阅读说明：本技术 用于检测抗生素耐药基因的rpa试剂、装置及其检测方法 (RPA reagent and device for detecting antibiotic resistance gene and detection method thereof ) 是由 屠博文 薛银刚 毛旭建 杜强 唐宏兵 于 2021-02-01 设计创作，主要内容包括：本发明提供了用于检测抗生素耐药基因的RPA试剂、装置及其检测方法。用于检测抗生素耐药基因的RPA试剂,所述抗生素耐药基因为bla-(NDM)、bla-(KPC)、mcr、tetLR,所述试剂包括：用于检测bla-(NDM)耐药基因的试剂A、用于检测bla-(KPC)耐药基因的试剂B、用于检测mcr耐药基因的试剂C；还包括：用于检测tetL耐药基因的试剂D和用于检测tetR耐药基因的试剂E中的任意一种。本发明提供的试剂、装置和检测方法,采用常温扩增方式进行抗生素耐药基因的扩增和检测,能够完全脱离大型仪器设备的依赖,实现便携式小型化和移动化,符合环境样本检测中快速检测的需要。(The invention provides an RPA reagent, a device and a detection method for detecting antibiotic resistance genes. RPA reagent for detecting antibiotic resistance gene which is bla NDM 、bla KPC Mcr, tetLR, said agent comprising: for detecting bla NDM Reagent A for drug resistance gene detection of bla KPC A reagent B of a drug-resistant gene and a reagent C for detecting an mcr drug-resistant gene; further comprising: any one of a reagent D for detecting a tetL-resistant gene and a reagent E for detecting a tetR-resistant gene. According to the reagent, the device and the detection method provided by the invention, the amplification and detection of the antibiotic drug-resistant gene are carried out by adopting a normal-temperature amplification mode, the dependence on large-scale instruments and equipment can be completely eliminated, the portable miniaturization and the mobility are realized, and the requirement of rapid detection in environmental sample detection is met.)

1. An RPA reagent for detecting an antibiotic resistance gene, wherein the antibiotic resistance gene is bla_NDM、bla_KPCMcr, tetLR, said agent comprising: for detecting bla_NDMReagent A for drug resistance gene detection of bla_KPCA reagent B of a drug-resistant gene and a reagent C for detecting an mcr drug-resistant gene; further comprising: among reagent D for detecting tetL-resistant gene and reagent E for detecting tetR-resistant geneEither one of them.

2. The RPA reagent for detecting antibiotic resistance genes as claimed in claim 1, wherein said reagent A comprises primer pair and probe, specifically comprises any one of reagent A1 and reagent A2;

the reagent A1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 1;

a downstream primer: the sequence is shown as SEQ ID NO. 2;

and (3) probe: the sequence is shown as SEQ ID NO. 3;

the reagent A2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 4;

a downstream primer: the sequence is shown as SEQ ID NO. 5;

and (3) probe: the sequence is shown as SEQ ID NO. 6;

the reagent B comprises a primer pair and a probe, and specifically comprises any one of a reagent B1 and a reagent B2;

the reagent B1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 7;

a downstream primer: the sequence is shown as SEQ ID NO. 8;

and (3) probe: the sequence is shown as SEQ ID NO. 9;

the reagent B2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 10;

a downstream primer: the sequence is shown as SEQ ID NO. 11;

and (3) probe: the sequence is shown as SEQ ID NO. 12;

the reagent C comprises a primer pair and a probe, and specifically comprises any one of a reagent C1 and a reagent C2;

the reagent C1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 13;

a downstream primer: the sequence is shown as SEQ ID NO. 14;

and (3) probe: the sequence is shown as SEQ ID NO. 15;

the reagent C2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 16;

a downstream primer: the sequence is shown as SEQ ID NO. 17;

and (3) probe: the sequence is shown as SEQ ID NO. 18.

3. The RPA reagent for detecting antibiotic resistance genes according to claim 1, wherein the reagent D comprises a primer pair and a probe, specifically comprises any one of a reagent D1 and a reagent D2;

the reagent D1 includes:

an upstream primer: the sequence is shown as SEQ ID NO. 19;

a downstream primer: the sequence is shown as SEQ ID NO. 20;

and (3) probe: the sequence is shown as SEQ ID NO. 21;

the reagent D2 includes:

an upstream primer: the sequence is shown as SEQ ID NO. 22;

a downstream primer: the sequence is shown as SEQ ID NO. 23;

and (3) probe: the sequence is shown as SEQ ID NO. 24;

the reagent E comprises a primer pair and a probe, and specifically comprises any one of a reagent E1 and a reagent E2;

the reagent E1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 25;

a downstream primer: the sequence is shown as SEQ ID NO. 26;

and (3) probe: the sequence is shown as SEQ ID NO. 27;

the reagent E2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 28;

a downstream primer: the sequence is shown as SEQ ID NO. 29;

and (3) probe: the sequence is shown as SEQ ID NO. 30.

4. Use of the RPA reagent for detecting antibiotic resistance genes according to any one of claims 1 to 3 in the detection of antibiotic resistance gene environmental samples.

5. A simple device for detecting antibiotic resistance genes, comprising the RPA reagent for detecting antibiotic resistance genes according to any one of claims 1 to 3.

6. The simplified apparatus for detecting antibiotic resistance gene as claimed in claim 5, further comprising: the detection device comprises a transparent single-side viscous glass fiber membrane, a liquid-sealing PVC (polyvinyl chloride) sealing membrane, a detection sheet containing a microfluidic liquid pipeline and an opaque back membrane; the fluorescent reporter reagent is Alexa Fluor488 labeled goat anti-rabbit FAM antibody suspension, the antibody is diluted by 5% BSA PBS buffer solution according to a ratio of 1:200, Cy5 labeled goat anti-rabbit digoxin antibody is used as a positive control, and the negative control does not have any fluorescent reporter group.

7. The simple device for detecting antibiotic resistance genes according to claim 6, wherein the detection sheet containing the microfluidic liquid pipeline is formed by integrally pouring polydimethylsiloxane through a silicon wafer mold, and siloxane hydrophobic treatment is performed on the inner side of the PVC sealing membrane; the mobile phase liquid of the micro-fluidic microtube is silicone oil containing 2.5 percent of surfactant Span-80, and the dispersed phase is amplification liquid containing RPA reagent.

