein the anti-tumor agent is selected from the group consisting of anthracyclines, bortezomib, oxaliplatin and cyclophosphamide.

8. The combination of claim 1, wherein the immunomodulatory chemotherapeutic agent comprises a Treg inhibitor.

9. The combination according to claim 8, wherein the Treg inhibitor is selected from the group consisting of dasatinib, cyclophosphamide), temozolomide, docetaxel and 5-fluorouracil.

10. The combination of claim 1, wherein the immunomodulatory chemotherapeutic agent comprises a myeloid-derived suppressor cell (MDSC) inhibitor.

11. The combination of claim 10, wherein the MDSC inhibitor is selected from the group consisting of paclitaxel, gemcitabine, 5-fluorouracil, oxaliplatin, cisplatin, carboplatin, dasatinib, sunitinib, and doxorubicin.

12. The combination of claim 1, wherein the immunomodulatory chemotherapeutic agent comprises an NK cell activator.

13. The combination according to claim 12, wherein the NK cell activator is selected from the group consisting of dasatinib and imatinib.

14. The combination of claim 1, wherein the combination is configured for systemic delivery.

15. The combination of claim 1, wherein the combination is configured for oral administration or parenteral injection.

16. The combination of claim 1, wherein the combination is configured for intravenous injection or intratumoral injection.

17. The combination of claim 1, wherein the immunotherapeutic agent is an agonist of both TLR7 and TLR 8.

18. A method for treating a tumor or abnormal cell proliferation in a subject in need of such treatment comprising administering to the subject a combination according to any one of claims 1-17.

19. The method of claim 18, wherein the abnormal cell proliferation comprises a precancerous lesion.

20. The method of claim 18, wherein the abnormal cell proliferation is of cancer cells.

21. The method of claim 20, wherein the cancer is selected from the group consisting of Acute Myeloid Leukemia (AML), breast cancer, Chronic Lymphocytic Leukemia (CLL), Chronic Myeloid Leukemia (CML), hodgkin's lymphoma, multiple myeloma, mycosis fungoides, neuroblastoma, non-hodgkin's lymphoma (NHL), ovarian cancer, and retinoblastoma.

22. The method of claim 18, comprising administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01mg/kg to about 0.02mg/kg, including all endpoints.

23. The method of claim 18, comprising administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of at least 0.0001mg/kg but no less than or about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01 mg/kg.

24. The method of claim 18, comprising administering to the subject an intravenous formulation comprising the immunotherapeutic agent weekly at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, or 0.006mg/kg to about 0.015mg/kg, including all endpoints.

25. The method of claim 18, comprising administering weekly to the subject an intravenous formulation comprising the immunotherapeutic agent at a dose of at least 0.0001mg/kg but not less than or about 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, or 0.01 mg/kg.

26. The method of claim 18, wherein the local concentration of the immunotherapeutic agent in the subject is about 0.005 μ g/ml to about 12 μ g/ml.

27. The method of claim 18, wherein the local concentration of the immunotherapeutic agent in the subject is about 0.05 μ g/ml, 0.1 μ g/ml, 0.15 μ g/ml, 0.2 μ g/ml, 0.3 μ g/ml, or 0.4 μ g/ml to about 0.5 μ g/ml.

28. The method of claim 18, comprising administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent in divided doses over 2-5 days at a dose of about 40-50 mg/kg.

29. The method of claim 28, wherein the combination is administered repeatedly at 2-4 week intervals over 1-5 days.

30. The method of claim 18, comprising administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent at a dose of about 10 to 15mg/kg, the dose administered every 7 to 10 days.

31. The method of claim 18, comprising administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic twice weekly at a dose of about 3 to 5 mg/kg.

32. The method of claim 18, comprising administering at about 60-120mg/m²Daily dosage an intravenous formulation comprising the immunomodulatory chemotherapeutic is administered to the subject continuously daily.

33. The method as claimed in claim 18, which includes a concentration of about 400-1000mg/m²Administering to said subject an oral formulation comprising said immunomodulatory chemotherapeutic agent, said dose administered in divided doses over 4-5 days.

34. The method of claim 18, comprising administering at about 50-100mg/m²Administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic at a dose per day or 1-5 mg/kg/day.

35. A kit comprising a combination according to any one of claims 1 to 17.

Technical Field

The present disclosure relates to immunomodulatory combinations and methods for treating cancer using combination therapy.

Background

In recent years, low-dose cyclophosphamide has been used clinically as a single agent or as a combination therapy for the treatment of Acute Myeloid Leukemia (AML), breast cancer, Chronic Lymphocytic Leukemia (CLL), Chronic Myeloid Leukemia (CML), hodgkin's lymphoma, multiple myeloma, mycosis fungoides, neuroblastoma, non-hodgkin's lymphoma (NHL), ovarian cancer, and retinoblastoma.

The efficacy of low doses of cyclophosphamide is mainly due to its immunomodulating ability in addition to its direct antitumor effect. The effect on regulatory T cells (tregs) is very relevant for low dose chemotherapeutic treatments. Tregs are CD4 that can suppress antigen-specific immune responses in both cytokine-dependent and cell contact-dependent ways⁺CD25⁺Foxp3⁺A lymphocyte. Thus, tregs can be made tumor specific by suppressing (CD 8)⁺Cytotoxic T lymphocytes and CD4⁺T helper cells) and tumor non-specific effector cells (natural killer (NK) and NK T cells). In a variety of human cancers, an increased proportion of Treg cells has been found, which is associated with a lack of tumor progression and therapeutic response. Thus, impairment of Treg activity by specific blocking or depletion is a method to enhance the immune response against tumor associated antigens. Many studies (preclinical and clinical) have documented the effect of low doses of cyclophosphamide on Treg cells. It reduces the number of Treg cells, inhibits Treg cell function, and increases both lymphocyte proliferation and memory T cells. This ability highlights the potential for synergy between traditional chemotherapy and novel immunotherapy.

Toll-like receptors (TLRs) are an important component of innate immunity and are the first line of defense against pathogens. Resiquimod is a ligand for TLR7 and TLR8 and directly activates innate immune cells, including myeloid dendritic cells, plasmacytoid dendritic cells and monocytes/macrophages. This activation can result in the activation of costimulatory molecules, the production of antiviral cytokines, and the stimulation of cell-mediated NK and T cell immune responses.

Disclosure of Invention

In general, the present disclosure provides a therapeutic combination and method for treating cancer

In one aspect, the present disclosure provides a combination comprising: an effective amount of an immunomodulatory chemotherapeutic agent; and an effective amount of an immunotherapeutic agent comprising TLR7 and/or TLR8 agonist activity. That is, the immunotherapeutic agent is an agonist of TLR7 or TLR8, or both.

In some embodiments, the immunotherapeutic agent has the structure of formula (I):

wherein the dotted line represents a bond or the absence of a bond;

x is S or-NR₁，R₁is-W₀—W₁—W₂—W₃—W₄，

W₀Is a bond, alkyl, alkenyl, alkynyl, alkoxy or-alkyl-S-alkyl-,

W₁is a bond, -O-or-NR₂-, wherein R₂Is hydrogen, an alkyl or an alkenyl group,

W₂is a bond, -O-, -C (O) -, -C (S) -, or-S (O)₂–，

W₃Is a bond, -NR₃-, wherein R₃Is hydrogen, an alkyl or an alkenyl group,

W₄is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl or heterocyclyl, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkyl-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–S-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R4, -alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN, -NO₂and-SH, wherein R₄Independently hydrogen, alkyl, alkenyl, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halo, cyano, nitro, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -O-C (O) -alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl, wherein each R is₅Independently hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl;

r is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkyl-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄、–C(O)-NH-R₄、–C(O)-NR₄R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–O-C(O)-R₄、–S-R₄、–C(O)-S-R₄、–S-C(O)-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R₄-alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN and-SH, wherein R₄Independently is hydrogen, alkyl, alkenyl, alkoxy, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

n is 0, 1,2,3 or 4;

y is-NR₆R₇、–CR₆R₇R₈or-alkyl-NH₂Each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, -NH₂Halogen, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl, wherein R is₆、R₇And R₈Independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, -alkyl-hydroxy, -alkyl-C (O) -O-R₉-alkyl-C (O) -R₉or-alkyl-O-C (O) -R₉Wherein each R is₅Independently is hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl, wherein R is₉Is hydrogen, alkyl, alkenyl, halogen or haloalkyl;

x and Z together may optionally form a (5-9) membered ring.

In some embodiments, the immunotherapeutic agent is a compound selected from the group consisting of:

2-propylthiazolo [4,5-c ] quinolin-4-amine,

1- (2-methylpropyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

4-amino-2- (ethoxymethyl) -aa-dimethyl-1H-imidazo [4,5-c ] quinoline-1-ethanol,

1- (4-amino-2-ethylaminomethylimidazo- [4,5-c ] quinolin-1-yl) -2-methylpropan-2-ol,

N- [4- (4-amino-2-ethyl-1H-imidazo [4,5-c ] quinolin-1-yl) butyl- ] methanesulfonamide,

4-amino-2-ethoxymethyl-aa-dimethyl-6, 7,8, 9-tetrahydro-1 h-imidazo [4,5-c ] quinoline-1-ethanol,

4-amino-aa-dimethyl-2-methoxyethyl-1 h-imidazo [4,5-c ] quinoline-1-ethanol,

1- {2- [3- (benzyloxy) propoxy ] ethyl } -2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

1- (2-amino-2-methylpropyl) -2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

1- {4- [ (3, 5-dichlorophenyl) sulfonyl ] butyl } -2-ethyl-1H-imidazo [4,5-c ] quinolin-4-amine,

N- {3- [ 4-amino-2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] propyl } -N' - (3-cyanophenyl) thiourea,

N- [3- (4-amino-2-butyl-1H-imidazo [4,5-c ] quinolin-1-yl) -2, 2-dimethylpropyl ] benzamide,

2-butyl-1- [3- (methylsulfonyl) propyl ] -1H-imidazo [4,5-c ] quinolin-4-amine,

N- {2- [ 4-amino-2- (ethoxymethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -1, 1-dimethylethyl } -2-ethoxyacetamide,

1- [ 4-amino-2-ethoxymethyl-7- (pyridin-4-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

1- [ 4-amino-2- (ethoxymethyl) -7- (pyridin-3-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

N- {3- [ 4-amino-1- (2-hydroxy-2-methylpropyl) -2- (methoxyethyl) -1H-imidazo [4,5-c ] quinolin-7-yl ] phenyl } methanesulfonamide,

1- [ 4-amino-7- (5-hydroxymethylpyridin-3-yl) -2- (2-methoxyethyl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol,

3- [ 4-amino-2- (ethoxymethyl) -7- (pyridin-3-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] propane 1, 2-diol,

1- [2- (4-amino-2-ethoxymethyl-1H-imidazo [4,5-c ] quinolin-1-yl) -1, 1-dimethylethyl ] -3-propylurea,

1- [2- (4-amino-2-ethoxymethyl-1H-imidazo [4,5-c ] quinolin-1-yl) -1, 1-dimethylethyl ] -3-cyclopentylurea,

1- [ (2, 2-dimethyl-1, 3-dioxolan-4-yl) methyl ] -2- (ethoxymethyl) -7- (4-hydroxymethylphenyl) -1H-imidazo [4,5-c ] quinolin-4-amine,

4- [ 4-amino-2-ethoxymethyl-1- (2-hydroxy-2-methylpropyl) -1H-imidazo [4,5-c ] quinolin-7-yl ] -N-methoxy-N-methylbenzamide,

2-ethoxymethyl-N1-isopropyl-6, 7,8, 9-tetrahydro-1H-imidazo [4,5-c ] quinoline-1, 4-diamine,

1- [ 4-amino-2-ethyl-7- (pyridin-4-yl) -1H-imidazo [4,5-c ] quinolin-1-yl ] -2-methylpropan-2-ol and

n- [4- (4-amino-2-ethyl-1H-imidazo [4,5-c ] quinolin-1-yl) butyl ] methanesulfonamide.

In some embodiments, the immunotherapeutic agent comprises resiquimod.

In some embodiments, the amount of the immunotherapeutic agent is capable of: (1) inducing IFN- α in enriched human blood DC; (2) inducing TNF- α in enriched human blood DC; and/or (3) inducing IL-12-alpha in enriched human blood DCs.

In some embodiments, the immunomodulatory chemotherapeutic agent comprises an anti-neoplastic agent, while other embodiments do not. In some embodiments, the anti-neoplastic agent is selected from the group consisting of anthracyclines (anthracerine), Bortezomib (Bortezomib), Oxaliplatin (Oxaliplatin), and Cyclophosphamide (Cyclophosphamide). Some embodiments specifically include one or more such agents, while other embodiments specifically exclude one or more or all such agents.

In some embodiments, the immunomodulatory chemotherapeutic comprises a Treg inhibitor, while other embodiments do not. In some embodiments, the Treg inhibitor is selected from the group consisting of Dasatinib (Dasatinib), cyclophosphamide (cyclophosamide), Temozolomide (Temozolomide), Docetaxel (Docetaxel), and 5-fluorouracil (5-Fluorouracile). Some embodiments specifically include one or more such agents, while other embodiments specifically exclude one or more or all such agents.

In some embodiments, wherein the immunomodulatory chemotherapeutic agent comprises a myeloid-derived suppressor cell (MDSC) inhibitor, while other embodiments do not. In some embodiments, the MDSC inhibitor is selected from the group consisting of Paclitaxel (Paclitaxel), Gemcitabine (Gemcitabine), 5-fluorouracil, oxaliplatin, Cisplatin (cissplatin), Carboplatin (Carboplatin), dasatinib, Sunitinib (Sunitinib), and Doxorubicin (Doxorubicin). Some embodiments specifically include one or more such agents, while other embodiments specifically exclude one or more or all such agents.

In some embodiments, the immunomodulatory chemotherapeutic agent comprises an NK cell activator, such as dasatinib and imatinib, while other embodiments do not. Some embodiments specifically include one or more such agents, while other embodiments specifically exclude one or more or all such agents.

In some embodiments, the combination is configured for systemic delivery. In some embodiments, the combination is configured for oral administration or parenteral injection. In some embodiments, the combination is configured for intravenous or intratumoral injection.

In some embodiments, the immunotherapeutic agent is an agonist of both TLR7 and TLR 8.

In another aspect, the present disclosure provides a method for treating a tumor or abnormal cell proliferation in a subject in need of such treatment, comprising administering to the subject a combination provided herein.

In some embodiments, the abnormal cell proliferation comprises a precancerous lesion.

In some embodiments, the abnormal cell proliferation is of a cancer cell. In some embodiments, the cancer is selected from the group consisting of Acute Myeloid Leukemia (AML), breast cancer, Chronic Lymphocytic Leukemia (CLL), Chronic Myeloid Leukemia (CML), hodgkin's lymphoma, multiple myeloma, mycosis fungoides, neuroblastoma, non-hodgkin's lymphoma (NHL), ovarian cancer, and retinoblastoma.

In some embodiments, the method comprises administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01mg/kg to about 0.02mg/kg, including all endpoints. In further embodiments, the range of doses is defined by any pair of doses in the foregoing list.

In some embodiments, the method comprises administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of at least 0.0001mg/kg but no less than or about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01 mg/kg.

In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunotherapeutic agent weekly at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, or 0.006mg/kg to about 0.015mg/kg, including all endpoints. In further embodiments, the range of doses is defined by any pair of doses in the foregoing list.

In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunotherapeutic agent weekly at a dose of at least 0.0001mg/kg but not less than or about 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, or 0.01 mg/kg.

In some embodiments, the local concentration of the immunotherapeutic agent in the subject is about 0.005 μ g/ml to about 12 μ g/ml.

In some embodiments, the local concentration of the immunotherapeutic agent in the subject is about 0.05 μ g/ml, 0.1 μ g/ml, 0.15 μ g/ml, 0.2 μ g/ml, 0.3 μ g/ml, or 0.4 μ g/ml to about 0.5 μ g/ml. In a further embodiment, the range of concentrations is defined by any pair of doses from the foregoing list.

In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent in divided doses over 2-5 days at a dose of about 40-50 mg/kg.

In some embodiments, wherein the combination is administered repeatedly at 2-4 week intervals over 1-5 days.

In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent at a dose of about 10 to 15mg/kg, the dose administered every 7 to 10 days.