8. The simplified apparatus for detecting antibiotic resistance gene as claimed in claim 6, further comprising: a filter paper for extracting nucleic acid, wherein the filter paper is soaked by 10% sodium acetate and then dried, and the nucleic acid extraction reagent is a magnetic bead pure water suspension containing 0.1% sodium hydroxide.

9. Use of the simple device for detecting antibiotic resistance genes according to any one of claims 5 to 8 in the detection of antibiotic resistance gene environmental samples.

10. A detection method for detecting an antibiotic resistance gene, which is applied to the device according to any one of claims 5 to 9, characterized in that the steps comprise:

s1, a nucleic acid extraction process: adding 200 mu l of sample suspension into the sample hole, and simultaneously adding 100 mu l of double distilled water into the control hole; rotating 90 degrees anticlockwise, mixing the microfluidic mobile phase silicone oil with the sample, entering a cracking area, and cracking for 5 min; rotating clockwise by 90 degrees, allowing the mixed liquid to enter an acid neutralization bin, and performing neutralization reaction for 5 min; the detection sheet can be used for carrying out alkaline cracking and acid neutralization on the collected environmental nucleic acid sample, and extracting nucleic acid in a simple manner;

s2, nucleic acid purification process: placing the test piece in constant-temperature equipment at 37-42 ℃, rotating the device clockwise by 90 degrees, and automatically feeding neutralized liquid drops into a filtering area for filtering;

s3, RPA normal-temperature amplification: then the device is rotated 90 degrees anticlockwise, the mixed liquid is automatically fed into the RPA amplification area by a microfluidic mode, the normal temperature nucleic acid amplification is immediately carried out for 20min,

s4, result judgment: then, the device is rotated by 90 degrees clockwise, the product is subjected to fluorescence reporting, and whether the antibiotic drug resistance gene exists in the detection sample or not is judged visually;

and (3) a result judging method comprises the following steps: the experiment negative control group has no fluorescence, the positive control group has fluorescence, the detection is effective, and whether the 4 classes of antibiotic drug-resistant genes are contained is directly judged according to the fluorescence reaction of the corresponding sample holes.

Technical Field

The invention relates to the field of antibiotic drug-resistant gene detection, in particular to an RPA reagent, a device and a detection method for detecting antibiotic drug-resistant genes.

Background

With the popularity of antibiotic use, clinical microorganisms carrying multiple Antibiotic Resistance Genes (ARG) have become commonplace. The wide spread of antibiotic resistance genes ARGs inevitably leads to the flooding of drug-resistant bacteria in water, soil, air and animals and plants, and the common attention and action of all the parties are needed for controlling the antibiotic resistance situation. Compared with clinical situations, the research on drug-resistant microorganisms in the environment starts late, and the research scale and depth are insufficient. The rise and spread of drug-resistant microorganisms or antibiotic resistance genes is very rapid, and it has been reported that the biomass of drug-resistant microorganisms can reach exponential growth after 2 hours in a humid environment, while the horizontal spread of antibiotic resistance genes is also in hours. Therefore, the traditional microbial culture and gradient dilution drug sensitive detection is adopted, so that the time and labor are wasted, and the diffusion of drug-resistant microorganisms in the environment and the transmission of antibiotic resistance genes cannot be met.

In the conventional monitoring process, the mode of directly and effectively detecting the drug-resistant gene highly depends on large instruments such as PCR and the like, and the requirements of different samples for laboratory nucleic acid detection are different. The conventional monitoring of the gene type of the drug-resistant microorganisms in the environment is often carried out by matching with an environmental molecular test laboratory meeting the nucleic acid amplification requirement, and the configured environmental test laboratory is few. Recombinase Polymerase Amplification (RPA) is known as an alternative nucleic acid detection technique to PCR. The RPA technology is an emerging isothermal nucleic acid amplification technology which takes the nucleic acid replication mechanism of T4 bacteriophage as a basic principle and imitates the nucleic acid replication mechanism in cells.

The existing RPA technology has a plurality of application difficulties. LFD-RPA and EXO-RPA are used as main detection modes in the product, but the RPA product still depends on laboratory operation, has very high requirements on amplification reaction, and depends on a constant temperature amplification instrument and other necessary instruments. The requirement of field detection on an amplification system needs that a system preparation is separated from instrument dependence as much as possible, and currently, the RPA amplification reaction cannot adapt to different detection samples, is greatly influenced by the amplification environment and does not meet the requirement of field detection.

Disclosure of Invention

Aiming at the limitation of the field environment detection of the existing antibiotic drug-resistant gene and the incapability of meeting the requirements of quick, high-throughput, accurate and effective quick emergency analysis, the invention firstly establishes a recombinase polymerase amplification technology platform corresponding to the antibiotic drug-resistant gene and establishes bla_NDM、bla_KPCDetection method of resistance gene of mcr, tetLR antibiotic, bla_NDMThe exo-RPA normal temperature detection amplification is adopted, the other genes are detected by nfo-RPA normal temperature amplification, upstream and downstream primers and exo and nfo probes are respectively designed, and an RPA reagent, a simple device and a detection method for detecting antibiotic resistance genes are designed.

The first object of the present invention is to provide an RPA reagent for detecting an antibiotic resistance gene which is bla_NDM、bla_KPCMcr, tetLR, said agent comprising: for detecting bla_NDMReagent A for drug resistance gene detection of bla_KPCA reagent B of a drug-resistant gene and a reagent C for detecting an mcr drug-resistant gene; further comprising: any one of a reagent D for detecting a tetL-resistant gene and a reagent E for detecting a tetR-resistant gene.

bla_NDMThe gene is antibiotic resistance gene for generating metal beta lactamase NDM, and the related primer probe is according to sequence bla_NDM-1(KX999121.1)，bla_NDM-2(KU510393.1)，bla_NDM-3(JQ734687.1)，bla_NDM-4(KP772213.1)，bla_NDM-5(KP772211.1)，bla_NDM-6(NG049338.1)，bla_NDM-7(JX262694.1) and other 22 kinds of conserved sequences of different genotypes are designed as templates (synthesized by Shanghai bioengineering company), the length of a primer is controlled to be 30-35 bp, the probe is an exo type fluorescent probe of 45-52 bp, a tetrahydrofuran group THF (tetrahydrofuran) replaces an adenylate site, the distance from the 5 'end of the probe exceeds 30bp, and the distance from the 3' end of the probe is larger than 30bpAnd (3) replacing deoxythymine with FAM fluorescent group modified deoxythymine at the 5 'end and BHQ quenching group modified deoxythymine at the position of more than 15bp, wherein THF is separated by 1-3 bp, and the 3' end replaces deoxythymine with BHQ quenching group modified deoxythymine, so that the probe can be identified and cut by enzyme with DNA damage repair activity. Meanwhile, an nfo amplification system of the gene is designed, the length of a primer is 30-35 bp, a probe is a 45-52 bp nfo type fluorescent probe, a tetrahydrofuran group THF replaces an adenylic acid site, the distance from the tetrahydrofuran group THF to the 5 'end of the probe exceeds 30bp, the distance from the tetrahydrofuran group THF to the 3' end of the probe exceeds 15bp, the 5 'end is marked by a FAM group, and the 3' end is marked by a C3 blocking group, so that the probe can be identified by nfo enzyme and cut and repaired.