In some embodiments, the method comprises administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic twice weekly at a dose of about 3 to 5 mg/kg.

In some embodiments, the method comprises administering the composition at about 60-120mg/m²Daily dosage an intravenous formulation comprising the immunomodulatory chemotherapeutic is administered to the subject continuously daily.

In some embodiments, the method comprises treating the mammal with about 400-1000mg/m²Administering to said subject an oral formulation comprising said immunomodulatory chemotherapeutic agent, said dose administered in divided doses over 4-5 days. In some embodiments, such administration is repeated at 2-4 week intervals.

In some embodiments, the method comprises administering the composition at about 50-100mg/m²Administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic at a dose per day or 1-5 mg/kg/day. In some embodiments, such administration is repeated at 2-4 week intervals.

In a further aspect, the present disclosure provides a kit comprising a combination provided herein, and optionally with instructions.

Drawings

The novel features believed characteristic of the embodiments of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

FIGS. 1A-D depict the assessment of the antitumor effect of cyclophosphamide/TLRL combination therapy in syngeneic tumor models. FIG. 1A: plan of treatment protocol developed for the treatment of C26 tumors. 100-12 at day 10 after tumor challenge0mm³Begins treatment and is administered weekly for 3 cycles starting on day 10. FIG. 1B: antitumor effect of systemic TLRL (resiquimod) in the C26 tumor model. Mix 4x10⁵One cell was inoculated subcutaneously into Balb/c mice. After allowing the tumor to grow for 10 days, groups of 8 mice were treated with Vehicle (Vehicle) or intraperitoneal administration with 1mg cyclophosphamide, or with 1.6 μ g TLRL by intravenous injection or combination therapy at the indicated dose. The compounds were administered weekly for three cycles. Data are represented by median tumor volume measurements for each group. Data for 8 mice per group are presented as mean ± SD. Statistical comparisons were performed using Student's t-test. Figure 1C depicts median tumor volume measurements during weekly treatment with 1.6 μ g resiquimod i.v. and low dose cyclophosphamide i.p. C26 tumor growth curves of vehicle, 1mg cyclophosphamide, 1.6 μ g TLRL (resiquimod) or 1.6 μ g TLRL (resiquimod) in Balb/C mice with various doses of cyclophosphamide at the indicated doses. The compounds were administered weekly for three cycles. These data are represented by median tumor volume measurements for each group (n-8). Figure 1D depicts median tumor volume measurements during treatment of C26 with 3.2 μ g resiquimod i.v. and low dose cyclophosphamide i.p. Tumor growth curves of vehicle, 1mg cyclophosphamide, 3.2 μ g TLRL (resiquimod) or 3.2 μ g TLRL (resiquimod) in Balb/c mice with various doses of cyclophosphamide at the indicated doses. The compound was administered three times per week. These data are represented by median tumor volume measurements for each group (n-8).

FIG. 2 depicts activated immune cells (CD 45) in TLRL or TLRL/Cyc treated tumors⁺) The infiltration of (a) is increased. Histological characterization of CD45 positive cells was performed in treated mice. Tumor samples were obtained from mice treated with TLRL, cyclophosphamide or TLRL/cyclophosphamide. With hematoxylin and eosin (H)&E) Tissue sections were counterstained. The CD45 protein was visualized by a darker (original: brown) color, some of which are indicated by arrows.

FIG. 3 depicts increased IFN α inducible gene expression in TLRL or TLRL/Cyc treated tumors. Expression of IFN α inducible genes in dLN and spleen of treated mice. After a second treatment with TLRL or cyclophosphamide or combination therapy, RNA was isolated from draining lymph nodes and spleen and the relative expression of the IFN α inducible genes MX2, ISG15 and IRF7 was determined by quantitative RT-PCR. The values represent the mRNA expression of the indicated IFN α inducible gene relative to actin of the housekeeping gene.

Detailed Description

Several aspects of embodiments of the present invention are described below in conjunction with example applications for purposes of illustration. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. One skilled in the relevant art will readily recognize, however, that the invention can be practiced without one or more of the specific details, or with other methods. The present invention is not limited by the illustrated ordering of acts or events, as some acts may occur in different orders and/or concurrently with other acts or events.

Moreover, not all illustrated acts or events are required to implement a methodology in accordance with an embodiment of the present invention.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, if the terms "including", "having", "with", or variants thereof are used in the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising".

The terms "about" or "approximately" mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean within 1 standard deviation or over 1 standard deviation, according to practice in the art. Alternatively, "about" may represent a range of up to 20%, preferably up to 10%, more preferably up to 5% and more preferably still up to 1% of a given value. Alternatively, especially for biological systems or processes, the term may mean within one order of magnitude, preferably within 5-fold, more preferably within 2-fold of a certain value. Where particular values are described in the application and claims, the term "about" shall be construed to mean within an acceptable error range for the particular value, unless otherwise specified.

I.Definitions and abbreviations

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments of the invention belong. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization are those well known and commonly employed in the art. Nucleic acid and peptide synthesis was performed using standard techniques. These techniques and procedures are generally performed according to conventional methods in the art and various general references provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, as well as the organic syntheses described below, are those well known and commonly employed in the art. Chemical synthesis and chemical analysis were performed using standard techniques or modifications thereof.

Unless otherwise indicated, the term "alkyl" by itself or as part of another substituent means a straight or branched chain or cyclic hydrocarbon group, or combinations thereof, which may be fully saturated, monounsaturated, or polyunsaturated, and may contain the indicated number of carbon atoms (i.e., C)₁-C₁₀Representing one to ten carbons) of divalent and polyvalent radicals. Examples of saturated hydrocarbyl radicals include, but are not limited to, groups such as: methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl) methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl and the like. An unsaturated alkyl group is an alkyl group having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, ethenyl, 2-propenyl, crotyl, 2-isopentenyl, 2- (butadienyl), 2, 4-pentadienyl, 3- (1, 4-pentadienyl), ethynyl, 1-and 3-propynyl, 3-butynyl, and higher homologs, andisomers. Unless otherwise indicated, the term "alkyl" is also intended to include those alkyl derivatives defined in more detail below, such as "heteroalkyl. Alkyl groups limited to hydrocarbyl groups are referred to as "homoalkyls".

The term "alkylene" by itself or as part of another substituent refers to a divalent radical derived from an alkane, such as, but not limited to, -CH₂CH₂CH₂CH₂And further includes those groups described below as "heteroalkylene". Typically, the alkyl (or alkylene) groups will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in embodiments of the invention. "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, typically having eight or fewer carbon atoms.

The terms "alkoxy", "alkylamino" and "alkylthio" (or thioalkoxy) are used in their conventional sense and refer to those alkyl groups attached to the rest of the molecule through an oxygen atom, an amino group, or a sulfur atom, respectively.

Unless otherwise specified, the term "heteroalkyl," by itself or in combination with another term, means a stable straight or branched chain, or cyclic hydrocarbyl group, or combinations thereof, consisting of the recited number of carbon atoms and at least one heteroatom selected from O, N, Si and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. The heteroatoms O, N and S and Si can be located at any internal position of the heteroalkyl group or at a position where the alkyl group is attached to the rest of the molecule. Examples include, but are not limited to-CH₂-CH₂-O-CH₃、-CH₂-CH₂-NH-CH₃、-CH₂-CH₂-N(CH₃)-CH₃、-CH₂-S-CH₂-CH₃、-CH₂-CH₂,-S(O)-CH₃、-CH₂-CH₂-S(O)₂-CH₃、-CH＝CH-O-CH₃、-Si(CH₃)₃、-CH₂-CH＝N-OCH₃and-CH ═ CH-N (CH)₃)-CH₃. Up to two heteroatoms may be consecutive, e.g. -CH₂-NH-OCH₃and-CH₂-O-Si(CH₃)₃. Similarly, the term "heteroalkylene" by itself or as part of another substituent refers to a divalent radical derived from a heteroalkyl radical, such as, but not limited to, -CH₂-CH₂-S-CH₂-CH_2-and-CH₂-S-CH₂-CH₂-NH-CH₂-. For heteroalkylene groups, heteroatoms can also occupy one or both of the chain ends (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, the orientation in which the formula of the linking group is written does not imply an orientation of the linking group. For example, of the formula-C (O)₂R' -represents-C (O)₂R '-and-R' C (O)₂-both.

Typically, the "acyl substituent" is also selected from the above groups. As used herein, the term "acyl substituent" refers to a group that is attached to and satisfies the valence of the carbonyl carbon of the polycyclic core that is directly or indirectly attached to the compounds of the embodiments.

Unless otherwise indicated, the terms "cycloalkyl" and "heterocycloalkyl" by themselves or in combination with other terms represent cyclic forms of "alkyl" and "heteroalkyl," respectively. Further, for heterocycloalkyl, a heteroatom may occupy the position at which the heterocycle is attached to the rest of the molecule. Examples of cycloalkyl groups include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1- (1,2,5, 6-tetrahydropyridinyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothiophen-2-yl, tetrahydrothiophen-3-yl, 1-piperazinyl, 2-piperazinyl, and the like.

Unless otherwise indicated, the term "halo" or "halogen" by itself or as part of another substituent means a fluorine, chlorine, bromine or iodine atom. Further, terms such as "haloalkyl" are intended to include monohaloalkyl and polyhaloalkyl. For example, surgeryThe term "halo (C)₁-C₄) Alkyl "is meant to include, but is not limited to, trifluoromethyl, 2,2, 2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.

As used herein, the term "haloalkyl" refers to an alkyl group, as defined herein, substituted with one or more halo groups, as defined herein. Preferably, the haloalkyl group may be a monohaloalkyl, dihaloalkyl or polyhaloalkyl group, including perhaloalkyl groups. The monohaloalkyl group can have one iodine, bromine, chlorine or fluorine within the alkyl group. Dihaloalkyl and polyhaloalkyl groups may have two or more of the same halogen atoms or a combination of different halogen groups within the alkyl group. Preferably, the polyhaloalkyl group contains up to 12, 10 or 8 or 6 or 4 or 3 or 2 halogen groups. Non-limiting examples of haloalkyl groups include fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichloromethyl, trichloromethyl, pentafluoroethyl, heptafluoropropyl, difluorochloromethyl, dichlorofluoromethyl, difluoroethyl, difluoropropyl, dichloroethyl, and dichloropropyl. Perhaloalkyl refers to alkyl groups in which all hydrogen atoms are substituted with halogen atoms.

As used herein, the term "heteroaryl" refers to a 5-14 membered monocyclic or bicyclic or fused polycyclic ring system having 1 to 8 heteroatoms selected from N, O, S or Se. Preferably, the heteroaryl group is a 5-to 10-membered ring system. Typical heteroaryl groups include 2-or 3-thienyl, 2-or 3-furyl, 2-or 3-pyrrolyl, 2-, 4-or 5-imidazolyl, 3-, 4-or 5-pyrazolyl, 2-, 4-or 5-thiazolyl, 3-, 4-or 5-isothiazolyl, 2-, 4-or 5-oxazolyl, 3-, 4-or 5-isoxazolyl, 3-or 5-1,2, 4-triazolyl, 4-or 5-1,2, 3-triazolyl, tetrazolyl, 2-, 3-or 4-pyridyl, 3-or 4-pyridazinyl, 3-, 4-or 5-pyrazinyl, 2-pyrazinyl, 2-, 4-or 5-pyrimidinyl.

The term "heteroaryl" also refers to a group in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocycloalkyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include, but are not limited to, 1-, 2-, 3-, 5-, 6-, 7-or 8-indolizinyl, 1-, 3-, 4-, 5-, 6-or 7-isoindolyl, 2-, 3-, 4-, 5-, 6-or 7-indolyl, 2-, 3-, 4-, 5-, 6-or 7-indazolyl, 2-, 4-, 5-, 6-, 7-or 8-purinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-or 9-murazinyl, 2-, 3-, 4-, 5-, 6-, 7-or 8-quinolinyl, 1-, 3-, 4-, 5-, 6-, 7-or 8-isoquinolinyl, 1-, 4-, 5-, 6-, 7-or 8-phthalazinyl, 2-, 3-, 4-, 5-or 6-naphthyridinyl, 2-, 3-, 5-, 6-, 7-or 8-quinazolinyl, 3-, 4-, 5-, 6-, 7-or 8-cinnolinyl, 2-, 4-, 6-or 7-pteridinyl, 1-, 2-, 3-, 4-, 5-, 6-, 7-or 8-4 aH-carbazolyl, 1-, 2-, 3-, 4-, 5-, 6-, 7-or 8-carbazolyl, 1-, 3-, 4-, 5-, 6-, 7-, 8-or 9-carbolinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-or 10-phenanthridinyl, 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-or 9-acridinyl, 1-, 2-, 4-, 5-, 6-, 7-, 8-or 9- -pyridinyl, 2-, 3-, 4-, 5-, 6-, 8-, 9-or 10-phenanthrolinyl, 1-, 2-, 3-, (a) a salt thereof, a pharmaceutical composition comprising the compound, 4-, 6-, 7-, 8-or 9-phenazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-or 10-phenothiazinyl, 1-, 2-, 3-, 4-, 6-, 7-, 8-, 9-or 10-phenoxazinyl, 2-, 3-, 4-, 5-, 6-or l-, 3-, 4-, 5-, 6-, 7-, 8-, 9-or 10-benzisoquinolinyl, 2-, 3-, 4-or 5-thieno [2,3-b ] furyl, 2-, 3-, 5-, 6-, (a) phenothiazinyl, a salt thereof, or a salt thereof, 7-, 8-, 9-, 10-or 11-7H-pyrazino [2,3-c ] carbazolyl, 2-, 3-, 5-, 6-or 7-2H-furan [3,2-b ] -pyranyl, 2-, 3-, 4-, 5-, 7-or 8-5H-pyrido [2,3-d ] -o-oxazinyl, 1-, 3-or 5-1H-pyrazolo [4,3-d ] -oxazolyl, 2-, 4-or 54H-imidazo [4,5-d ] thiazolyl, 3-, 5-or 8-pyrazino [2,3-d ] pyridazinyl, 2-, 3-, 5-or 6-imidazo [2,1-b ] thiazolyl, 1-, 3-, 6-, 7-, 8-or 9-furo [3,4-c ] cinnolinyl, 1-, 2-, 3-, 4-, 5-, 6-, 8-, 9-, 10-or 11-4H-pyrido [2,3-c ] carbazolyl, 2-, 3-, 6-or 7-imidazo [1,2-b ] [1,2,4] triazinyl, 7-benzo [ b ] thienyl, 2-, 4-, 5-, 6-or 7-benzoxazolyl, 2-, 4-, 5-, 6-or 7-benzimidazolyl, 2-, 4-, 5-, 6-or 7-benzothiazolyl, 1-, 2-, 4-, 5-, 6-, 7-, 8-or 9-benzoxarenyl, 2-, 4-, 5-, 6-, 7-or 8-benzoxazinyl, 1-, 2-, 3-, 5-, 6-, 7-, 8-, 9-, 10-or 11-1H-pyrrolo [1,2-b ] [2] benzazepinyl. Typical fused heteroaryl groups include, but are not limited to, 2-, 3-, 4-, 5-, 6-, 7-or 8-quinolinyl, 1-, 3-, 4-, 5-, 6-, 7-or 8-isoquinolinyl, 2-, 3-, 4-, 5-, 6-or 7-indolyl, 2-, 3-, 4-, 5-, 6-or 7-benzo [ b ] thienyl, 2-, 4-, 5-, 6-or 7-benzoxazolyl, 2-, 4-, 5-, 6-or 7-benzimidazolyl, 2-, 4-, 5-, 6-or 7-benzothiazolyl.

As used herein, the term "heterocyclyl" or "heterocycle" refers to an optionally substituted, fully saturated or unsaturated, aromatic or non-aromatic cyclic group, for example, which is a 4-to 7-membered monocyclic, 7-to 12-membered bicyclic, or 10-to 15-membered tricyclic ring system having at least one heteroatom in at least one carbon atom-containing ring. Each ring in the heterocyclic group containing a heteroatom may have 1,2 or 3 heteroatoms selected from nitrogen atoms, oxygen atoms and sulfur atoms, where the nitrogen and sulfur heteroatoms may also be optionally oxidized. The heterocyclic group may be attached at a heteroatom or carbon atom.

Exemplary monocyclic heterocyclic groups include pyrrolidinyl, pyrrolyl, pyrazolyl, oxetanyl, pyrazolinyl, imidazolyl, imidazolinyl, imidazopyridinyl, triazolyl, oxazolyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolyl, thiadiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, furyl, tetrahydrofuryl, thienyl, oxadiazolyl, piperidinyl, piperazinyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, 2-oxopazanyl, azanyl, 4-piperidinonyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, tetrahydropyranyl, morpholinyl, thiomorpholinyl sulfoxide, thiomorpholinyl sulfone, 1, 3-dioxolane and tetrahydro-1, 1-dioxothienyl, 1,1, 4-trioxo-1, 2, 5-thiadiazol-2-yl, and the like.

Exemplary bicyclic heterocyclic groups include indolyl, indolinyl, benzothiazolyl, benzoxazinyl, benzoxazolyl, benzothienyl, benzothiazinyl, quinuclidinyl, quinolinyl, tetrahydroquinolinyl, decahydroquinolinyl, isoquinolinyl, tetrahydroisoquinolinyl, decahydroisoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, chromonyl, coumarinyl, benzopyranyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridinyl, furpyridinyl (e.g., furan [2,3-c ] pyridinyl, furan [3,2-b ] -pyridinyl ] or furan [2,3-b ] pyridinyl), dihydroisoindolyl, 1, 3-dioxo-1, 3-dihydroisoindol-2-yl, dihydroquinazolinyl (e.g., 3, 4-dihydro-4-oxo-quinazolinyl), phthalazinyl, and the like.

Exemplary tricyclic heterocyclic groups include carbazolyl, dibenzoazepinyl, dithienoazepinyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, phenoxazinyl, phenothiazinyl, thioxanthyl, carbolinyl, and the like.

The term "heterocyclyl" also refers to heterocyclic groups as defined herein which are substituted with 1,2 or 3 substituents selected from:

(a) an alkyl group;

(b) hydroxyl (or protected hydroxyl);

(c) halogen;

(d) oxygen, i.e., ═ O;

(e) amino, alkylamino or dialkylamino;

(f) an alkoxy group;

(g) a cycloalkyl group;

(h) a carboxyl group;

(i) heterocyclyloxy, wherein heterocyclyloxy represents a heterocyclic group bonded through an oxygen bridge;

(j) alkyl-O-C (O) -;

(k) a mercapto group;

(l) A nitro group;

(m) cyano;

(n) an aminosulfonyl or sulfonylamino group;

(o) an aryl group;

(p) alkyl-C (O) -O-;

(q) aryl-c (O) -O-;

(r) aryl-S-;

(s) aryloxy;

(t) alkyl-S-;

(u) formyl, i.e., HC (O) -;

(v) a carbamoyl group;

(w) aryl-alkyl-; and

(x) Aryl substituted with alkyl, cycloalkyl, alkoxy, hydroxy, amino, alkyl-C (O) -NH-, alkylamino, dialkylamino or halo.

The term "alkenyl" as used herein refers to a straight or branched chain hydrocarbon group having 2 to 20 carbon atoms and comprising at least one double bond. The alkenyl group preferably has about 2 to 8 carbon atoms.

Unless otherwise indicated, the term "aryl" refers to a polyunsaturated aromatic hydrocarbon substituent which may be a single ring or multiple rings (preferably 1 to 3 rings) fused together or covalently linked. The term "heteroaryl" refers to an aryl group (or ring) containing one to four heteroatoms selected from N, O and S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atoms are optionally quaternized. The heteroaryl group may be attached to the rest of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 2-pyrimidinyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalyl, 5-quinoxalyl, 3-quinolyl, and 6-quinolyl. The substituents noted above for each of the aryl and heteroaryl ring systems are selected from the following group of acceptable substituents.

For brevity, the term "aryl" when used in conjunction with other terms (e.g., aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above. Thus, the term "arylalkyl" is meant to include those radicals (e.g., benzyl, phenethyl, pyridylmethyl, and the like) in which an aryl group is attached to an alkyl group, including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced, for example, by an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3- (1-naphthyloxy) propyl, and the like).

Each of the above terms (e.g., "alkyl," "heteroalkyl," "aryl," and "heteroaryl") includes both substituted and unsubstituted forms of the designated radical. Preferred substituents for each type of radical are provided below.

The substituents of the alkyl and heteroalkyl radicals (including those groups commonly referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are generally referred to as "alkyl substituents" and "heteroalkyl substituents," respectively, and may be one or more of a variety of groups selected from, but not limited to: -OR ', - (O), (NR', - (N-OR ', - (NR' R '), - (SR'), - (halogen), -SiR 'R' ″, - (oc) (O) R ', - (c) (O) R', - (CO) CO₂R’、-CONR’R”、-OC(O)NR’R”、-NR”C(O)R’、-NR’-C(O)NR”R”’、-NR”C(O)₂R’、-NR-C(NR’R”R’”)＝NR””、-NR-C(NR’R”)＝NR’”、-S(O)R’、-S(O)₂R’、-S(O)₂NR’R”、-NRSO₂R', -CN and-NO₂In an amount ranging from zero to (2m '+ 1), where m' is the total number of carbon atoms in such radical. R ', R ", R'" and R "" each preferably independently refer to hydrogen, a substituted or unsubstituted heteroalkyl, a substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), a substituted or unsubstituted alkyl, alkoxy or thioalkoxy group, or an arylalkyl group. When the compounds of the embodiments of the present invention contain more than one R group, for example, as when more than one of each of the R ', R ", R'" and R "" groups is present, each of the R groups is independently selected. When R' and R "are attached to the same nitrogen atom, they may combine with the nitrogen atom to form a 5,6 or 7 membered ring. For example, -NR' R "is meant to include, but is not limited to, the following: 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, those skilled in the art will understand that the term "alkyl" is meant to include groups containing groups other than hydrogen (e.g., haloalkyl (e.g., -CF) groups₃and-CH₂CF₃) Andacyl radicals (e.g. -C (O) CH)₃、-C(O)CF₃、-C(O)CH₂OCH₃Etc.) to a carbon atom.

Similar to the substituents described for the alkyl radical, the aryl and heteroaryl substituents are generally referred to as "aryl substituents" and "heteroaryl substituents", respectively, and are different and selected from, for example: halogen, -OR ', - (O), - (NR '), - (N-OR ', - (NR ') R ", -SR ', -halogen, -SiR ' R" R ' ", -oc (O) R ', -c (O) R ', -CO₂R’、-CONR’R”、-OC(O)NR’R”、-NR”C(O)R’、-NR’-C(O)NR”R”’、-NR”C(O)₂R’、-NR-C(NR’R”)＝NR’”、-S(O)R’、-S(O)₂R’、-S(O)₂NR’R”、-NRSO₂R', -CN and-NO₂,-R’、-N₃、-CH(Ph)₂Fluorine (C)₁-C₄) Alkoxy and fluorine (C)₁-C₄) Alkyl groups in an amount ranging from zero to the total number of open valences on the aromatic ring system; and wherein R ', R ", R'" and R "" are preferably independently selected from hydrogen, (C)₁-C₈) Alkyl and heteroalkyl, unsubstituted aryl and heteroaryl, (unsubstituted aryl) - (C)₁-C₄) Alkyl and (unsubstituted aryl) oxy- (C)₁-C₄) An alkyl group. When a compound according to embodiments of the present invention comprises more than one R group, for example, as when more than one of each of the R ', R ", R'" and R "" groups is present, each of the R groups is independently selected.

Two of the aryl substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be substituted with a compound of the formula-T-C (O) - (CRR')_q-U-, wherein T and U are independently-NR-, -O-, -CRR' -or a single bond, and q is an integer from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be substituted with a group of formula-A- (CH)₂)_r-substituent replacement of B-, wherein A and B are independently-CRR' -, -O-, -NR-, -S (O)₂-、-S(O)₂NR' -or a single bond, and r is an integer of 1 to 4. Of the new ring thus formedOne of the single bonds may optionally be replaced by a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be substituted with a compound of formula- (CRR')_s-X-(CR”R’”)_d-wherein S and d are independently integers from 0 to 3, and X is-O-, -NR' -, -S (O)₂-or-S (O)₂NR' -. The substituents R, R ', R ", and R'" are preferably independently selected from hydrogen or substituted or unsubstituted (C)₁-C₆) An alkyl group.

As used herein, the term "heteroatom" includes oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).

The term "aryl group" as used herein refers to both an-O-aryl group and an O-heteroaryl group, wherein aryl and heteroaryl are defined herein.

As used herein, the term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the compounds described in the embodiments of the present invention and is not biologically or otherwise undesirable. In many cases, compounds according to embodiments of the present invention are capable of forming acid and/or base salts due to the presence of amino and/or carboxyl groups or groups similar thereto (e.g., phenol or hydroxyamidic acid). Pharmaceutically acceptable acid addition salts may be formed by inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like; particularly preferred are ammonium, potassium, sodium, calcium and magnesium salts. Organic bases from which salts can be derived include, for example, primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine, among others. Pharmaceutically acceptable salts of the compounds of the embodiments of the invention may be synthesized from the parent compound, the basic or acidic moiety, by conventional chemical methods. In general, such salts can be prepared by reacting the free acid forms of these compounds with a stoichiometric amount of the appropriate base (e.g., Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, etc.), or by reacting the free base with a stoichiometric amount of the appropriate acid. Such reactions are generally carried out in water or an organic solvent or in a mixture of the two. Generally, nonaqueous media such as diethyl ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred where feasible. Lists of other suitable salts can be found, for example, in Remington's pharmaceutical Sciences, 20 th edition, Mack Publishing Company, Easton, Pa., (1985), which is incorporated herein by reference.

As used herein, the term "pharmaceutically acceptable carrier/excipient" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial, antifungal agents), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, such as those known to those of ordinary skill in the art, and combinations thereof (see, e.g., Remington's Pharmaceutical Sciences,18th ed. mack Printing Company,1990, pp.1289-1329, incorporated by reference herein). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in therapeutic or pharmaceutical compositions is contemplated.

As used herein, the term "subject" refers to an animal. Preferably, the animal is a mammal. Subjects also refer to, for example, primates (e.g., humans), cows, sheep, goats, horses, dogs, rabbits, mice, cats, fish, birds, and the like. In a preferred embodiment, the subject is a human.

As used herein, the term "therapeutic combination" or "combination" is a combination of one or more active drug substances, i.e. a compound having therapeutic utility. Typically, each such compound in the therapeutic combinations described in the embodiments of the present invention will be present in a pharmaceutical combination comprising the compound and a pharmaceutically acceptable carrier. The compounds of the therapeutic combinations of the embodiments of the present invention may be administered simultaneously or separately as part of a therapeutic regimen.

II.Composition comprising a metal oxide and a metal oxide

In general, the present disclosure provides therapeutic combinations, pharmaceutical compositions, and methods of treating cancer using combination therapies. More specifically, immunotherapy (e.g., using Toll-like receptor ligand "TLRL"), such as TLR7/8 agonists to activate DCs in innate immunity, is combined with low-dose immunomodulatory chemotherapy.

In one aspect, the present disclosure provides a therapeutic combination or pharmaceutical composition comprising: (i) an effective amount of an immunomodulatory chemotherapeutic agent; and (ii) an effective amount of an immunotherapeutic agent comprising TLR7 and/or TLR8 agonist activity. That is, in various embodiments, the immunotherapeutic agent is an agonist of TLR7 or TLR8, or both.

Therapeutic combinations may be provided in a single pharmaceutical composition such that the immunomodulatory chemotherapeutic agent and the immunotherapeutic agent may be administered together. In alternative embodiments, more than one pharmaceutical composition may be used to provide a therapeutic combination. In such embodiments, the immunomodulatory chemotherapeutic agent may be provided in one pharmaceutical composition and the immunotherapeutic agent may be provided in a second pharmaceutical composition, such that the two compounds may be administered separately, e.g., at different times, by different routes of administration, etc. Thus, it is also possible to provide the immunomodulatory chemotherapeutic agent and the immunotherapeutic agent in different dosing regimens.

Unless otherwise indicated, reference to a compound may include any pharmaceutically acceptable form of the compound, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like. In particular, if a compound has optical activity, reference to said compound may include each of the enantiomers of said compound as well as racemic mixtures of said enantiomers.

In general, the immunomodulatory chemotherapeutic agent and the immunotherapeutic agent are not forgiving of each other, e.g., by a covalent linker.

A. Immunomodulatory chemotherapeutic agents

In general, the compositions provided herein comprise an immunomodulatory chemotherapeutic agent.

By "immunomodulatory chemotherapeutic agent" herein is meant a therapeutic agent capable of reducing host regulatory T cells (tregs) and/or subpopulations of MDSCs in addition to its direct anti-tumor effect.

In some embodiments, the immunomodulatory chemotherapeutic agent comprises an anti-neoplastic agent

By "anti-tumor agent" herein is meant a therapeutic agent that directly kills tumor cells by conventional cytotoxic anti-tumor activity. In some embodiments, the anti-neoplastic agent is selected from the group consisting of anthracyclines, bortezomib, oxaliplatin and cyclophosphamide.

In some embodiments, the immunomodulatory chemotherapeutic comprises a Treg inhibitor.

By "Treg inhibitor" herein is meant modulating CD25⁺/CD45⁺Therapeutic agents for Treg cells. In some embodiments, the Treg inhibitor is selected from the group consisting of dasatinib, cyclophosphamide, temozolomide, docetaxel, and 5-fluorouracil.

In some embodiments, the immunomodulatory chemotherapeutic agent comprises a myeloid-derived suppressor cell (MDSC) inhibitor.

By "myeloid-derived suppressor cell (MDSC) inhibitor" herein is meant a therapeutic agent capable of modulating immune suppressor cells, such as MDSCs. In some embodiments, the MDSC inhibitor is selected from the group consisting of paclitaxel, gemcitabine, 5-fluorouracil, oxaliplatin, cisplatin, carboplatin, dasatinib, sunitinib, and doxorubicin.

In some embodiments, the immunomodulatory chemotherapeutic agent comprises an NK cell activator.

By "NK cell activating agent" herein is meant a therapeutic agent capable of activating NK cells in the tumor microenvironment. In some embodiments, the NK cell activator is selected from the group consisting of dasatinib and imatinib.

B. Immunotherapeutic agent

In general, the combinations or compositions described in this disclosure comprise an immunotherapeutic agent.

By "immunotherapeutic" herein is meant a compound, molecule or agent capable of stimulating or enhancing the body's immune system or tumor cells. Immunotherapeutics are used to treat diseases by inducing, enhancing or suppressing an immune response. Immunotherapeutics of the present embodiments are generally designed to elicit or amplify an immune response, rather than to suppress an immune response.

In general, immunotherapeutic agents according to embodiments of the invention act directly or indirectly on a toll-like receptor, a nucleotide oligomerization domain-like receptor, a RIG-I-like receptor, a c-type lectin receptor, or a cytoplasmic DNA sensor or a combination thereof. In particular, the immunotherapeutic agent according to embodiments of the invention is capable of activating human plasmacytoid dendritic cells, myeloid dendritic cells, NK cells, or tumor cells, or a combination thereof.

In some embodiments, the immunotherapeutic agent described in embodiments of the invention activates human immune cells, including but not limited to dendritic cells, macrophages, monocytes, myeloid-derived suppressor cells, NK cells, B cells, T cells, or tumor cells, or a combination thereof.

Dendritic cells are the most powerful antigen presenting cells. Dendritic cells play an important role in the initiation of both innate and adaptive immune responses. Dendritic cells also play a key role in the induction and maintenance of immune tolerance.

By "dendritic cells" (DCs) herein is meant a heterogeneous population of cells comprising two major subtypes: bone marrow dcs (mdcs) and plasma cell-like dcs (pdcs) (Steinman et al, 1979, j.exp.med.,149, 1-16). These two subsets of blood DCs were initially distinguished by their expression of CD11c (integrin complement receptor) and CD123(IL-3R α). Each of the pDC and mDC populations constitutes from about 0.2 to about 0.6% of a PBMC population in a human.