Preferably, the reagent A comprises a primer pair and a probe, and specifically comprises any one of a reagent A1 and a reagent A2;

the reagent A1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 1;

a downstream primer: the sequence is shown as SEQ ID NO. 2;

and (3) probe: the sequence is shown as SEQ ID NO. 3;

the reagent A2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 4;

a downstream primer: the sequence is shown as SEQ ID NO. 5;

and (3) probe: the sequence is shown as SEQ ID NO. 6;

bla_KPCthe gene is antibiotic resistance gene for producing carbapenemase KPC, and the primer probe reference sequence bla_KPC-1(AF297554.1)，bla_KPC-2(EF062508.1)，bla_KPC-3(AB557734.1)，bla_KPC-4(EU447304.1)， bla_KPC-5(NG_049259.1)，bla_KPC-6(EU555534.1) and the like, and the same conserved sequences of a total of 17 genotypes were designed (synthesized by shanghai bioengineering company). The 5' end of the downstream primer is marked by a biotin group, the probe is an nfo type probe of 48-55 bp, a tetrahydrofuran group THF replaces an adenylate site, the 5' end is marked by a FAM group, and the 3 ' end is marked by a C3 blocking group.

The reagent B comprises a primer pair and a probe, and specifically comprises any one of a reagent B1 and a reagent B2;

the reagent B1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 7;

a downstream primer: the sequence is shown as SEQ ID NO. 8;

and (3) probe: the sequence is shown as SEQ ID NO. 9;

the reagent B2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 10;

a downstream primer: the sequence is shown as SEQ ID NO. 11;

and (3) probe: the sequence is shown as SEQ ID NO. 12;

the MCR gene is related to polymyxin enzyme MCR, primer probes of the MCR gene are designed according to 10 kinds of conserved sequences of different genotypes such as MCR-1 (KY013597.1), MCR-2(MF176239.1), MCR-3(NG _056184.1), MCR-4(MK016505.1) and the like (the synthesis of Shanghai bioengineering company is entrusted), and a scheme of the primer and the probe is combined with bla_KPCThe same is true.

The reagent C comprises a primer pair and a probe, and specifically comprises any one of a reagent C1 and a reagent C2;

the reagent C1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 13;

a downstream primer: the sequence is shown as SEQ ID NO. 14;

and (3) probe: the sequence is shown as SEQ ID NO. 15;

the reagent C2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 16;

a downstream primer: the sequence is shown as SEQ ID NO. 17;

and (3) probe: the sequence is shown as SEQ ID NO. 18.

the tetLR gene is related to the production of tigecycline enzyme TET, the primer and probe of the tetLR gene are designed according to the sequence of tetL (JQ280448.2) and tetR (J01830.1) (the synthesis of Shanghai bioengineering company is entrusted), the scheme of the primer and probe and bla_KPCThe same is true.

Preferably, the reagent D comprises a primer pair and a probe, and particularly comprises any one of a reagent D1 and a reagent D2;

the reagent D1 includes:

an upstream primer: the sequence is shown as SEQ ID NO. 19;

a downstream primer: the sequence is shown as SEQ ID NO. 20;

and (3) probe: the sequence is shown as SEQ ID NO. 21;

the reagent D2 includes:

an upstream primer: the sequence is shown as SEQ ID NO. 22;

a downstream primer: the sequence is shown as SEQ ID NO. 23;

and (3) probe: the sequence is shown as SEQ ID NO. 24;

the reagent E comprises a primer pair and a probe, and specifically comprises any one of a reagent E1 and a reagent E2;

the reagent E1 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 25;

a downstream primer: the sequence is shown as SEQ ID NO. 26;

and (3) probe: the sequence is shown as SEQ ID NO. 27;

the reagent E2 comprises:

an upstream primer: the sequence is shown as SEQ ID NO. 28;

a downstream primer: the sequence is shown as SEQ ID NO. 29;

and (3) probe: the sequence is shown as SEQ ID NO. 30.

The second purpose of the invention is to provide the application of the RPA reagent for detecting antibiotic-resistant genes in the detection of antibiotic-resistant gene environmental samples.

The third purpose of the invention is to provide a simple device for detecting antibiotic resistance genes, which comprises the RPA reagent for detecting antibiotic resistance genes.

Preferably, the method further comprises the following steps: the detection device comprises a transparent single-side viscous glass fiber membrane, a liquid-sealing PVC (polyvinyl chloride) sealing membrane, a detection sheet containing a microfluidic liquid pipeline and an opaque back membrane; the fluorescent reporter reagent is Alexa Fluor488 labeled goat anti-rabbit FAM antibody suspension, the antibody is diluted by 5% BSA PBS buffer solution according to a ratio of 1:200, Cy5 labeled goat anti-rabbit digoxin antibody is used as a positive control, and the negative control does not have any fluorescent reporter group.

Preferably, the detection sheet is formed by integrally pouring polydimethylsiloxane through a silicon wafer mold, and siloxane hydrophobic treatment is carried out on the inner side of the PVC sealing film; the mobile phase liquid of the micro-fluidic microtube is silicone oil containing 2.5% of surfactant Span-80, and the dispersed phase is amplification liquid containing RPA reagent.

Preferably, the method further comprises the following steps: the filter paper for nucleic acid extraction is soaked by 10% sodium acetate and then dried, a filter paper sheet is cut and folded and placed at the position F, and a nucleic acid extraction reagent is a magnetic bead pure water suspension containing 0.1% sodium hydroxide.