By "pDC" herein is meant plasmacytoid dendritic cells, and it means a subtype of dendritic cells found in blood and peripheral lymphoid organs. These cells express the surface markers CD123, BDCA-2(CD303) and BDCA-4(CD304) and HLA-DR, but do not express CD11c, CD14, CD3, CD20 or CD56, which distinguishes them from conventional dendritic cells, monocytes, T cells, B cells and NK cells. As a component of the innate immune system, these cells express intracellular Toll-like receptors 7 and 9, which enable the detection of viral and bacterial nucleic acids, such as ssRNA or CpG DNA motifs. Upon stimulation and subsequent activation, these cells produce large amounts of type I interferons (primarily IFN- α and IFN- β) and type III interferons (e.g., IFN- γ), which are key pleiotropic antiviral compounds that mediate a wide range of effects. Plasmacytoid dendritic cells are widely involved in the innate and adaptive immune response of the body by producing large amounts of type I interferons, cytokines and chemokines. They can regulate NK cells, T cells, B cells and other cells involved in the intensity, duration, response pattern of the immune response and thus play a very important role in tumors, infections and autoimmune diseases. (Liu YJ. IPC: developmental type 1 interaction-producing cells and plasmacytic dendritic cell recursors. Annu Rev Immunol.2005; 23:275-306.Gilliet M, Cao W, Liu YJ. plasmacytic dendritic cells: sensing nuclear acids in viral infection and autoimmunity diseases. nat Rev Immunol.2008.8 months; 8(8):594 606).

By "mDC" herein is meant myeloid dendritic cells, and it means a subset of circulating dendritic cells found in blood and peripheral lymphoid organs. These cells expressed the surface markers CD11c, CD1a, HLA-DR and BDCA-1(CD1c) or BDCA-3(CD 141). They do not express BDCA-2 or CD123, which distinguishes them from pDC. mdcs also do not express CD3, CD20, or CD 56. As a component of the innate immune system, mdcs express Toll-like receptors (TLRs), including TLRs 2,3,4, 5,6, and 8, which enable the detection of bacterial and viral components. These cells are the most potent antigen presenting cells that activate antigen specific CD4 and CD 8T cells after stimulation and subsequent activation. In addition, mdcs have the ability to produce large amounts of IL-12 and IL23, which is critical for inducing Th 1-mediated or Th17 cell-mediated immunity.

Studies have found that pDC invasion (Trelleux I, Blay JY, Bendriss-Vermare N et al, Dendritic cell enrichment and prognosis of early stage Breast Cancer. Clin Cancer Res 2004; 10:7466-7474.Hartmann E, Wollenberg B, Rothenfunser S et al, Identification and functional analysis of tumor-encapsulating tissue and Cancer Res 2003; 63:6478-6487.Zou, Machelon V, Coulomb-L' Hermin A, et al, structural-tissue-1 human tissues and tumor 1349: 7. tumor maturation inhibition factor DC 1346. the present of tumor cells. (Garfiltrate DI, Corak J, Ciernik IF et al, deleted important presentation by polymeric cells In tissues with molecular culture In Cancer Res 1997; 3:483-490.Bell D, Chomurat P, Broyles D et al, In culture carcinoma tissue, polymeric cell residue with the molecular culture In the tumor, where the polymeric cell residue is located In polymeric regions J Exp Med 1999; 190: net 7-1415. Merier-Caux C, monomeric G, Dieu MC et al, Inhibition of differentiation of polymeric cells In CD 34-molecular culture In tissue culture 4791: 1998; origin of polymeric cell residue In tissue culture 4791: 1998). These immature DC cells do not play a role in promoting anti-tumor immunity. In contrast, DCs within the tumor microenvironment promote tumor growth by inhibiting anti-tumor immunity and by promoting angiogenesis. There is evidence that Toll-like receptor 7 agonist imiquimod and Toll-like receptor 9 agonist CpG drugs can stimulate pDC within the tumor microenvironment to inhibit tumor progression. (Dummer R, Urosevic M, Kempf W et al, Impquimod in basic cell carbonate: how doss it work Br J Dermatol 2003; 149:57-58.Miller RL, Gerster JF, Owens ML et al, Imiquod applied topologic: a novel animal response modifier and new class of drug. int J Immunopharmacol 1999; 21:1-14.Hofmann MA, Kors C, Audring H et al, Phase 1evaluation of intraviral injected TLR9-agonist PF-3512676in batch with basic cell carbonate or antibiotic cell. J527; 2008: 520).

Natural Killer (NK) cells are a type of cytotoxic lymphocytes that constitute a major component of the immune system. NK cells are a subset of peripheral blood lymphocytes defined by expression of CD56 or CD 16 and deletion of the T cell receptor (CD 3). They recognize and kill transformed cell lines without being initiated in an MHC non-limiting manner. NK cells play a major role in rejecting tumor and virus infected cells. The process by which NK cells recognize target cells and deliver sufficient signal to trigger target lysis is determined by a series of inhibitory and activating receptors on the cell surface. NK itself is distinguished from altered NK itself by the involvement of inhibitory receptor recognition by MHC-I molecules and non-MHC ligands (e.g., CD48 and Clr-1 b). NK recognition of infected or injured cells (altered self) is regulated by stress-induced ligands (e.g., MICA, MICB, Rae1, H60, Mult1) or virus-encoded ligands (e.g., m157, hemagglutinin) recognized by various activating receptors, including NKG2D, Ly49H, and NKp46/Ncr 1.

NK cells represent the predominant lymphoid cells in the Blood at weeks or months after allogeneic or autologous stem cell transplantation, and they play a major role in the immunity to pathogens during this period (Reititie et al, (1989) Blood 73: 1351-. The role of NK cells in transplantation, graft versus host disease, anti-leukemic activity and post-transplantation infection is reviewed in Lowdell (2003) transfer Medicine13: 399-404.

Human NK cells mediate the lysis of tumor cells and virus-infected cells by natural cytotoxicity and antibody-dependent cellular cytotoxicity (ADCC).

Human NK cells are controlled by positive and negative cytolytic signals. Negative (inhibitory) signals are transformed by the C-lectin domain containing receptor CD94/NKG2A and by some killer immunoglobulin-like receptors (KIR). The regulation of NK lysis by inhibitory signals is called the "self-deletion" hypothesis, in which a specific HLA-class I allele expressed on the surface of a target cell is linked to an inhibitory receptor on NK cells. Down-regulation of HLA molecules on tumor cells and some virally infected cells (e.g., CMV) reduces this inhibition below the target threshold, and the target cells can become susceptible to NK cell-mediated lysis if they also carry NK initiation and activation molecules. TLR7, TLR8, or TLR9 agonists can activate both mdcs and pdcs to produce type I IFNs and express co-stimulatory molecules, such as GITR ligands, which then activate NK cells to produce IFN- γ and effectively promote NK cell killing functions.

Inhibitory receptors are classified into two groups, those of the Ig superfamily, known as killer immunoglobulin-like receptors (KIRs), and those of the lectin family NKG2, which form dimers with CD94 at the cell surface. KIR has a 2-or 3-domain extracellular domain and binds to HLA-A, -B or-C. The NKG2/CD94 complex is linked to HLA-E.

Inhibitory KIRs have up to 4 ITIM-containing intracellular domains, and the best characterized are KIR2DL1, KIR2DL2, and KIR2DL3, which are known to bind to HLA-C molecules. KIR2DL2 and KIR2DL3 bound to group 1 HLA-C alleles, while KIR2DL1 bound to group 2 alleles. Certain leukemia/lymphoma cells express both group 1 and group 2 HLA-C alleles and are known to be resistant to NK-mediated cell lysis.

For positive activation signals, ADCC is thought to be mediated by CD 16, and a number of trigger receptors responsible for natural cytotoxicity have been identified, including CD2, CD38, CD69, NKRP-I, CD40, B7-2, NK-TR, NKp46, NKp30 and NKp 44. Some KIR molecules with short intracytoplasmic tails are also stimulatory. These KIRs (KIR2DS1, KIR2DS2 and KIR2DS4) are known to bind HLA-C; its extracellular domain is identical to its associated inhibitory KIR. Activating KIRs lack ITIM and, conversely, are associated with DAP 12, leading to NK cell activation. The control mechanisms for inhibitory and activating KIR expression are still unknown.

Several reports have described the expression of TLRs in mouse or human cancers or cancer cell lines. For example, TLRs 1-6 are expressed by colon, lung, prostate and melanoma mouse tumor cell lines (Huang B et al, Toll-like receptors on tumor cells efficacy evaluation of tumor tissue. cancer Res. 2005; 65 (12): 5009) and TLR3 is expressed in Human breast cancer cells (Salaun B, Coste I, Risson MC, Lebecque SJ, Renno T.TLR3 tumor tissue. J. immune. 2006; 176 (8): 4894) and liver and stomach cancer cells express TLR2 and TLR4(Huang B et al, Listeria polynucleotides tissue cells viscosity evaluation. J. immune. 2007; Huang B et al, cancer tissue culture cell expression of tumor tissue strain 439. expression of tumor tissue strain, TLR 5. and TLR 5. expression of tumor tissue strain, TLR 5. 5, TLR 5. expression of tumor tissue strain, 2. cancer cell strain, and 5. expression of tumor tissue strain, strain; 44(11): 2850-2859) are expressed by human lung cancer cells. TLR7 and TLR8 are found in tumor cells of human lung cancer (Cherfils-Vicini J, Platonova S, Gillard M, Laurans L, Validire P, Caliandro R, Magdeleeinat P, Mami-Chouaib F, Dieu-Nosjean MC, Fridman WH, Damotte D, Saut' S-Fridman C, Cremer I.J.Clin invest.2010; 120 (4): 1285) -1297).

TLRs are a family of proteins that sense microbial products and/or initiate adaptive immune responses. TLRs activate Dendritic Cells (DCs). TLRs are conserved transmembrane molecules comprising an extracellular domain rich in leucine repeats, a transmembrane domain, and an intracellular TIR (Toll/interleukin receptor) domain. TLRs recognize different structures in microorganisms, which are commonly referred to as "PAMPs" (pathogen-associated molecular patterns). Ligands that bind to TLRs trigger a cascade of intracellular signaling pathways that induce the production of factors involved in inflammation and immunity.

In some embodiments, the immunotherapeutic agent is a TLR7 and/or TLR8 agonist. TLR7 and TLR8 are phylogenetically and structurally related. TLR7 is selectively expressed by human pDC and B cells. TLR8 is expressed primarily by mdcs, monocytes, macrophages and myeloid suppressor cells. TLR 7-specific agonists activate plasma cell-like dcs (pdcs) to produce large amounts of type 1 IFN and express high levels of co-stimulatory molecules that promote activation of T cells, NK cells, B cells, and mdcs. TLR 8-specific agonists activate myeloid DCs, monocytes, macrophages or myeloid-derived suppressor cells to produce large amounts of type 1 IFN, IL-12 and IL-23 and express high levels of MHC class I, MHC class II and co-stimulatory molecules that promote activation of antigen-specific CD4 and CD8+ T cells.

In some embodiments, the immunotherapeutic agent is a TLR7 and/or TLR8 agonist represented by the structure of formula (I):

wherein the dotted line represents a bond or the absence of a bond;

x is S or-NR₁,R₁ is–W₀—W₁—W₂—W₃—W₄，

W₀Is a bond, alkylalkenyl, alkynyl, alkoxy or-alkyl-S-alkyl-,

W₁is a bond, -O-or-NR₂-, wherein R₂Is hydrogen, an alkyl or an alkenyl group,

W₂is a bond, -O-, -C (O) -, -C (S) -, or-S (O)₂—，

W₃Is a bond, -NR₃-, wherein R₃Is hydrogen, an alkyl or an alkenyl group,

W₄is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, aryl, aryloxy, heteroaryl or heterocyclyl, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkyl-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–S-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R4, -alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN, -NO₂and-SH, wherein R₄Independently hydrogen, alkyl, alkenyl, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

z is hydrogen, alkyl, alkenyl, alkynyl, alkoxy, aryl, haloalkyl, heteroaryl, heterocyclyl, each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, aryl, heteroaryl, heterocyclyl, halo, cyano, nitro, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -O-C (O) -alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl, wherein each R is₅Independently hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl;

r is hydrogen, alkyl, alkoxy, haloalkyl, halogen, aryl, heteroaryl, heterocyclyl, each of which is optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl, heterocyclyl, -NH₂Nitro, -alkyl-hydroxy, -alkyl-aryl, -alkyl-heteroaryl, -alkyl-heterocyclyl, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄、–C(O)-NH-R₄、–C(O)-NR₄R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–O-C(O)-R₄、–S-R₄、–C(O)-S-R₄、–S-C(O)-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R₄-alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN and-SH, wherein R₄Independently is hydrogen, alkyl, alkenyl, alkoxy, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl;

n is 0, 1,2,3 or 4;

y is-NR₆R₇、–CR₆R₇R₈or-alkyl-NH₂Each of which may be optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, -NH₂Halogen, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl,

wherein R is₆、R₇And R₈Independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, -alkyl-hydroxy, -alkyl-C (O) -O-R₉-alkyl-C (O) -R₉or-alkyl-O-C (O) -R₉Wherein each R is₅Independently is hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl, wherein R is₉Is hydrogen, alkyl, alkenyl, halogen or haloalkyl;

x and Z together may optionally form a (5-9) membered ring.

In some embodiments, X of formula (I) is S.

In some embodiments, X of formula (I) is-NR₁，R₁Is alkyl, -alkyl-W₄-alkyl-O-W₄-alkyl-NH-C (O) -W₄-alkoxy-NH-C (O) -W₄-alkyl-NH-C (O) -NH-W₄-alkoxy-NH-C (O) -NH-W₄-alkyl-S (O)₂-W₄or-alkyl-NH-C (S) -W₄Wherein W is₄As defined above.

In some embodiments, Z of formula (I) is hydrogen, alkyl, alkoxy, aryl, heteroaryl, haloalkyl,each of which is optionally substituted with one to three substituents selected from the group consisting of: hydroxy, alkyl, aryl, heteroaryl, heterocyclyl, cyano, -alkoxy-alkyl, nitro and-N (R)₅)₂Wherein each R is₅Independently hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl.

In some embodiments, Y of formula (I) is-NH₂-alkyl-NH₂Each of which is optionally substituted with one to three substituents selected from the group consisting of: alkyl, alkoxy, alkenyl, and alkynyl.

In some embodiments, n of formula (I) is 1 or 2.

In some embodiments, R of formula (I) is aryl or heteroaryl, each of which is optionally substituted with one to three substituents selected from the group consisting of: hydroxy, alkoxy, -alkyl-hydroxy, -O-R₄-O-alkyl-R₄-alkyl-O-R₄、–C(O)-R₄、–C(O)-NH-R₄、–C(O)-NR₄R₄-alkyl-C (O) -R₄-alkyl-C (O) -O-R₄、–C(O)-O-R₄、–O-C(O)-R₄、–S-R₄、–C(O)-S-R₄、–S-C(O)-R₄、–S(O)₂-R₄、–NH-S(O)₂-R₄-alkyl-S-R₄-alkyl-S (O)₂-R₄、–NHR₄、–NR₄R₄-NH-alkyl-R₄Halogen, -CN and-SH, wherein R₄Independently hydrogen, alkyl, alkenyl, alkoxy, -alkyl-hydroxy, aryl, heteroaryl, heterocyclyl or haloalkyl.

In some embodiments, the immunotherapeutic agent is a TLR7 and/or TLR8 agonist selected from table 2. The compounds in table 2 are described and characterized in more detail in US4,689,338, US5,389,640, US5,226,575, US6,110,929, US6,194,425, US5,352,784, US6,331,539, US5,482,936, US6,451810, WO2002/46192, WO2002/46193, WO2002/46194, US2004/0014779 and US 2004/0162309.

TABLE 2 exemplary TLR7 and/or TLR8 agonists

Preferably, in some embodiments, the immunotherapeutic agent is resiquimod or imiquimod.