In the simple device, the fluorescence reaction report area can specifically display positive and negative detection results. Following Recombinase Polymerase Amplification (RPA) amplification of each ARGs sample nucleic acid, the reactants will each carry a corresponding reporter. Because the 5 'end of the RPA probe is marked by FAM and the 5' end of the downstream primer is marked by biotin, when the RPA amplification result is positive, the RPA product can be combined with mouse anti-FAM monoclonal antibody marked by Alexa Fluor488, and is combined with avidin coated on the detection line after continuous diffusion, so that a specific fluorescent strip appears on the detection line (T line); the Alexa Fluor 488-labeled mouse anti-digoxin monoclonal antibody can be combined with the goat anti-mouse antibody coated on the quality control line, and a fluorescent band can also appear on the quality control line (C line). When the RPA amplification result is negative, the probe is combined by an anti-FAM antibody, but amplification does not occur, and the nucleic acid segment connected with the FAM group does not carry a biotin group and cannot be combined with T-line avidin, so that a fluorescent strip does not appear on a detection line (T line); meanwhile, the mouse anti-FAM monoclonal antibody marked by Alexa Fluor488 can be combined with the goat anti-mouse antibody, so that a band appears on a quality control line (C line).

In the simple device, a positive control reaction area uses a plasmid with KPC enzyme full-length gene as a template as a positive control, a corresponding primer and a probe system are used as positive reactants, the probe is labeled with digoxin at the 5' end, and a fluorescent report is carried out by using a Cy5 labeled anti-digoxin antibody. When the reaction proceeded smoothly, the amplified product in the positive control area was labeled with digoxin group at the 5' end, and after the combination of Cy5 labeled anti-digoxin antibody, red fluorescence was shown on the T detection line, and red fluorescence was also shown on the C line.

In the simple device, a negative control reaction zone only uses deionized and RPA amplification reagents to carry out reagent control experiments, and T line has no fluorescence report while C line has red fluorescence report to prove that the detection is reliable.

The RPA amplification is obviously different from the conventional PCR amplification reaction, the design of a primer probe of the RPA amplification system needs to be separated from the research scheme of a PCR amplification system, and the experiment is carried out according to the design principle of the RPA amplification primer and the probe. The length of the primer is controlled to be 30-35 bp; avoiding the long G sequence at the 5' end; g, C sequences are used as far as possible at the 3' end, and the length of the probe is controlled to be 46-52 bp; respectively modifying FAM fluorescent groups and shattering groups at the left and right sides of THF; the extension is prevented by adding a C-terminal block at the 3' end.

The fourth purpose of the invention is to provide an application of the simple device for detecting the antibiotic resistance gene in the detection of the antibiotic resistance gene environmental sample.

The fifth object of the present invention is to provide a detection method for detecting an antibiotic resistance gene, which is applied to the above-mentioned simple device, and comprises the steps of:

s1, a nucleic acid extraction process: adding 200 mu l of sample suspension into the sample hole, and simultaneously adding 100 mu l of double distilled water into the control hole; rotating 90 degrees anticlockwise, mixing the microfluidic mobile phase silicone oil with the sample, entering a cracking area, and cracking for 5 min; rotating clockwise by 90 degrees, allowing the mixed liquid to enter an acid neutralization bin, and performing neutralization reaction for 5 min; the detection sheet can be used for carrying out alkaline cracking and acid neutralization on the collected environmental nucleic acid sample, and extracting nucleic acid in a simple manner;

s2, nucleic acid purification process: placing the test piece in constant-temperature equipment at 37-42 ℃, rotating the device clockwise by 90 degrees, and automatically feeding neutralized liquid drops into a filtering area for filtering;

s3, RPA normal-temperature amplification: then the device is rotated 90 degrees anticlockwise, the mixed liquid is automatically fed into the RPA amplification area by a microfluidic mode, the normal temperature nucleic acid amplification is immediately carried out for 20min,

s4, result judgment: then, the device is rotated by 90 degrees clockwise, the product is subjected to fluorescence reporting, and whether the antibiotic drug resistance gene exists in the detection sample or not is judged visually;

the validity judging method comprises the following steps: when the positive hole T and the positive hole C generate fluorescence reaction and report positive, the negative hole T is negative, and the negative hole C is positive, the detection result is reliable. And directly judging whether the 4 classes of antibiotic resistance genes are contained according to the fluorescence reaction of the corresponding sample hole. The sample detection result judging method comprises the following steps:

and when the T line of the detection window corresponding to the antibiotic resistance gene is positive, the C line is positive, the positive control is positive, and the negative control group is negative, judging that the sample contains the corresponding antibiotic resistance gene fragment.

And when the T line of the sample detection window is free of fluorescence, the C is positive, the positive control is positive, and the negative control is negative, judging that the sample does not contain the corresponding antibiotic resistance gene fragment.

When the control group area has a wrong result, please re-test according to the following method.

Comparison test group discrimination method:

when the C line of the sample detection window is free of fluorescence, the detection area reagent is reminded of being expired, and the anti-FAM antibody needs to be retested when being invalid.

When the T line of the positive control detection window is not fluorescent, the detection piece RPA reagent is out of date or polluted, and the test needs to be performed again.

When the T line of the negative control detection window shows fluorescence reaction, the detection piece is prompted to be polluted by nucleic acid, and the detection piece is required to be replaced and retested.

The technical scheme of the invention has the following advantages:

the method adopts a normal-temperature amplification mode to amplify and detect the antibiotic drug-resistant gene, can completely separate from the dependence of large-scale instruments and equipment, realizes portable miniaturization and mobility, and meets the requirement of rapid detection in environmental sample detection.

RPA amplification is different from other nucleic acid detection, because of the complexity of ultra-long primers and probes, the design difficulty is extremely high, highly conserved sequences are difficult to select, and secondly, non-specific amplification cannot be effectively avoided in the normal-temperature amplification process, so the specificity requirement of an amplification binding region is far higher than that of conventional amplification (such as PCR), and finally, the sensitivity and the stability of an RPA amplification system are weaker than those of other amplification methods. The present invention strictly screens and tests amplification systems. The key to the success of RPA amplification is the selection of the conserved region of the target gene of the corresponding antibiotic resistance gene, and the sensitivity, repeatability and specificity of the primers and probes, so the designed primer and probe are the decisive factors for the effectiveness of the invention. The multiple primer probe systems related by the invention are verified and optimized through experiments.

The simple device provided by the invention is a totally-enclosed integrated chip module, after the sample suspension is added, the amplification and interpretation targets can be realized only by rotating and incubating at normal temperature according to requirements, the use is convenient, the carrying is convenient, the sheet type design is adopted, the simultaneous detection of a plurality of samples can be carried out, and the detection result is visualized.

According to the simple device provided by the invention, liquid is actively fed in a microfluidic mode without external force when flowing, and the purposes of nucleic acid extraction, DNA purification, RPA amplification and fluorescence result interpretation can be achieved only by rotating the detection sheet according to the specified flow. The invention combines the micro-fluidic technology with the RPA amplification of antibiotic drug-resistant genes for the first time.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a sectional view and a flowchart of a configuration method of a detection sheet in a simple apparatus for detecting antibiotic resistance genes according to an embodiment of the present invention;

FIG. 2 is a flowchart illustrating the operation of a simple apparatus for detecting antibiotic resistance genes according to an embodiment of the present invention;

FIG. 3 is a graph of a template gradient dilution experiment for different RPA amplification systems according to one embodiment of the present invention;

wherein A1-A4: experimental group RPND 1-4; p0: undiluted; p1: diluting by 10 times; 100 times of P2; p3: 1000 times; p4: 10000 times; p5: 100000 times;

FIG. 4 shows an experiment on the specificity of the RPA amplification system according to an embodiment of the present invention;

FIG. 5 is a repeated experiment of RPA amplification in an RPND1 amplification system according to an embodiment of the present invention;

FIG. 6 shows bla in an embodiment of the invention_NDMThe result of gene nfo amplification;

wherein, the concentration of the template decreases from left to right in each experimental group in turn, bla_NDMThe original copy number of the gene was 1.764X 10⁹copies/mL, initial concentration 40 ng/mL;

FIG. 7 shows bla in an embodiment of the invention_KPCThe result of gene nfo amplification;

wherein, the concentration of the template decreases from left to right in each experimental group in turn, bla_KPCThe original copy number of the gene was 1.803X 10⁹CopysCopys/mL, initial concentration 40 ng/mL;

FIG. 8 shows the result of amplification of ncr gene nfo in one embodiment of the present invention;

wherein, the template concentration of each experimental group is decreased from left to right, and the original copy number of the mcr gene is 1.922 multiplied by 10⁹CopysCopys/mL, initial concentration 40 ng/mL;

FIG. 9 shows the result of the amplification of the tfo gene of tetL in one embodiment of the present invention;

wherein the concentration of the template decreases from left to right in each experimental group, and the original copy number of the tetL gene is 1.271 × 10⁹CopysCopys/mL, initial concentration 40 ng/mL;

FIG. 10 shows the result of amplification of the tetR gene nfo in one embodiment of the present invention;

wherein, the concentration of the template decreases from left to right in turn for each experimental group, tetRThe original copy number of the gene was 1.061X 10⁹CopysCopys/mL, initial concentration 40 ng/mL;

FIG. 11 shows the results of the reproducibility of amplification of each group in one example of the present invention.

Detailed Description

The following description is made with reference to the accompanying drawings.

Example 1: design of upstream and downstream primers and exo and nfo probes for detecting antibiotic resistance genes

RPA reagent for detecting antibiotic resistance gene which is bla_NDM、bla_KPCMcr, tetLR, said agent comprising: for detecting bla_NDMReagent A for drug resistance gene detection of bla_KPCA reagent B of a drug-resistant gene and a reagent C for detecting an mcr drug-resistant gene; further comprising: any one of a reagent D for detecting a tetL-resistant gene and a reagent E for detecting a tetR-resistant gene.

bla_NDMThe gene is antibiotic resistance gene for generating metal beta lactamase NDM, and the related primer probe is according to sequence bla_NDM-1(KX999121.1)，bla_NDM-2(KU510393.1)，bla_NDM-3(JQ734687.1)，bla_NDM-4(KP772213.1)，bla_NDM-5(KP772211.1)，bla_NDM-6(NG_049338.1)，bla_NDM-7(JX262694.1) and other 22 conserved sequences of different genotypes are used as templates for designing, the length of a primer is controlled to be 30-35 bp, the probe is an exo fluorescent probe of 45-52 bp, a tetrahydrofuran group THF replaces an adenylate site, the distance from the 5 'end of the probe exceeds 30bp, the distance from the 3' end of the probe exceeds 15bp, the 5 'end of the position, 1-3 bp apart from THF, of the THF replaces deoxythymine with deoxythymine modified by FAM fluorescent groups, and the 3' end replaces deoxythymine with the deoxythymine modified by BHQ quenching groups, so that the probe can be identified by an enzyme with DNA damage repair activity and excised as an artificial base analogue. Simultaneously, designing an nfo amplification system of the gene, wherein the length of a primer is 30-35 bp, a probe is a 45-52 bp nfo type fluorescent probe, a tetrahydrofuran group THF (tetrahydrofuran) replaces an adenylic acid site, the distance from the tetrahydrofuran group THF to the 5' end of the probe exceeds 30bp, the distance from the tetrahydrofuran group THF to the 3 ' end of the probe exceeds 15bp, and the end of the tetrahydrofuran group 5' is provided with FA (alpha-fluorogenic amino acid)M group labeling, 3' end labeling with C3 blocking group, is a probe that can be recognized by nfo enzyme and cleaved for repair.

Preferably, the reagent A comprises a primer pair and a probe, and specifically comprises any one of a reagent A1 and a reagent A2;

the reagent A1 comprises:

an upstream primer: CTTATGCCAATGCGTTGTCGAACCAGCTTGCCC (SEQ ID NO: 1);

a downstream primer: Biotin-CCCAACGGTGATATTGTCACTGGTGTGGCC (SEQ ID NO: 2);

and (3) probe: 5' 6-FAM-CAACACAGCCTGACTTTCGCCGCCAATGGCTG

/idSp/GTCGAACCAGCAACCGCG-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

CAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCC (SEQ ID NO:3)；

the reagent A2 comprises:

an upstream primer: CATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCC (SEQ ID NO: 4);

a downstream primer: Biotin-CCCTGACGATCAAACCGTTGGAAGCGACTGCCC (SEQ ID NO: 5);

and (3) probe: 5' 6-FAM-AGCTCGCACCGAATGTCTGGCAGCACACTTCC

/idSp/ATCTCGACATGCCG-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

AGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGG(SEQ ID NO:6)；

bla_KPCthe gene is antibiotic resistance gene for producing carbapenemase KPC, and the primer probe reference sequence bla_KPC-1(AF297554.1)，bla_KPC-2(EF062508.1)，bla_KPC-3(AB557734.1)，bla_KPC-4(EU447304.1)， bla_KPC-5(NG_049259.1)，bla_KPC-6(EU555534.1), etc. in total of 17 genotypes. The 5' end of the downstream primer is marked by a biotin group, the probe is a 48-55 bp nfo type probe, a tetrahydrofuran group THF replaces an adenylate site, the 5' end is marked by a FAM group, and the 3 ' end is markedLabeled with a C3 blocking group.