In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and/or TLR8 agonist) represented by the structure of formula (II):

wherein V is-NR₆R₇Wherein R is₆And R₇Each of which is independently hydrogen, alkyl, alkenyl, alkoxy, alkylamino, dialkylamino, alkylthio, arylthio, -alkyl-hydroxy, -alkyl-C (O) -O-R₉-alkyl-C (O) -R₉or-alkyl-O-C (O) -R₉Wherein R is₉Is hydrogen, alkyl, alkenyl, hydrogen or haloalkyl;

R₁₀and R₁₁Independently hydrogen, alkyl, alkenyl, aryl, haloalkyl, heteroaryl, heterocyclyl or cycloalkyl, each of which is optionally substituted with one or more substituents selected from the group consisting of: hydroxy, alkoxy, alkyl, alkenyl, alkynyl, halogen, -N (R)₅)₂-alkoxy-alkyl, -alkoxy-alkenyl, -C (O) -alkyl, -C (O) -O-alkyl, -C (O) -N (R)₅)₂Aryl, heteroaryl, -CO-aryl and-CO-heteroaryl, wherein each R is₅Independently hydrogen, alkyl, haloalkyl, -alkyl-aryl or-alkyl-heteroaryl.

In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and/or TLR8 agonist) represented by the structure of formula (III):

whereinIs a double or single bond; r₂And R₃Independently selected from H and lower alkyl, or R₂And R₃Linked to form a saturated carbocyclic ring having 3 to 7 ring members; r₇And R₈Is one of

And the other is hydrogen; r₄is-NR_cR_dOR-OR₁₀；R_cAnd R_dIs lower alkyl, wherein said alkyl is optionally substituted with one or more — OH; r₁₀Is alkyl, wherein said alkyl is optionally substituted with one or more — OH; z is C andis a double bond, or Z is N andis a single bond; r_aAnd R_bIndependently selected from H, alkyl, alkenyl, alkynyl and R_eWherein said alkyl is substituted by one OR more-OR₁₀Or R_eOptionally substituted, R_eIs selected from-NH₂-NH (alkyl) and-N (alkyl)₂(ii) a When in useWhen it is a double bond, R₁Is absent, or whenWhen it is a single bond, N₁—R₁And R_aOr R_bIs linked to form a saturated, partially unsaturated or unsaturated heterocyclic ring having 5 to 7 ring members, and R_aOr R_bThe other of (a) may be hydrogen or absent in accommodating the need for ring unsaturation; and at least one of the following A-D applies: A) r₇Is not hydrogen; B) r₈Is not hydrogen and R_aAnd R_bAt least one of which is not hydrogen; C) z is N; or D) N₁—R₁And R_aOr R_bTo form a saturated, partially unsaturated or unsaturated heterocyclic ring having 5-7 ring members. US 20140088085a1, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, R of the compound of formula (III)₇Is that

Further, in the compound of the formula (III), R_aAnd R_bAt least one of which is not hydrogen, or, for example, R_aAnd R_bOne of which is alkyl and R_aAnd R_bIs hydrogen. Further, the alkyl group of formula (III) is substituted by R_eAnd (4) substitution. In various embodiments, R_aAnd R_bBoth are alkyl, or R_aAnd R_bIs R_eAnd the other R_aAnd R_bIs hydrogen. For example, R of the formula (III)₈Is not hydrogen.

In some alternative embodiments, N₁And R of the formula (III)_aOr R_bIs linked to form a saturated, partially unsaturated or unsaturated heterocyclic ring having 5 to 7 ring members, and R_aOr R_bIs hydrogen or is absent in accommodating the need for ring unsaturation, wherein the ring is a 5-membered ring, or for example the ring is:

in some embodiments, R in the compound of formula (III)₂And R₃At least one of which is not hydrogen, or, for example, R₂And R₃Linked to form a saturated carbocycle, wherein the saturated carbocycle is cyclopropyl. Alternatively, Z in the compound of formula (III) is N.

In some embodiments, the TLR agonist or modulator has the structure of formula (IV):

wherein R is₄Selected from-NR_cR_dand-OR₁₀；R_cAnd R_dIs lower alkyl, wherein said alkyl is substituted by oneOr a plurality of — OH groups are optionally substituted; r₁₀Is alkyl, wherein said alkyl is optionally substituted with one or more — OH; r_{f and}R_gis lower alkyl, or R_{f and}R_gtogether with the nitrogen atom to which they are attached form a saturated heterocyclic ring having 4-6 ring members. For example, R in the compound of formula (IV)_{f and}R_gtogether with the nitrogen atom to which it is attached, form a saturated heterocyclic ring, wherein the heterocyclic ring is pyrrolidine.

In some alternative embodiments, R of formula (III) or formula (IV)₄is-OR₁₀Wherein R is_{10 is}Alkyl or ethyl. In another embodiment, R of formula (III) or formula (IV)₄is-NR_cR_dWherein both are alkyl or both are propyl. Also, in certain embodiments, R_cOr R_dAt least one of which is alkyl substituted by one-OH, and R_{c and}R_dat least one of which is

And the remaining R_cOr R_dIs propyl.

In some alternative embodiments, the TLR is a compound selected from the group consisting of:

alternatively, the compound is selected from

In some alternative embodiments, the TLR agonist compound is

In some alternative embodiments, the TLR agonist is a compound selected from the group consisting of:

in some alternative embodiments, the TLR agonist is

In some alternative embodiments, the TLR agonist is a compound selected from the group consisting of:

in some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and/or TLR8 agonist) represented by the structure of formula (V):

wherein:

y is CF₂CF₃、CF₂CF₂R⁶Or arylA aryl or heteroaryl ring, wherein the aryl and heteroaryl rings are substituted with one or more groups independently selected from: alkenyl, alkynyl, Br, CN, OH, NR⁶R⁷、C(＝O)R⁸、NR⁶SO₂R⁷、(C₁-C₆Alkyl) amino, R⁶OC(＝O)CH＝CH₂-、SR⁶And SO₂R⁶And wherein said aryl and heteroaryl rings are further optionally substituted with one or more groups selected from: F. cl, CF₃、CF₃O-、HCF₂O-, alkyl, heteroalkyl, and ArO-;

R¹、R³and R⁴Independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(^O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶，

Or R³And R⁴Together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclic ring, wherein the carbocyclic ring is optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

R²And R⁸Independently selected from H, OR⁶、NR⁶R⁷Alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br₅I、CN、OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(^O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

R^5a、R^5bAnd R^5cIndependently H, F, Cl, Br, I, OMe, CH₃、CH₂F₅、CHF₂Or CF₃(ii) a And is

R⁶And R⁷Independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶，

Or R⁶And R⁷Together with the atoms to which they are attached form a saturated or partially unsaturated heterocyclic ring, wherein the heterocyclic ring is optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I,CN、OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶. In certain embodiments, R¹、R³And R⁴Each is hydrogen. In certain embodiments, R^5a、R^5bAnd R^5cEach is hydrogen. WO 2007024612 a2, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, R of the compound of formula (V)²Is OR⁶. In some embodiments, R⁶Is alkyl, e.g. (C)_l-4) An alkyl group. In certain embodiments, R⁶Is ethyl.

In some embodiments of compounds of formula (V), R²Is NR⁶R⁷. In some embodiments, R⁶And R⁷Independently of one another, H, alkyl, e.g. (C)_l-6) Alkyl, or heteroalkyl, e.g. (C)_l-4) Alkoxy (C)_2-4) An alkyl group. In certain embodiments, R⁶And R⁷Independently is H, ethyl, propyl or CH₂CH₂OCH₃. In some embodiments of the compounds of formula V, Y is aryl, e.g., phenyl. In some embodiments, the aryl group is substituted with C (═ O) R⁸(e.g. for R)⁸C (═ O) phenyl) substitution. In some embodiments, R⁸Is OR⁶、NR⁶R⁷Or a heterocycloalkyl group. In some embodiments, R⁶And R⁷Independently of one another, H or alkyl, e.g. (C)_l-6) An alkyl group. In some other embodiments, R⁶And R⁷Together with the nitrogen atom to which they are attached form a 4-6 membered azacycloalkyl ring, such as pyrrolidinyl. In some embodiments, Y is

In some embodiments of the compounds of formula (V), Y is CF₂CF₃。

In some embodiments, the immunotherapeutic agent is a TLR modulator represented by the structure of formula (VI) (e.g., a TLR8 agonist) and metabolites, solvates, tautomers, and pharmaceutically acceptable prodrugs and salts thereof:

wherein:

z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR⁶Or NR⁶R⁷Wherein said alkyl, alkenyl, alkynyl; heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl F, Cl₃ Br、I、CN、OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(Ci-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OCC＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

R¹、R²、R³And R⁴Independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、CC＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、CC＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OCC＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶，

Or R¹And R²Together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclic ring, wherein the carbocyclic ring is optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、CC＝O)OR⁶、OC(＝O)R⁶、CC＝O)NR⁶R⁷、CCi-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OCC＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

Or R³And R⁴Together are oxy;

each R⁵Independently selected from H, F, Cl, Br, I, OMe, CH₃、CH₂F、CHF₂、CF₃And CF₂CF₃；

R⁶And R⁷Independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、CC＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶,CC＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

Or R⁶And R⁷Together with the atoms to which they are attached form a saturated or partially unsaturated heterocyclic ring, wherein the heterocyclic ring is selected independently by one or moreOptionally substituted with a group selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、CC＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶(ii) a And n is 0, 1,2,3 or 4. WO2007040840a2, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, the immunotherapeutic agent is a TLR modulator (e.g., a TLR7 and/or TLR8 agonist) represented by the structure of formula (VI) and metabolites, solvates, tautomers, and pharmaceutically acceptable salts and prodrugs thereof:

wherein:

z is H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, OR⁶Or NR⁶R⁷Wherein the alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OCC＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

R¹、R²、R³And R⁴Independently selected from the group consisting of H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkylThe group, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I₉ CN、OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OCC＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶，

Or R¹And R²Together with the atoms to which they are attached form a saturated or partially unsaturated carbocyclic ring, wherein the carbocyclic ring is optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶，

Or R³And R⁴Together are oxy;

R⁵is H, F, Cl, Br, I, OMe, CH₃、CH₂F、CHF₂、CF₃Or CF₂CF₃；

R⁶And R⁷Independently selected from H, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl, wherein said alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl and heteroaryl are optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino₅CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶；

Or R⁶And R⁷Together with the atoms to which they are attached form a saturated or partially unsaturated heterocyclic ring, wherein the heterocyclic ring is optionally substituted with one or more groups independently selected from: alkyl, alkenyl, alkynyl, F, Cl, Br, I, CN, OR⁶、NR⁶R⁷、C(＝O)R⁶、C(＝O)OR⁶、OC(＝O)R⁶、C(＝O)NR⁶R⁷、(C₁-C₆Alkyl) amino, CH₃OCH₂O-、R⁶OC(＝O)CH＝CH₂-、NR⁶SO₂R⁷、SR⁶And SO₂R⁶(ii) a And

n is 0, 1,2,3 or 4.

In some embodiments, Z is OR⁶. In some embodiments, R⁶Is alkyl, e.g. (C)_1-6) An alkyl group. In certain embodiments, R⁶Is ethyl, propyl, isopropyl or isobutyl.

In some embodiments, Z is NR⁶R⁷. In some embodiments, R⁶And R⁷Independently of one another, H or alkyl, e.g. (C)_1-6) An alkyl group. In some embodiments, R⁶And R⁷Is ethyl. In some embodiments, n is 0 or 1.

In some embodiments, R⁵Is C F₂CF₃. In certain embodiments, R³Is H or alkyl, e.g. (C)_1-4) Alkyl, and R⁴Is H. In certain embodiments, R is alkyl, e.g., (C)_1-4) An alkyl group. In some embodiments, R is methyl. In other particular embodiments, R³Is H. In some embodiments, R is H or alkyl, e.g., (C)_1-4) Alkyl, and R is H. In some embodiments, R¹Is an alkyl group. In some embodiments, R¹Is methyl. In some particular embodiments, R¹Is H.

In some embodiments, the TLR7 and/or TLR8 agonist represented by the structure of formula (XV):

wherein ring A represents a 6-10 membered aromatic carbocyclic ring or a 5-10 membered heteroaromatic ring;

r represents a halogen atom, an alkyl group, a hydroxyalkyl group, a haloalkyl group, an alkoxy group, a hydroxyalkoxy group, a haloalkoxy group, an amino group, an alkylamino group, a dialkylamino group or a 4-to 7-membered ring containing 1 to 2 ring heteroatoms in the ring, said 1 to 2 ring heteroatoms being selected from 1-2 nitrogen atoms and optionally heteroatoms of 0-1 oxygen atom or 0-1 sulfur atom;

n represents an integer of 0 to 2, and when n is 2, the R's may be the same or different;

Z¹represents a substituted or unsubstituted alkylene group or a substituted or unsubstituted cycloalkylene group;

X²represents an oxygen atom, a sulfur atom, SO₂、NR⁵、CO、CONR⁵、NR⁵CO、SO₂NR⁵、NR⁵SO₂、NR⁵CONR⁶Or NR⁵CSNR⁶(wherein R is⁵And R⁶Each independently is a hydrogen atom, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted cycloalkyl group);

Y¹、Y²and Y³Each independently represents a single bond or an alkylene group;

X¹represents an oxygen atom, a sulfur atom, SO₂、NR⁴(wherein R is⁴Is a hydrogen atom or an alkyl group) or a single bond;

R²represents a hydrogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkenyl group, a substituted or unsubstituted alkynyl group, or a substituted or unsubstituted ringAn alkyl group; and is

R¹Represents a hydrogen atom, a hydroxyl group, an alkoxy group, an alkoxycarbonyl group, a haloalkyl group, a haloalkoxy group, a substituted or unsubstituted aryl group, a substituted or unsubstituted heteroaryl group or a substituted or unsubstituted cycloalkyl group. The linker is attached to one of the possible attachment sites of the agonist (e.g., to-NH)₂Connected).

In some embodiments, R¹Represents hydrogen, hydroxy, or C₁-C₆Alkoxy radical, C₂-C₅Alkoxycarbonyl group, C₁-C₆Haloalkyl, C₁-C₆Haloalkoxy, C₆-C₁₀Aryl radical, C₅-C₁₀Heteroaryl or C₃-C₈Cycloalkyl groups, each group optionally substituted with one or more substituents independently selected from: halogen, hydroxy, C₁-C₆Alkyl radical, C₁-C₆Haloalkyl, C₁-C₆Alkoxy radical, C₁-C₆Haloalkoxy, C₂-C₅Alkoxycarbonyl, amino (NH)₂) And (mono) -C₁-C₆Alkylamino and (di) -C₁-C₆An alkylamino group;

Y¹represents a single bond or C₁-C₆An alkylene group;

X¹represents a single bond, oxygen, sulfur atom, Sulfonyl (SO)₂) Or NR³；

Z¹Is represented by C₂-C₆Alkylene or C₃-C₈A cycloalkylene group, each group optionally substituted with at least one hydroxyl group;

X²represents NR⁴；

Y²Represents a single bond or C₁-C₆An alkylene group;

Y³represents a single bond or C₁-C₆An alkylene group;

n is an integer 0, 1 or 2;

r represents halogen or C₁-C6 alkyl, C₁-C₆Hydroxyalkyl radical, C₁-C₆Haloalkyl, C₁-C₆Alkoxy radical, C₁-C₆Hydroxyalkoxy, C₁-C₆Haloalkoxy, amino (NH)₂) And (mono) -C₁-C₆Alkylamino, (di) -C₁-C₆Alkylamino group or C comprising a ring nitrogen atom and optionally one or more additional heteroatoms independently selected from nitrogen, oxygen and sulfur₃-C₈A saturated heterocycle, said heterocycle being optionally substituted with one or more substituents selected from the group consisting of: halogen, hydroxy, oxy, C₁-C₆Alkyl radical, C₁-C₆Alkoxy radical, C₂-C₅Alkylcarbonyl and C₂-C₅An alkoxycarbonyl group;

R²represents hydrogen or C₁-C₆Alkyl radical, C₂-C6 alkenyl, C₂-C₆Alkynyl or C₃-C₈Cycloalkyl groups, each group optionally substituted with one or more substituents independently selected from: halogen, hydroxy or C₁-C₆Alkoxy radical, C₂-C₁₀Acyloxy selected from C_2-5Alkylcarbonyloxy radical, C₂-C₅Alkenylcarbonyloxy radical, C₂-C₅Alkynyl carbonyloxy radical, C₆-C₉Arylcarbonyloxy radical and C₅-C₉A group of heteroarylcarbonyloxy groups, wherein each acyloxy group may be optionally substituted with one or more substituents independently selected from: halogen, hydroxy, C₁-C₃Alkoxy and phenyl (provided that the total number of carbon atoms in the acyloxy group does not exceed 10), amino (NH)₂) (mono) -C₁-C₆Alkylamino radicals, (bis) -C₁-C₆Alkylamino groups and C comprising a ring nitrogen atom and optionally one or more additional heteroatoms independently selected from nitrogen, oxygen and sulfur₃-C₈A saturated heterocycle which in turn is optionally substituted with one or more substituents independently selected from: halogen, hydroxy, oxy, C₁-C₆Alkyl radical, C₁-C₆Alkoxy radical, C₂-C₅Alkylcarbonyl and C₂-C₅An alkoxycarbonyl group;

R³represents hydrogen or C₁-C₆An alkyl group;

R⁴represents CO₂R⁵、SO₂R⁵、COR⁵、SO₂NR⁶R⁷And CONR⁶R⁷；

R⁵Independently represent

(i) Comprising 1 or 2 selected ring groups NR⁸、S(O)_mOr a heteroatom of oxygen, said 3 to 8 membered heterocyclic ring being optionally substituted with one or more substituents independently selected from: halogen, hydroxy or C₁-C₆Alkyl and C₁-C₆An alkoxy radical, or

(ii)C₆-C₁₀Aryl or C₅-C₁₀Heteroaryl groups, each of which may be optionally substituted with one or more substituents independently selected from: halogen, cyano, C₁-C₆Alkyl radical, C₁-C₃Haloalkyl, carboxyl, S (O)_mR⁹、OR¹⁰、CO₂R¹⁰、SO₂NR¹⁰R¹¹、CONR¹⁰R¹¹、NR¹⁰R¹¹、NR¹⁰SO₂R⁹、NR¹⁰CO₂R⁹、NR¹⁰COR⁹Or is or

(iii)C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl or C₃-C₈Cycloalkyl groups, each of which may be optionally substituted with one or more substituents independently selected from: halogen, CN, C₃-C₈Cycloalkyl, S (O)_pR¹²、OR¹³、COR¹³、CO₂R¹³、SO₂NR¹³R¹⁴、CONR¹³R¹⁴、NR¹³R¹⁴、NR¹³SO₂R¹²、NR¹³CO₂R¹²、NR¹³COR¹²、NR¹³SO₂R¹²Or C₆-C₁₀Aryl or C₅-C₁₀A heteroaryl group or a heterocycle, the latter three groups being optionally substituted by one or more substituents independently selected from: c₁-C₆Alkyl (by hydroxy, C)₁-C₆Alkoxy radical, C₁-C₆Alkoxycarbonyl, amino, C₁-C₆Alkylamino radical, bis-C₁-C₆Alkylamino radical, NH₂C(O)—、C₁-C₆Alkyl NHC (O), bis-C₁-C₆Alkyl radicals NC (O) -OCH₂CH₂OH, pyrrolidinyl, pyrrolidinylcarbonyl, furyl, piperidinyl, methylpiperidinyl or phenyl optionally substituted), C₂-C₆Alkenyl (optionally substituted by phenyl), halogen, hydroxy, cyano, carboxy, amino, C₁-C₆Alkylamino radical, bis-C₁-C₆Alkylamino radical, NH₂C(O)—，C₁-C₆Alkyl NHC (O) -, bis-C₁-C₆Alkyl radical NC (O), C₁-C₆Alkoxycarbonyl radical, C₁-C₆Alkylsulfonyl radical, C₁-C₆Alkylcarbonylamino, C₁-C₆Alkylcarbonylmethylamino, phenyl (optionally substituted with hydroxy, fluoro or methyl), pyrrolidinyl, pyridinyl, piperidinyl, benzothiazolyl or pyrimidinyl;

R⁶represents hydrogen or C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, C₃-C₈A cycloalkyl group or a heterocycle, each of which may be optionally substituted with one or more substituents independently selected from: halogen, hydroxy, oxo, cyano, C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, C₃-C₈Cycloalkyl, OR¹⁵、S(O)_qR¹⁵、CO₂R¹⁶、COR¹⁶、NR¹⁶R¹⁷、CONR¹⁶R¹⁷、NR¹⁶COR¹⁷、NR¹⁶CO₂R¹⁵、SO₂NR¹⁶R¹⁷、NR¹⁶SO₂R¹⁵Or C₆-C₁₀Aryl or C₅-C₁₀A heteroaryl group or a heterocycle, the latter three groups being optionally substituted by one or more substituents independently selected from: c₁-C₆Alkyl radical, C₃-C₈Cycloalkyl, halogen, S (O)_qR¹⁵、CO₂R¹⁶、COR¹⁶Hydroxy or cyano; and

R⁷represents hydrogen, C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl or C₃-C₈Cycloalkyl groups, each of which may be optionally substituted with one or more substituents independently selected from: halogen, C₃-C₈Cycloalkyl radical, C₆-C₁₀Aryl or C₅-C₁₀Heteroaryl group, carboxyl group, cyano group, OR¹⁵Hydroxy or NR¹⁸R¹⁹Or is or

R⁶And R⁷Together with the nitrogen atom to which they are attached form a 3-to 8-membered saturated or partially saturated heterocyclic ring, optionally containing a nitrogen atom, S (O)_mOr oxygen, which heterocyclic ring may be optionally substituted with one or more substituents independently selected from: halogen, hydroxy, carboxy, cyano, OR²⁰、NR²¹R²²、S(O)_qR²³、COR²⁴、CO₂R²⁴、NR²⁴R²⁵、CONR²⁴R²⁵、NR²⁴COR²⁵、NR²⁴CO₂R²³、SO₂NR²⁴R²⁵、NR²⁴SO₂R²³、C₆-C₁₀Aryl radical, C₅-C₁₀Heteroaryl radical, heterocycle, C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl or C₃-C₈A cycloalkyl group, the latter seven groups optionally substituted with one or more substituents independently selected from: halogen, hydroxy, oxy, cyano, OR²⁰、S(O)_qR²³、COR²⁴、CO₂R²⁴、NR²⁴R²⁵、CONR²⁴R²⁵、NR²⁴CO₂R²³、NR²⁴COR²⁵、SO₂NR²⁴R²⁵、NR²⁴SO₂R²³Hetero ring or C₆-C₁₀Aryl or C₅-C₁₀A heteroaryl group, the last three groups being optionally substituted with one or more substituents independently selected from: c₁-C₆Alkyl, halogen, hydroxy or cyano;

R⁸represents hydrogen and CO₂R²⁶、COR²⁶、SO₂R²⁶、C₁-C₆Alkyl or C₃-C₆Cycloalkyl groups, each of which may be optionally substituted with one or more substituents independently selected from: halogen, hydroxy and NR²⁷R²⁸；

R¹⁰、R¹¹、R¹⁶、R¹⁷、R¹⁸、R¹⁹、R²¹、R²²、R²⁶、R²⁷Or R²⁸Each independently represents hydrogen, and C₁-C₆Alkyl or C₃-C₆A cycloalkyl group;

R²⁴and R²⁵Each independently represents hydrogen, and C₁-C₆Alkyl or C₃-C₆A cycloalkyl group; or

R²⁴And R²⁵Together with the nitrogen atom to which they are attached form a 3-to 8-membered saturated or partially saturated heterocyclic ring, optionally comprising an additional ring selected from nitrogen, S (O)_mOr a heteroatom or heterogroup of oxygen;

R⁹、R¹²、R¹⁵and R²³Is represented by C₁-C₆Alkyl or C₃-C₆A cycloalkyl group;

R¹³and R¹⁴Respectively for R⁶And R⁷Defining;

R²⁰is represented by C₁-C₆Alkyl optionally substituted with one or more substituents independently selected from: halogen, hydroxy OR OR²³；

M, p, q and r each independently represent an integer of 0, 1 or 2; and is

A represents C₆-C₁₀Aryl or C₅-C₁₂A heteroaryl group. See WO2008004948a1, US 8,138,172 and US 8,575,180, the disclosures of which are incorporated by reference in their entirety.

In some embodiments, the TLR7 and/or TLR8 agonist has the structure:

wherein R is Me or H.

In some embodiments, the TLR7 and/or TLR8 has the structure:

in some embodiments, the TLR7 and/or TLR8 agonist has the structure of formula (XVI):

wherein: r¹Independently is H, -C (O) R³Or a racemic, L-or D-amino acid radical-C (O) CHNH₂R⁴Wherein R is³Is a substituted or unsubstituted alkyl group, and R⁴Is H or substituted or unsubstitutedAn alkyl group;

R²is H, O, OR⁵Or N (R)⁶)₂Wherein R is⁵Independently is H or alkyl, and wherein R⁶Independently is H, substituted or unsubstituted alkyl, cycloalkyl, or together with the nitrogen forms a substituted or unsubstituted heterocycloalkyl ring; and wherein if R is-OH, at least one of said R groups is a racemic, L-or D-amino acid group-C (O) CHNH₂R⁴. See US6,924,271, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, the R is¹At least one of the radicals being racemic, an L-or D-amino acid radical-C (O) CHNH₂R⁴Wherein R is⁴Is a substituted or unsubstituted alkyl group, and wherein the remainder of R¹The group is H; r²Is OR⁵Or N (R)⁶)₂Wherein R is⁵Independently selected from H or alkyl, and wherein R is independently H, substituted or unsubstituted alkyl, cycloalkyl, or together with the nitrogen forms a substituted or unsubstituted heterocycloalkyl ring.

In some embodiments, the R is¹At least one of the radicals being an L-amino acid group-C (O) CHNH₂R⁴Wherein R is⁴Is a substituted or unsubstituted alkyl group, and wherein the remainder of R¹The group is H; r²Is OR⁵Or N (R)⁶)₂Wherein R is⁴Is a substituted alkyl group, and wherein R⁶Independently is H or substituted or unsubstituted alkyl.

In some embodiments, the R is¹At least one of the radicals being an L-amino acid group-C (O) CHNH₂R, wherein R⁴is-CH (CH)₃)₂And wherein R remains¹The group is H; and R is²Is OH.

In some embodiments, the TLR7 and/or agonist is selected from the group consisting of:

in some embodiments, the TLR7 and/or TLR8 has the structure:

wherein:

each R¹Is H, or a substituted or unsubstituted alkyl, alkenyl, or alkynyl group, or a substituted or unsubstituted aryl or heteroaryl group, which alkyl, alkenyl, or alkynyl group may be interrupted by one or more O, S, or N, heteroatoms;

R²is H, OH, SH, halo, or a substituted or unsubstituted alkyl, alkenyl or alkynyl group, or a substituted or unsubstituted-O- (alkyl), -O- (aryl), -O- (heteroaryl), -S- (alkyl), -S- (aryl), -S- (heteroaryl), aryl, or heteroaryl group, which alkyl, alkenyl or alkynyl group may be interrupted by one or more O, S or N heteroatoms;

R³is H, OH, or SH, or a substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl, heteroaryl, — O- (alkyl), — O- (aryl), — O- (heteroaryl), — S- (alkyl), — S- (aryl), — S- (heteroaryl), — NH (alkyl), — NH (aryl), — NH (heteroaryl), — NH (R)⁴) (alkyl) - (NH) (R)⁴) (aryl), or-NH (R)⁴) (heteroaryl) wherein R is⁴Is a substituted or unsubstituted alkyl group;

x is O or S;

y is H, halo, OH, OR⁴、SH、SR⁴Or a substituted or unsubstituted alkyl or aryl group; and is

Z is H, halo, OH, OR⁴、SH、SR⁴. See US 7,576,068, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, the TLR7 and/or TLR8 agonist has the structure of formula (XVIII):

wherein:

Y—Z

is-CR⁴R⁵—、—CR⁴R⁵—CR⁴R⁵—、—C(O)CR⁴R⁵—、—CR⁴R⁵C(O)—、—NR⁸C(O)—、—C(O)NR⁸—、—CR⁴R⁵S(O)₂-or-CR⁵═CR⁵—；

L¹

is-NR⁸—、—O—、—S—、—N(R⁸)C(O)—、—S(O)₂—、—S(O)—C(O)N(R⁸)—、—N(R⁸)S(O)₂—、—S(O)₂N(R⁸) -or a covalent bond;

R¹is alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl or substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl;

X¹is alkylene, substituted alkylene, heteroalkylene, substituted heteroalkylene, alkenylene, substituted alkenylene, alkynylene, substituted alkynylene, carbocyclylene, substituted carbocyclylene, heterocyclylene, substituted heterocyclylene, — NR⁸—、—O—、—C(O)—、—S(O)—、S(O)₂-or a bond;

d is carbocyclyl, substituted carbocyclyl, heterocyclyl or substitutedHeterocyclyl, wherein said carbocyclyl, substituted carbocyclyl, heterocyclyl or substituted heterocyclyl is substituted with one or two-L²-NR⁶R⁷Substitution; or

D is a heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl, wherein the heterocyclyl, substituted heterocyclyl, heteroaryl, or substituted heteroaryl contains one to four nitrogen atoms;

each L²Independently is alkylene, substituted alkylene, heteroalkylene, substituted heteroalkylene, or a covalent bond;

each R³Independently halogen, cyano, azido, nitro, alkyl, substituted alkyl, hydroxy, amino, heteroalkyl, substituted heteroalkyl, alkoxy, haloalkyl, haloalkoxy, — CHO, — c (o) OR⁸、—S(O)R⁸、—S(O)₂R⁸；—C(O)NR⁹R¹⁰、—N(R⁹)C(O)R⁸Carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, — s (o)₂NR⁹R¹⁰、—N(R⁹)S(O)₂R⁸、—N(R⁹)S(O)₂OR¹⁰、—OS(O)₂NR⁹R¹⁰；

n is 0, 1,2,3,4 or 5;

R⁴and R^{5 each of}Independently of the others, H, alkyl, substituted alkyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, OR substituted heteroarylheteroalkyl, cyano, azido, OR⁸、—C(O)H、—C(O)R⁸、—S(O)R⁸、—S(O)₂R⁸、—C(O)OR⁸or-C (O) NR⁹R¹⁰(ii) a Or

R⁴And R⁵Together with the carbons to which they are both attached form a carbocyclic ring, substituted carbocyclic ring, heterocyclic ring, or substituted heterocyclic ring; or

When on the same carbon atom, R⁴And R⁵Together with the carbon to which they are attached is-C (O) -or-C (NR)⁸) A; or

Two R on adjacent carbon atoms⁴Or two R⁵(ii) when taken together with the carbon to which they are attached form a 3-to 6-membered carbocyclic ring, substituted carbocyclic ring, heterocyclic ring, or substituted heterocyclic ring;

R⁶and R7 is each independently H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl, — C (O) H, — C (O) R⁸、—S(O)R⁸、—S(O)₂R⁸、—C(O)OR⁸or-C (O) NR⁹R¹⁰、S(O)₂NR⁹R¹⁰(ii) a Or

R⁶And R⁷Together with the nitrogen to which both are attached, form a substituted or unsubstituted heterocyclic ring which may contain one or more additional heteroatoms selected from N, O, P or S; or

R⁷L connected to both²And N form a substituted or unsubstituted 3 to 8 membered heterocyclic ring which may contain one or more additional heteroatoms selected from N, O, S or P;

R⁸is H, alkyl, substituted alkyl, haloalkyl, alkenyl, substituted alkenyl, alkynyl, substitutedAlkynyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl; and is

R⁹And R¹⁰Each independently is H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, haloalkyl, heteroalkyl, substituted heteroalkyl, carbocyclyl, substituted carbocyclyl, carbocyclylalkyl, substituted carbocyclylalkyl, heterocyclyl, substituted heterocyclyl, heterocyclylalkyl, substituted heterocyclylalkyl, arylalkyl, substituted arylalkyl, heteroarylalkyl, substituted heteroarylalkyl, carbocyclylheteroalkyl, substituted carbocyclylheteroalkyl, heterocyclylheteroalkyl, substituted heterocyclylheteroalkyl, arylheteroalkyl, substituted arylheteroalkyl, heteroarylheteroalkyl, or substituted heteroarylheteroalkyl; or

R⁹And R¹⁰Together with the nitrogen to which both are bonded, form a substituted or unsubstituted heterocyclic ring;

wherein each substituted alkyl, substituted alkenyl, substituted alkynyl, substituted heteroalkyl, substituted carbocyclyl, substituted carbocyclylalkyl, substituted heterocyclyl, substituted heterocyclylalkyl, substituted arylalkyl, substituted heteroarylalkyl, substituted carbocyclylheteroalkyl, substituted heterocyclylheteroalkyl, substituted arylheteroalkyl, substituted heteroarylheteroalkyl, substituted alkylene, substituted heteroalkylene, substituted alkenylene, substituted alkynylene, substituted carbocyclylene, or substituted heterocyclylene is independently substituted with one to four substituents selected from the group consisting of: -halogen, -R, -O^-、═O、—OR、—SR、—S^-、—NR₂、—N(+)R₃═ NR, — C (halogen)₃-CR (halogen)₂、—CR₂(halogen), -CN, -OCN, -SCN, -N ═ C ═ O, -NCS, -NO₂、═N₂、—N₃、—NRC(═O)R、—NRC(═O)OR、—NRC(═O)NRR、—C(═O)NRR、—C(═O)OR、—OC(═O)NRR、—OC(═O)OR、—C(═O)R、—S(═O)₂OR、—S(═O)₂R、—OS(═O)₂OR、—S(═O)₂NR、—S(═O)R、—NRS(═O)₂R、—NRS(═O)₂NRR、—NRS(═O)₂OR、—OP(═O)(OR)₂、—P(═O)(OR)₂(O) R, - (C (═ O) R, - (═ S) R, - (═ O) OR, - (═ S) OR, - (C (═ O) SR, - (═ S) SR, - (═ O) NRR, - (C (═ S) NR R, - (═ NR) NRR and- (NRC (═ NR) NRR; wherein each R is independently H, alkyl, cycloalkyl, aryl, arylalkyl, or heterocyclyl. See US 20100143301 a1, the disclosure of which is incorporated by reference in its entirety.