The reagent B comprises a primer pair and a probe, and specifically comprises any one of a reagent B1 and a reagent B2;

the reagent B1 comprises:

an upstream primer: TGCCACCGCGCTGACCAACCTCGTCGCGGAAC (SEQ ID NO: 7);

a downstream primer: Biotin-AAGCCCTTGAATGAGCTGCACAGTGGGAAGCG (SEQ ID NO: 8);

and (3) probe: 5' 6-FAM-GACTTTGGCGGCTCCATCGGTGTGTACGCGATGGA

/idSp/ACCGGCTCAGGCGCAACTGTAAGTTA-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

GACTTTGGCGGCTCCATCGGTGTGTACGCGATGGATACCGGCTCAGGCGCAACTGT AAGTTA(SEQ ID NO:9)；

the reagent B2 comprises:

an upstream primer: AGGAGCGCTTCCCACTGTGCAGCTCATTCAAGGGCT (SEQ ID NO: 10);

a downstream primer: Biotin-TCATGCCTGTTGTCAGATATTTTTCCGAGATG (SEQ ID NO: 11);

and (3) probe: 5' 6-FAM-TGTGCTGGCTCGCAGCCAGCAGCAGGCCGGCTTGC

/idSp/GGACACACCCATCCGTTACGGCA-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

TGTGCTGGCTCGCAGCCAGCAGCAGGCCGGCTTGCTGGACACACCCATCCGTTAC GGCA(SEQ ID NO:12)；

the MCR gene is related to polymyxin enzyme MCR, primer probes of the MCR gene are designed according to 10 kinds of conserved sequences of different genotypes such as sequences MCR-1 (KY013597.1), MCR-2(MF176239.1), MCR-3(NG _056184.1), MCR-4(MK016505.1) and the like, and a primer and probe scheme and bla 016505.1 are combined_KPCThe same is true.

The reagent C comprises a primer pair and a probe, and specifically comprises any one of a reagent C1 and a reagent C2;

the reagent C1 comprises:

an upstream primer: CTAAAGCCTGTGTTGATTTTGCTATTAATCATGGG (SEQ ID NO: 13);

a downstream primer: Biotin-CCCAATCGGCGCATCAAACCCTTGCCCCAA (SEQ ID NO: 14);

and (3) probe: 5' 6-FAM-CGGTCTATGATACGACCATGCTCCAAAATGC

/idSp/CTACAGACCGACCAAGCCGAG-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

CGGTCTATGATACGACCATGCTCCAAAATGCCCTACAGACCGACCAAGCCGAG (SEQ ID NO:15)；

the reagent C2 comprises:

an upstream primer: AGACGCGGTACAAGCAACCAAGCCTGATATGCG (SEQ ID NO: 16);

a downstream primer: Biotin-TGGTCACGCCATCGATCTTGGCAAGCTGTGG (SEQ ID NO: 17);

and (3) probe: 5' 6-FAM-CGTCGTCGGTGAGACGGCACGCGCCGATCA

TGTCAGCTTCAATGGCTATGA-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

CGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGA(SEQ ID NO:18)。

the tetLR gene is related to the production of tigecycline enzyme TET, the primer and probe are designed according to the sequence of tetL (JQ280448.2) and tetR (J01830.1) gene, the scheme of the primer and probe is combined with bla_KPCThe same is true.

Preferably, the reagent D comprises a primer pair and a probe, and particularly comprises any one of a reagent D1 and a reagent D2;

the reagent D1 includes:

an upstream primer: TTAAAAGGTTACTCCTATTTGGGATTATAATA (SEQ ID NO: 19);

a downstream primer: Biotin-TATGGAGCCAATAAGACCAAACGCTTTACC (SEQ ID NO: 20);

and (3) probe: 5' 6-FAM-CTGGCTCGATTTATTCAAGGAGCTGGTGCAGC

/idSp/GCATTTCCAGCACTCGTG-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

CTGGCTCGATTTATTCAAGGAGCTGGTGCAGCTGCATTTCCAGCACTCGTG(SEQ ID NO:21)；

the reagent D2 includes:

an upstream primer: TTATTGGCTCCATAGTAGCTATGGGAGAAG (SEQ ID NO: 22);

a downstream primer: Biotin-AGTATAATTCCTTTGATATCAAAATGACCTT (SEQ ID NO: 23);

and (3) probe: 5' 6-FAM-TTCTACTCATTCCTATGATAACAATTATCACTGT

/idSp/CCGTTTCTTATGAAATTATTAA-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

TTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAAATTATTAA (SEQ ID NO:24)；

the reagent E comprises a primer pair and a probe, and specifically comprises any one of a reagent E1 and a reagent E2;

the reagent E1 comprises:

an upstream primer: GCTTGCACTTTATGCGTTAATGCAGGTTATCT (SEQ ID NO: 25);

a downstream primer: Biotin-CAAACGGCCTAAATACAGCATCCAAAGCGCACT (SEQ ID NO: 26);

and (3) probe: 5' 6-FAM-TCTGACCGATTTGGTCGGCGCCCAGTGCTGTTG

/idSp/TGTCATTAATAGGCGCATCGCTG-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

TCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGCGCATCGCTG (SEQ ID NO:27)；

the reagent E2 comprises:

an upstream primer: CATGAGCAAGGTGCTTTACAGGGATTATTG (SEQ ID NO: 28);

a downstream primer: Biotin-CTAAACCAATAATCCAAATCCAGCCATCCCA (SEQ ID NO: 29);

and (3) probe: 5' 6-FAM-GCAACCGGTGTTATTGGCCCATTACTGTTTAC

/idSp/GTTATTTATAATCATTCAC-3`C3-Spacer

Wherein, the nucleotide sequence corresponding to the probe:

GCAACCGGTGTTATTGGCCCATTACTGTTTACTGTTATTTATAATCATTCAC(SEQ ID NO:30)。

wherein,/idsp/: tetrahydrofuran modification; 5' 6-FAM: FAM fluorophore at the 5' end; 3' C3-Spacer: a 3' end blocking group; biotin-reverse primer 5' end Biotin labeling group

Example 2: validation of Exo amplification System

Amplification reaction system and amplification conditions: exo-1 probes were used for the experimental groups RPND1 and RPND2, and Exo-2 probes were used for the experimental groups RPND3 and RPND4, as shown in Table 1. The exo amplification reaction is monitored by a PCR instrument, and the amplification procedure is as follows: isothermal mode was set, 40 cycles of pre-amplification at 40 ℃ for 1.0min and amplification at 40 ℃ for 31 sec.