In some embodiments, the TLR7 and/or TLR8 has the structure:

wherein:

L¹is-NH-or-O-;

R¹is alkyl, substituted alkyl, heteroalkyl, substituted heteroalkyl, heterocyclylalkyl, substituted heterocyclylalkyl, carbocyclylalkyl, or substituted carbocyclylalkyl;

R⁴and R⁵Each independently is H or C₁-C₆Alkyl, or R⁴And R⁵Together with the carbon to which it is attached is-C (O) -;

X¹is C₁-C₆Alkylene radical, C₁-C₆Heteroalkylene or C₁-C₆Substituted heteroalkylene groups;

d is phenyl, biphenyl or pyridyl, wherein said phenyl, biphenyl or pyridyl is substituted by-L²-NR⁶R⁷Substitution; or

D is pyridyl, piperidinyl, piperazinyl or 1,2,3, 4-tetrahydroisoquinolinyl;

n is 0 or 1;

R³is halogen, cyano, alkyl, carbocyclyl, carbocyclylalkyl, haloalkyl, -C (O) OR⁶、—C(O)NR⁹R¹⁰Or — CHO;

L²is C₁-C₆An alkylene or covalent bond;

R⁶and R⁷Each is independently H, alkyl or heteroaryl; or

R⁶And R⁷Together with the nitrogen to which they are attached form a substituted or unsubstituted 4-6 membered heterocyclic ring containing 0 to 2 heteroatoms selected from N, O or S.

In some embodiments, the TLR7 and/or TLR8 has the structure:

C. the amount of immunotherapeutic agent in the therapeutic composition

In another aspect, the present disclosure provides a therapeutic combination comprising an immunomodulatory chemotherapeutic agent and an immunotherapeutic agent in amounts suitable for combination therapy treatment of diseases (e.g., tumors and cancers).

In some embodiments, the amount of the immunotherapeutic agent is capable of: (1) inducing IFN- α in enriched human blood DC; (2) inducing TNF- α in enriched human blood DC; and/or (3) inducing IL-12-alpha in enriched human blood DCs.

The method for measuring the activity of the immunotherapeutic agent is: 1) an assay that measures the release of an immunotherapy-stimulated cytokine from human dendritic cells; and 2) efficacy studies in immunotherapy-treated tumor models.

In some embodiments, the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered orally or intravenously in an amount such that the local concentration of the immunotherapeutic agent (e.g., near or at the tumor site of a solid tumor) is from about 0.005 μ g/ml to about 1,2,3,4, 5,6, 7,8,9, 10, 11, or 12 μ g/ml, or a range defined by any pair of values in the above list, including all endpoints.

Local concentrations of the immunotherapeutic agent (e.g., near or at the tumor site of a solid tumor) can be measured using methods known in the art (e.g., measuring tissue or blood concentrations). The local effective concentration of a therapeutic agent depends on its absorption from various pathways, tissue distribution, and metabolic processes, and the plasma pharmacokinetics and tissue concentration of the agent can be routinely measured using methods known in the art.

In some embodiments, the immunotherapeutic agent is administered in an amount such that the local concentration of the immunotherapeutic agent (e.g., near or at a tumor site of a solid tumor) is about 0.05 μ g/ml, 0.1 μ g/ml, 0.15 μ g/ml, 0.2 μ g/ml, 0.3 μ g/ml, or 0.4 μ g/ml to about 0.5 μ g/ml, or a range defined by any pair of values in the above list, including all endpoints.

In some embodiments, an oral formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered twice weekly to the subject at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, 0.01mg/kg, or 0.015mg/kg to about 0.02mg/kg, or a range defined by any pair of values in the above list, including all endpoints. In some embodiments, an oral formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered twice weekly to the subject at a dose of about 0.0005 to about 0.0006, 0.0007, 0.0008, 0.0009, 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.015, or 0.02mg/kg, or a range defined by any pair of values in the above list, including all endpoints.

In some embodiments, an oral formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered twice weekly to the subject at a dose of at least 0.0001mg/kg but no less than or about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01 mg/kg.

In some embodiments, an intravenous formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered to the subject per week at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, 0.01mg/kg, or about 0.015mg/kg to about 0.02mg/kg, or a range defined by any pair of values in the foregoing list, including all endpoints. In some embodiments, the subject is administered an intravenous formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) per week at a dose of about 0.0005mg/kg to about 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, 0.01mg/kg, 0.015mg/kg, or 0.02mg/kg, or a range defined by any pair of values in the foregoing list, including all endpoints.

In some embodiments, the methods comprise administering to the subject an intravenous formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) weekly at a dose of about 0.0008mg/kg to about 0.0133 mg/kg.

In some embodiments, an intravenous formulation comprising the immunotherapeutic agent (e.g., resiquimod or an analog thereof) is administered weekly to the subject at a dose of at least 0.0001mg/kg but not less than or about 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, or about 0.01 mg/kg. For references to immunotherapeutics and safe dosages, see Jurk et al, Nature Immunology, low 4, No.6 "499 (2002), and Pockros et al, j.hepatology, 47: 174, and 2007, the disclosure of which is incorporated by reference in its entirety.

III.Pharmaceutical formulations and administration

The present disclosure further relates to a pharmaceutical formulation comprising a compound according to an embodiment of the present invention, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers.

A wide variety of routes or modes of administration can be used to deliver the compounds described herein (including pharmaceutically acceptable carriers, such as addition salts or hydrates thereof) to a patient. Suitable routes of administration include inhalation, transdermal, oral, rectal, transmucosal, intestinal, and parenteral administration, including intramuscular, subcutaneous, and intravenous injections. Preferably, the compounds comprising an immunomodulatory agent according to embodiments of the invention are administered parenterally, more preferably intravenously.

As used herein, the term "administration" is intended to encompass all means for delivering a compound directly or indirectly to its intended site of action.

The compounds described herein, or pharmaceutically acceptable salts and/or hydrates thereof, can be administered independently, in combination with other compounds described in embodiments of the present invention, and/or in admixture with other therapeutic agents. Of course, the choice of therapeutic agent that can be co-administered with a compound to which the present disclosure pertains will depend in part on the condition being treated.

For example, when administered to a patient suffering from a disease state caused by an organism that relies on an autoinducer, the compounds of the embodiments of the invention may be administered in a mixture containing agents useful for treating pain, infections, and other symptoms and side effects commonly associated with disease. Such agents include, for example, analgesics, antibiotics, and the like.

When administered to a patient receiving a cancer treatment, the compounds may be administered in a mixture containing an anti-cancer agent and/or a complementary potentiating agent. The compounds may also be administered in mixtures containing agents that treat side effects of radiation therapy (e.g., antiemetics, radioprotectants, and the like).

Supplementary potentiating agents that can be co-administered with the compounds of the present embodiments include, for example, tricyclic antidepressants (e.g., imipramine (imipramine), desipramine, amitriptyline, clomipramine, trimipramine, doxepin (doxepin), nortriptyline, protriptyline, amoxapine, and maprotiline); non-tricyclic drugs and antidepressants (e.g., sertraline, trazodone and citalopram); ca +2 antagonists (e.g., verapamil, nifedipine, nitrendipine, and caroverine); amphotericin; triphenylethanol analogs (e.g., tamoxifen); antiarrhythmic drugs (e.g., quinidine); antihypertensive drugs (e.g., reserpine); thiol consuming agents (e.g., buthionine and sulfoximines); and calcium folinate.

The active compounds according to embodiments of the present invention are administered as such or in the form of a pharmaceutical composition, wherein the active compound is mixed with one or more pharmaceutically acceptable carriers, excipients or diluents. Pharmaceutical compositions for use in accordance with embodiments of the present invention are generally formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Suitable formulations depend on the route of administration chosen.

For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the compounds can be readily formulated by combining the active compound with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the embodiments of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries and suspensions, for oral administration to a patient to be treated. Oral pharmaceutical formulations can be obtained as follows: solid excipients, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired to give tablets or dragee cores. Suitable excipients are in particular fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, for example maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents, such as cross-linked polyvinylpyrrolidone, agar or alginic acid or a salt thereof such as sodium alginate, may be added.

Dragee cores are provided with suitable coatings. To this end, concentrated sugar solutions may be used, which may optionally comprise gum arabic, talc, polyvinyl pyrrolidone, carbomer gel, polyethylene glycol and/or titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to the tablets or dragee coatings for the purpose of identifying or characterizing different combinations of active compound doses.

Pharmaceutical preparations for oral use include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules may contain the active ingredients in admixture with fillers such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids (for example fatty oils, liquid paraffin or liquid polyethylene glycols). In addition, stabilizers may be added. The dosage of all formulations for oral administration should be suitable for such administration.

For oral administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.

For administration by inhalation, the compounds for use according to embodiments of the present invention are conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas). In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds may be formulated for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Injection is a preferred method of administration of the compositions described in embodiments of the present invention. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents such as cross-linked polyvinylpyrrolidone, agar or alginic acid or a salt thereof such as sodium alginate.

Pharmaceutical preparations for parenteral administration comprise aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils, such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, for example sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compound to allow for the preparation of highly concentrated solutions. For injection, the agents of the embodiments of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers (e.g., hanks 'solution, ringer's solution, or physiological saline buffer).

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the compounds may also be formulated as depot preparations. Such long acting formulations may be delivered by implantation or transdermal delivery (e.g. subcutaneous or intramuscular), intramuscular injection or transdermal patch. Thus, for example, the compounds may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, e.g., as a sparingly soluble salt.

The pharmaceutical composition may also comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include calcium carbonate, calcium phosphate, various sugars, starch, cellulose derivatives, gelatin, and polymers such as polyethylene glycol.

In some embodiments, the pharmaceutical composition of embodiments of the invention further comprises an additional therapeutic agent in addition to the chemotherapeutic agent and the immunotherapeutic agent.

In some embodiments, the additional therapeutic agent is an anti-cancer agent.

In some embodiments, the additional anti-cancer agent is selected from an anti-metabolite, an inhibitor of topoisomerase I and II, an alkylating agent, a microtubule inhibitor, an anti-androgen agent, a GNRh modulator, or a mixture thereof.

In some embodiments, the additional therapeutic agent is a chemotherapeutic agent.

By "chemotherapeutic agent" is meant herein a chemical compound useful in the treatment of cancer. Examples are, but not limited to: gemcitabine, irinotecan, doxorubicin, 5-fluorouracil, cytarabine ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytotoxins, TAXOL, methotrexate, cisplatin, Melphalan, vinblastine, and carboplatin.

In some embodiments, the second chemotherapeutic agent is selected from tamoxifen, raloxifene, anastrozole, exemestane, letrozole, imatinib, paclitaxel, cyclophosphamide, lovastatin, minoxidil, gemcitabine, cytarabine, 5-fluorouracil, methotrexate, docetaxel, goserelin, vincristine, vinblastine, nocodazole, teniposide, etoposide, gemcitabine, epothilone, vinorelbine, camptothecin, daunorubicin, actin-D, mitoxantrone, acridine, doxorubicin, epirubicin, or idarubicin.

IV.Reagent kit

In another aspect, the embodiments of the present invention provide a kit comprising a therapeutic combination provided herein and instructions for the therapeutic combination. The kit may further comprise a container and optionally one or more vials, tubes, flasks, bottles, or syringes. Other forms of kits will be apparent to those skilled in the art and are within the scope of the invention.

V.Medical use

In another aspect, the present disclosure provides a method for treating a disease condition in a patient in need of such treatment, comprising: administering to the subject a therapeutic combination or pharmaceutical composition comprising a therapeutically effective amount of a compound according to an embodiment of the invention, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

In addition to the compositions and constructs described above, embodiments of the invention also provide for various uses of the disclosed combinations. The combinations of embodiments of the invention comprise immunomodulatory chemotherapeutic agents having one or more of a tumor cell killing agent, a Treg inhibitor, a myeloid-derived suppressor cell inhibitor, and an NK activator. These uses include administering to an animal (e.g., a mammal or a human) in need thereof an effective amount of a compound described in embodiments of the invention, i.e., administering the disclosed compositions.

The compositions of the embodiments of the invention are useful for treating a disease (e.g., cancer) in a subject (e.g., a human). Combinations and uses for treating tumors by providing the compositions to a subject in a pharmaceutically acceptable manner with a pharmaceutically effective amount of a composition of the present disclosure are provided.

By "cancer" herein is meant a pathological condition in humans characterized by unregulated cell proliferation. Examples include, but are not limited to: carcinomas, lymphomas, blastomas, and leukemias. More specific examples of cancer include, but are not limited to: acute Myeloid Leukemia (AML), breast cancer, Chronic Lymphocytic Leukemia (CLL), Chronic Myeloid Leukemia (CML), Hodgkin's lymphoma, multiple myeloma, mycosis fungoides, neuroblastoma, non-Hodgkin's lymphoma (NHL), ovarian cancer, and retinoblastoma.

By "inhibiting" or "treating" herein is meant reducing, treating therapeutically and prophylactically or prophylactically treating, wherein the objective is to reduce or prevent the targeted pathological disorder or condition. In one example, a cancer patient may experience a reduction in tumor size after administration of a compound of an embodiment of the invention. "treating" includes (1) inhibiting a disease in a subject experiencing or exhibiting a pathology or symptom of the disease, (2) ameliorating the disease in a subject experiencing or exhibiting a pathology or symptom of the disease, (3) affecting any measurable reduction in the disease in a subject or patient experiencing or exhibiting a pathology or symptom of the disease. To the extent that a compound of the present embodiments can prevent the growth and/or kill cancer cells, it can be cytostatic and/or cytotoxic.

By "therapeutically effective amount" herein is meant an amount of a compound provided herein that is effective to "treat" a condition in a subject or mammal. In the case of cancer, a therapeutically effective amount of the drug may reduce the number of cancer cells, reduce tumor size, inhibit infiltration of cancer cells into peripheral organs, inhibit tumor metastasis, inhibit tumor growth to some extent, prolong non-progressive survival, prolong overall survival, prolong time to relapse after complete remission and/or relieve to some extent one or more symptoms associated with cancer. In some embodiments, the response to treatment is assessed according to RECIST criteria.

Administration "in combination with" one or more other therapeutic agents includes simultaneous (simultaneous) and sequential administration in any order. As used herein, the term "pharmaceutical combination" refers to a product obtained by mixing or combining active ingredients and includes fixed and non-fixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, e.g. the compound of formula (1) and the co-agent, are both administered to the patient simultaneously in the form of a single entity or dose. The term "non-fixed combination" means that the active ingredients, e.g., a compound of formula (1) and a co-agent, are both administered to a patient as separate entities, simultaneously or sequentially, without specific time constraints, wherein such administration provides therapeutically effective levels of the active ingredients in the patient. The latter also applies to mixture therapy, for example the administration of three or more active ingredients.

In some embodiments, the disease condition is a tumor or cancer. In some embodiments, the cancer or tumor is selected from the group consisting of gastric, colon, rectal, liver, pancreatic, lung, breast, cervical, uterine corpus, ovarian, testicular, bladder, kidney, brain/CNS, head and neck, throat, hodgkin's disease, non-hodgkin's lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer, acute lymphocytic leukemia, acute myelogenous leukemia, ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, wilms' tumor, neuroblastoma, hairy cell leukemia, mouth/pharynx, esophageal, throat, kidney, or lymphoma.

In some embodiments, the disease condition comprises abnormal cell proliferation, such as a precancerous lesion.

Embodiments of the invention are particularly useful for treating cancer and inhibiting the proliferation of tumor cells or cancer cells in an animal. Cancer or precancerous lesions, including tumors, metastases, or any disease or disorder characterized by uncontrolled cell growth, may be treated or prevented by administering a drug-ligand complex according to embodiments of the present invention.

Representative examples of precancerous conditions that may be targeted by the compounds of the embodiments of the present invention include: metaplasia, hyperplasia, dysplasia, colorectal polyps, actinic keratosis, actinic cheilitis, human papilloma virus, leukoplakia, lichen planus and bowen's disease.

Representative examples of cancers or tumors that may be targeted by the compounds of the embodiments of the present invention include: lung cancer, colon cancer, prostate cancer, lymphoma, melanoma, breast cancer, ovarian cancer, testicular cancer, CNS cancer, kidney cancer, pancreatic cancer, stomach cancer, oral cancer, nasal cancer, cervical cancer, and leukemia.

In some embodiments, the abnormal proliferation is of cancer cells.

In some embodiments, the cancer is selected from the group consisting of: breast cancer, colorectal cancer, diffuse large B-cell lymphoma, endometrial cancer, follicular lymphoma, gastric cancer, glioblastoma, head and neck cancer, hepatocellular cancer, lung cancer, melanoma, multiple myeloma, ovarian cancer, pancreatic cancer, prostate cancer, and renal cell carcinoma.

In some embodiments, the cancer treated is selected from the group consisting of: acute Myeloid Leukemia (AML), breast cancer, Chronic Lymphocytic Leukemia (CLL), Chronic Myeloid Leukemia (CML), hodgkin's lymphoma, multiple myeloma, mycosis fungoides, neuroblastoma, non-hodgkin's lymphoma (NHL), and ovarian cancer.

In some embodiments, the present disclosure provides compounds for killing cells. Administering a compound to the cells in an amount sufficient to kill the cells. In exemplary embodiments, the compound is administered to a subject carrying cells. In another exemplary embodiment, administration is used to delay or stop the growth of a tumor comprising cells (e.g., the cells may be tumor cells). For growth-retarding administration, the growth rate of the cells should be at least 10% less than the growth rate prior to administration. Preferably, the growth rate will be retarded by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or completely stop.

Furthermore, the present disclosure provides a compound or pharmaceutical composition of an embodiment of the invention for use as a medicament. The disclosure also provides compounds or pharmaceutical compositions for killing, inhibiting or delaying the proliferation of tumors or cancer cells, or for treating diseases in which TLR7 and/or TLR8 are involved.

Effective dose

Pharmaceutical compositions suitable for use in embodiments of the present invention include compositions in which the active ingredient is contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated. Determination of an effective amount is well within the ability of those skilled in the art, especially in light of the detailed disclosure herein.

For any of the compounds described herein, a therapeutically effective amount can be initially determined from a cell culture assay. The target plasma concentration will be the concentration of the active compound capable of inhibiting cell growth or division. In a preferred embodiment, cellular activity is inhibited by at least 25%. Presently preferred are target plasma concentrations of active compounds capable of inducing inhibition of cellular activity of at least about 30%, 50%, 75% or even 90% or more. The percent inhibition of cellular activity in the patient can be monitored to assess the appropriateness of the achieved plasma drug concentration, and the dose can be adjusted up or down to achieve the desired percent inhibition.

A therapeutically effective amount for use in humans can also be determined from animal models. For example, dosages for humans can be formulated to achieve circulating concentrations that have been found to be effective in animals. As described above, the dose in humans can be adjusted by monitoring cytostatic and adjusting the dose up or down.

A therapeutically effective dose can also be determined from human data for compounds known to exhibit similar pharmacological activity. The dosage employed may be adjusted according to the relative bioavailability and potency of the administered compound compared to known compounds.

Dosages are adjusted to achieve maximal efficacy in humans based on the methods described above and other methods known in the art.

In some embodiments, the compositions of embodiments of the invention are delivered locally or regionally to a tumor located within the body of the subject, systemically, or by intratumoral injection or by direct injection into the tumor vasculature.

In some embodiments, the combinations provided herein are configured for systemic delivery. In some embodiments, the combination is configured for oral administration or parenteral injection. In some embodiments, the combination is configured for intravenous or intratumoral injection.

In another aspect, the present disclosure provides a method for treating a tumor or abnormal cell proliferation in a subject in need of such treatment, comprising administering to the subject a composition provided herein.

In some embodiments, the methods provided herein comprise administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01mg/kg to about 0.02mg/kg, or any range defined by pairs of values in the foregoing list, including all endpoints.

In some embodiments, the methods provided herein comprise administering to the subject an oral formulation comprising the immunotherapeutic agent twice weekly at a dose of at least 0.0001mg/kg but no less than or about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, 0.006mg/kg, 0.007mg/kg, 0.008mg/kg, 0.009mg/kg, or 0.01 mg/kg.

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation comprising the immunotherapeutic agent per week at a dose of about 0.0005mg/kg, 0.0006mg/kg, 0.0007mg/kg, 0.0008mg/kg, 0.0009mg/kg, 0.001mg/kg, 0.002mg/kg, 0.003mg/kg, 0.004mg/kg,0.005mg/kg, or 0.006mg/kg to about 0.015mg/kg, or any range defined by pairs of values in the foregoing list, including all endpoints.

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent at a dose of about 40-50mg/kg in divided doses over 2-5 days.

In some embodiments, the combination is administered repeatedly at intervals of 2-4 weeks.

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic agent at a dose of about 10 to 15mg/kg, the dose administered every 7 to 10 days.

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic twice weekly at a dose of about 3 to 5 mg/kg.

In some embodiments, the methods provided herein comprise administering an effective amount of about 60-120mg/m²Daily dosage an intravenous formulation comprising the immunomodulatory chemotherapeutic is administered to the subject continuously daily.

In some embodiments, the methods provided herein comprise a concentration of about 400-1000mg/m²Administering to said subject an oral formulation comprising said immunomodulatory chemotherapeutic agent, said dose administered in divided doses over 4-5 days.

In some embodiments, the methods provided herein comprise administering an effective amount of about 50-100mg/m²Administering to the subject an intravenous formulation comprising the immunomodulatory chemotherapeutic at a dose per day or 1-5 mg/kg/day.

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation in the form of an intermittent therapy, wherein 40-50mg/kg is administered in divided doses over 2-5 days. Administration was repeated at 2-4 week intervals. In some embodiments, the dose is 10 to 15mg/kg, administered every 7 to 10 days; or 3 to 5mg/kg twice weekly

In some embodiments, the methods provided herein comprise administering to the subject an intravenous formulation at a dose of 1-2.5 mg/kg/day in the form of a continuous daily regimen.

In some embodiments, the methods provided herein comprise administering to the subject an oral formulation in the form of an intermittent therapy, wherein the administration is in divided doses over 4-5 days at a dose of 40-50 mg/kg.

In some embodiments, the methods provided herein comprise administering to the subject an oral formulation at a dose of 1-5 mg/kg/day in a form of continuous daily therapy.

In the case of topical administration, the systemic circulating concentration of the administered compound is not particularly important. In this case, the compound is administered to achieve a concentration in the local area effective to achieve the desired result.

Therapeutic amounts of the specific antibodies disclosed herein can also be administered as a component of a combination with an immunotherapeutic agent in a single mixture or separately. In some embodiments, the therapeutic amount is an amount that eliminates or reduces tumor burden, or prevents or reduces metastatic cell proliferation, in the patient. The dosage will depend on a number of parameters, including the nature of the tumor, patient history, patient condition, possible co-use of other oncolytic agents, and the method of administration. Methods of administration include injection (e.g., parenteral, subcutaneous, intravenous, intraperitoneal, etc.), wherein the antibody is provided in a non-toxic pharmaceutically acceptable carrier (e.g., water, saline, ringer's solution, dextrose solution, 5% human serum albumin, fixed oil, ethyl oleate, or liposomes). A typical dosage range may be from about 0.01 to about 20mg/kg, for example from about 0.1 to about 10 mg/kg. Other effective methods of administration and dosages can be determined by routine experimentation and are within the scope of the invention.

For other modes of administration, the amount and interval of doses can be adjusted independently to provide plasma levels of the administered compound that are effective for the particular clinical indication being treated. For example, in one embodiment, a compound according to an embodiment of the present invention may be administered at relatively high concentrations multiple times per day. Alternatively, it may be more desirable to administer the compounds of the embodiments of the present invention in a minimum effective concentration and using a less frequent administration regimen. This will provide a treatment regimen commensurate with the severity of the disease in the individual.

Using the teachings provided herein, an effective treatment regimen can be planned that does not cause toxicity and is completely effective in treating the clinical symptoms exhibited by a particular patient. The program should include careful selection of the active compound by consideration of such factors as the potency of the compound, relative bioavailability, patient weight, presence and severity of adverse side effects, mode of administration preferred and toxicity characteristics of the drug selected. In various aspects of these embodiments, the toxicity avoided is observable toxicity, substantial toxicity, severe toxicity, or acceptable toxicity, or dose-limiting toxicity (such as, but not limited to, MTD). Observable toxicity means that although changes are observed, the effect is negligible or slight. Substantial toxicity means a negative impact on the overall health or quality of life of the patient. In some cases, severe toxicity can be mitigated or addressed by other ongoing medical interventions. Severe toxicity means that the effect requires urgent medical intervention and/or dose reduction or therapeutic suspension. The acceptability of toxicity will be affected by the particular disease being treated and its severity and the availability to mitigate ongoing medical intervention. Toxicity and adverse events were sometimes graded according to a 5 point scale. Grade 1 or mild toxicity is asymptomatic or causes only mild symptoms; may be characterized only by clinical or diagnostic observations; and no intervention is indicated. Grade 2 or moderate toxicity may impair activities of daily living (e.g., preparing meals, shopping, managing money, using telephone, etc.), but only minor, local or non-invasive interventions are required. Grade 3 toxicity is medically significant, but not immediately life threatening; requiring hospitalization or extended hospitalization; daily activities associated with self-care, such as bathing, dressing and undressing, eating, toileting, taking medicine, and being bedridden, may be affected. Grade 4 toxicity is life threatening and requires urgent intervention. Grade 5 toxicity produces death associated with adverse events. Thus, in various embodiments, the disclosed therapeutic treatment regimen reduces the level of toxicity associated with the treatment by at least one level as compared to a similar effective dose (if achievable) used independently for either active ingredient (immunotherapeutic or immunomodulatory chemotherapeutic). Alternatively, in various embodiments, a therapeutic effect is achieved using the regimens of the disclosed combinations while producing a lesser level of toxicity than would be associated with dose limiting toxicity or one or the other of the desired active ingredients of the regimens. In other embodiments, the regimen using the disclosed combinations limits toxicity to grade 2 or less, grade 1 or less, or produces no observed toxicity.

While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Examples

The present invention is further illustrated by, but not limited to, the following examples illustrating the preparation of compounds of embodiments of the present invention.

Example 1

In vivo killing of tumor cells in immunocompetent mice using cyclophosphamide in combination with TLRL therapy

All BALB/c mice were maintained under specific pathogen free conditions and used between 6-16 weeks of age according to animal experimental guidelines established by the institutional animal care and use Commission. All experiments were approved by the institutional animal care and use committee and met relevant regulatory standards. C26 colon tumor cell line 5% CO₂Cultured in vitro and maintained in RPMI-1640 supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS) (Sigma), 100 units/mL penicillin and 100 μ g/mL streptomycin. C26 cells were injected s.c. at the back of 6 to 8 week old anesthetized mice. Tumor volume was measured along three orthogonal axes (x, y and z) and calculated as tumor volume ═ 2 (xyz). Mice were treated with i.p. injections of cyclophosphamide, i.v. injections of 1.6 μ g TLRL (resiquimod), or a combination of both treatments (once weekly, 3 administrations). The injection time points are shown in figure 1A. The observed tumor volumes are shown in fig. 1B. Combination therapy had greater effect in reducing tumor volume than either of the independent treatments (both of which were similar).

In separate experiments, mice were treated with i.v. injections of 1.6 μ g TLRL (resiquimod) or combination therapy with 1mg, 0.5mg, 0.25mg or 0.1mg cyclophosphamide (shown in figure 1C).

In separate experiments, mice were treated with i.v. injections of 3.2ug TLRL (resiquimod) or combination therapy with 1mg, 0.5mg, 0.25mg or 0.1mg cyclophosphamide (shown in figure 1D).

Example 2

Tumor isolation and immunohistochemistry

Balb/C mice (6-8 weeks old, female, purchased from vita River, Beijing) were injected s.c. into the back of anesthetized mice with C26 cells. When the tumor volume reaches 100-³Treatment was started with i.p. injection of cyclophosphamide or 1.6 μ g TLRL (resiquimod)D) i.v. injection or a combination thereof. On the day of the second treatment, tissue specimens of tumors were surgically removed from treated mice, fixed in 4% buffered formaldehyde for 24 hours, processed into paraffin, and then sectioned at 5 μm. For immunohistochemistry, tissue sections were deparaffinized and then antigen retrieval was performed in Tris-EDTA buffer (0.01M pH 9.0) at high temperature (water bath, 30 min at 98 ℃). After blocking of non-specific binding with 10% goat serum in PBS, primary anti-rat anti-mouse CD45 (purified clone #30-F11, eBioscience (TM), Thermofoisher, Cat #:14-0451-81) was applied at a concentration of 1. mu.g/mL and incubated overnight at 4 degrees. After 3 washes with PBS, a secondary goat antibody rat HPR was applied. Visualization was performed using standard DAB (3,3 '-diaminobenzidine) kit and H was used according to the manufacturer's recommended protocol&E, counterstaining the slices. Large number of CDs 45⁺The cells were infiltrated in the TLRL (resiquimod) or resiquimod/cyclophosphamide treated tumor microenvironment.

Example 3

Induction of Gene expression with IFN alpha in lymph nodes and spleen of mice treated with Cyclophosphamide or TLRL or combination therapy Can detect the systemic immune activation.

Balb/C mice (6-8 weeks old, female, purchased from vita River, Beijing) were injected s.c. into the back of anesthetized mice with C26 cells. When the tumor volume reaches 100-³Treatment was started at the beginning with i.p. injections of cyclophosphamide or i.v. injections of 1.6 μ g TLRL (resiquimod) or a combination thereof once a week. On the second day of the second treatment (i.e., day 8), the drainage LN and spleen were excised from the treated mice, and RNA was extracted using TRIzol reagent. After reverse transcription of the cDNA, quantitative real-time PCR was performed and IFN α -induced gene expression data were normalized to the geometric mean of two housekeeping genes (actin):

mouse actin: f: CATTGCTGACAGGATGCAGAAGG (SEQ ID NO. 1)

Mouse actin R: TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO. 2)

Mouse Mx 2F: CCTGCCTGCCATCGCTGTC (SEQ ID NO. 3)

Mouse Mx 2R: GCCTCTCCACTCCTCTCCCTCATT (SEQ ID NO. 4)

Mouse IRF 7F: TTGGGCAAGACTTGTCAGCA (SEQ ID NO. 5)

Mouse IRF 7R: ATACCCATGGCTCCAGCTTC (SEQ ID NO. 6)

Mouse ISG 15F: CAGCAATGGCCTGGGACCTAA (SEQ ID NO. 7)

Mouse ISG 15R: GGAAAGCCGGCACACCAATC (SEQ ID NO: 8).

Upregulation of the IFNa-inducible gene cluster was observed in TLRL (resiquimod) or resiquimod/cyclophosphamide treated C26 mice.