And (3) sensitivity test of an amplification system: marking plasmid DNA mother liquor carrying antibiotic drug-resistant gene as P0, diluting respectively by 10(P1), 100(P2), 1000(P3), 10000(P4) and 100000(P5) times, and finally preparing into gradient dilution template 2 × 10⁶、2×10⁵、2×10⁴、2×10³、2×10²And 20 copies/mL, respectively, in an RPA amplification experiment, which analyzes the detection limit of the RPA amplification system on the template DNA. The results are shown in FIG. 3.

And (3) specific test of an amplification system: and respectively carrying out amplification tests of the RPA system on salmonella, pseudomonas aeruginosa, shigella, staphylococcus aureus, serratia marcescens, vibrio parahaemolyticus and streptococcus haemolyticus with different drug-resistant phenotypes, comparing the amplification results with a positive plasmid experimental group, and evaluating the specificity of the RPA amplification system. The results are shown in FIG. 4.

And (3) repeatability test of an amplification system: and selecting an experimental group with higher sensitivity, respectively carrying out positive RPA repeated amplification experiments, respectively carrying out repeated amplification for 10 times, and evaluating the repeatability of the RPA amplification by analyzing the positive rate of the result. The results are shown in FIG. 5.

TABLE 1 Probe and primer pairs for Exo amplification systems

Note: i6 FAMdT/: FAM fluorophore-modified deoxythymine; [ solution ]/iBHQ 1 dT/: BHQ truncates group-modified deoxythymine; /idsp/: and (4) tetrahydrofuran modification.

As can be seen from FIG. 3, the primers and probes of the amplification system were subjected to gradient dilution and then subjected to RPA amplification detection, so that the 4 amplification systems showed better amplification curves in the N0 group, each amplification system still showed weak amplification signals in the N1 group, and the amplification results in the N2 group were negative. The result of RPA amplification with DNA template concentration gradient is 50-2.0 × 10²Positive amplification still occurred with copies/mL.

As can be seen from FIG. 4, 3 of the 4 sets of primers and probe amplification systems designed in this experiment exhibited good sensitivity and specificity. The detection limit reaches 200 DNA template copies, and is equivalent to PCR related products. bla_NDMThe RPA amplification of the gene also has excellent specificity, no cross reaction occurs, and trace bla can be accurately detected in the sample_NDMA gene.

As can be seen from FIG. 5, the RPA amplification reaction can be carried out at 35-45 ℃ and the requirements for amplification equipment are low. In addition, the RPA reaction can generate positive reaction within 2-7 min, so that the method has good application value in the field of rapid detection. And an RPN1 experimental group with sensitive amplification reaction is selected to carry out the repeatability verification of the RPA amplification reaction, and the repeatability is good.

Example 3: nfo verification of amplification System

Amplification reaction system and amplification conditions: using the primer set and the probe set described in example 1, the Bla-containing primer set and the probe set, respectively_NDM、 bla_KPCPlasmid sequences of mcr and tetLR genes were subjected to a mock amplification assay. The amplification reaction is carried out by adopting a PCR instrument, the amplification program is set to be in an isothermal mode, the pre-amplification is carried out for 1.0min at 40 ℃, and the amplification is carried out for 31sec at 40 ℃ for 40 cycles. Subsequently, 5. mu.l of the amplified product was pipetted into 95. mu.l of PBST to prepare a reaction dilution, which was inserted into a lateral flow strip containing anti-FAM antibody in a commercial kit and read within 5 min.

And (3) sensitivity test of an amplification system: marking the plasmid DNA mother liquor carrying antibiotic drug-resistant gene as 1, and respectively diluting 10, 100, 1000, 10⁴、10⁵、10⁶、10⁷、10⁸And 10⁹Doubling, finally preparing a gradient dilution reaction template, respectively carrying out RPA amplification experiments, and analyzing the RPA amplification system by the methodDetection limit for template DNA. The results are shown in Table 2.

And (3) specific test of an amplification system: and respectively carrying out amplification tests of the RPA system on Klebsiella pneumoniae, pseudomonas aeruginosa, Shigella, staphylococcus aureus and Serratia marcescens with different drug-resistant phenotypes, comparing the amplification results with a positive plasmid experimental group, and evaluating the specificity of the RPA amplification system. The results are shown in FIGS. 6-10.

And (3) repeatability test of an amplification system: and selecting amplification systems with higher sensitivity in the table 2, respectively carrying out positive RPA repeated amplification experiments, respectively carrying out repeated amplification for 10 times, and evaluating the repeatability of RPA amplification by analyzing the positive rate of the result.

TABLE 2 detection limit results for nfo amplification assay for different amplification systems

By bla_NDM、bla_KPCThe mcr and tetLR plasmids are used as test templates, pathogenic bacteria with different drug-resistant phenotypes are used as specificity controls, and cross reaction does not occur in amplification systems of all groups. As shown in FIG. 11, bla_NDM、bla_KPCIn the result of the repeatability verification of the mcr and tetLR plasmid templates, the system has better repeatability, and the positive rate reaches 100 percent. The retention time of RPA amplification of a sample is obviously reduced along with the increase of the concentration of a template, so that the higher copy number of antibiotic drug-resistant genes can be seen, and the positive reaction time can be obviously shortened.

The amplification products of each reaction are amplified by fluorescence using an Alexa Fluor 488-labeled anti-FAM antibody, and good effects are obtained. Wherein most of the amplification systems can detect that the sample only contains target gene sequences within 100 copies/mL after amplification for 15 min. The positive control group has strong fluorescence reaction effect and can meet the requirements of control experiments, while the double distilled water reagent experiment group cannot report fluorescence and can meet the requirements of the negative control experiment group.

Example 4: simple device for detecting antibiotic resistance gene

A simple device for detecting antibiotic-resistant genes, which comprises the RPA reagent for detecting antibiotic-resistant genes of example 1.

Preferably, the method further comprises the following steps: the detection device comprises a transparent single-side viscous glass fiber membrane, a liquid-sealing PVC (polyvinyl chloride) sealing membrane, a detection sheet containing a microfluidic liquid pipeline and an opaque back membrane; the fluorescent reporter reagent is Alexa Fluor488 labeled goat anti-rabbit FAM antibody suspension, the antibody is diluted by 5% BSA PBS buffer solution according to a ratio of 1:200, Cy5 labeled goat anti-rabbit digoxin antibody is used as a positive control, and the negative control does not have any fluorescent reporter group.

Preferably, the detection sheet is formed by integrally pouring polydimethylsiloxane through a silicon wafer mold, and siloxane hydrophobic treatment is carried out on the inner side of the PVC sealing film; the mobile phase liquid of the micro-fluidic microtube is silicone oil containing 2.5% of surfactant Span-80, and the dispersed phase is amplification liquid containing RPA reagent.

Preferably, the method further comprises the following steps: the filter paper for nucleic acid extraction is soaked by 10% sodium acetate and then dried, a filter paper sheet is cut and folded and placed at the position F, and a nucleic acid extraction reagent is a magnetic bead pure water suspension containing 0.1% sodium hydroxide.

In the simple device, the fluorescence reaction report area can specifically display positive and negative detection results. Following Recombinase Polymerase Amplification (RPA) amplification of each ARGs sample nucleic acid, the reactants will each carry a corresponding reporter. Because the 5 'end of the RPA probe is marked by FAM and the 5' end of the downstream primer is marked by biotin, when the RPA amplification result is positive, the RPA product can be combined with mouse anti-FAM monoclonal antibody marked by Alexa Fluor488, and is combined with avidin coated on the detection line after continuous diffusion, so that a specific fluorescent strip appears on the detection line (T line); the Alexa Fluor 488-labeled mouse anti-digoxin monoclonal antibody can be combined with the goat anti-mouse antibody coated on the quality control line, and a fluorescent band can also appear on the quality control line (C line). When the RPA amplification result is negative, the probe is combined by an anti-FAM antibody, but amplification does not occur, and the nucleic acid segment connected with the FAM group does not carry a biotin group and cannot be combined with T-line avidin, so that a fluorescent strip does not appear on a detection line (T line); meanwhile, the mouse anti-FAM monoclonal antibody marked by Alexa Fluor488 can be combined with the goat anti-mouse antibody, so that a band appears on a quality control line (C line).

In the simple device, a positive control reaction area uses a plasmid with KPC full-length gene as a template as a positive control, a corresponding primer and a corresponding probe system are positive reactants, digoxin is used for carrying out 5' end labeling on the probe, and a Cy5 labeled anti-digoxin antibody is used for carrying out fluorescence reporting. When the reaction proceeded smoothly, the amplified product in the positive control area was labeled with digoxin group at the 5' end, and after the combination of Cy5 labeled anti-digoxin antibody, red fluorescence was shown on the T detection line, and red fluorescence was also shown on the C line.

In the simple device, a negative control reaction zone only uses deionized and RPA amplification reagents to carry out reagent control experiments, and T line has no fluorescence report while C line has red fluorescence report to prove that the detection is reliable.

The RPA amplification is obviously different from the conventional PCR amplification reaction, the design of a primer probe of the RPA amplification system needs to be separated from the research scheme of a PCR amplification system, and the experiment is carried out according to the design principle of the RPA amplification primer and the probe. The length of the primer is controlled to be 30-35 bp; avoiding the long G sequence at the 5' end; g, C sequences are used as far as possible at the 3' end, and the length of the probe is controlled to be 46-52 bp; respectively modifying FAM fluorescent groups and shattering groups at the left and right sides of THF; the extension is prevented by adding a C-terminal block at the 3' end.

As shown in fig. 1, the simple visual RPA amplification detection device is prepared by the following steps:

preparing a black opaque PVC bottom plate at the bottom layer, cutting according to the thickness of (10cm multiplied by 18cm multiplied by 1.5mm), and polishing the edge for later use. Cutting a silicon wafer according to the thickness of (9.8cm is multiplied by 17.7cm is multiplied by 2mm), immersing the silicon wafer in concentrated sulfuric acid, heating and baking the silicon wafer in an oven at 120 ℃ for 30min, cooling the silicon wafer to room temperature, washing the silicon wafer with a large amount of water to remove sulfuric acid, cleaning the surface of the silicon wafer with alcohol, washing the silicon wafer with deionized water for 3-5 times, drying the silicon wafer with nitrogen, and heating and drying the silicon wafer in the oven to remove water.

Secondly, pressing the carved template on a silicon wafer, and cutting the silicon wafer by using laser to prepare a detection die containing holes and pipelines. Mixing Polydimethylsiloxane (PDMS) monomer and a cross-linking agent according to a ratio of 10:1, pouring into a silicon wafer mold, standing for 2h after vacuumizing, and placing into an 80-DEG oven for heating and balancing for 10 h.

And thirdly, peeling the well-cured PDMS sheet from the silicon wafer of the mold, and then punching and cutting so as to meet the experimental requirements. And one sides of the light-tight back plate and the PVC membrane facing the detection sheet are subjected to siloxane hydrophobic treatment. And then carrying out oxygen plasma bonding on the back plate and the PDMS detection sheet to finish the single-side sealing of the chip pipeline.

And fourthly, injecting silicon oil of 2.5 percent of surfactant Span-80 into the mobile phase notch, and bonding the PVC film and the PDMS detection sheet in an ion bonding manner by using the same bonding method as the back plate to realize the integral sealing of the chip. And then, the transparent protective adhesive film is pasted on the outer side of the PVC film, the sampling hole and the comparison hole are protected, and the simple device is installed.

The simple device has the following use method:

sample types: environmental sewage, animal and plant samples, garbage samples, surface swab samples, and the like.

Sampling requirement: and (5) carrying out sample collection under aseptic operation. The sample is diluted properly to be prepared into a turbid liquid or a semitransparent liquid state, the turbid liquid needs to be prepared for the solid sample, the reliability of the detection method can be influenced by the sample with more viscous and particulate matters, and proper grinding or dilution treatment is carried out. The pH value of the sample needs to be maintained within a range of 6.5-7.5, and the reliability of the detection method is obviously influenced by the peracid or the over-alkali.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.