阅读说明：本技术 治疗和预防hiv和aids的方法 (Methods for treating and preventing HIV and AIDS ) 是由 D·哈祖达 M·D·米勒 J·A·格罗布勒 D·A·尼科尔格里夫 于 2017-02-10 设计创作，主要内容包括：本发明涉及治疗和预防HIV和AIDS的方法。本发明涉及通过施用结构式(I)的化合物(I)或其药学上可接受的盐或共晶体,其中X为–F或–Cl,抑制HIV逆转录酶,治疗HIV感染,预防HIV感染,以及治疗、预防和/或延迟AIDS或ARC的发作或进展的方法,施用频率低于每日一次。(The present invention relates to methods for the treatment and prevention of HIV and AIDS. The invention relates to the use of compounds of formula (I) (I) Or a pharmaceutically acceptable salt or co-crystal thereof, wherein X is-F or-Cl, methods of inhibiting HIV reverse transcriptase, treating HIV infection, preventing HIV infection, and treating, preventing and/or delaying the onset or progression of AIDS or ARC less frequently thanIt is administered once daily.)

1. A unit dose of a compound of the formula:

or a pharmaceutically acceptable salt thereof, in the manufacture of an orally administrable medicament for inhibiting HIV reverse transcriptase, treating HIV infection, treating AIDS or ARC, or delaying the onset of AIDS or ARC in an individual, wherein the dosage regimen is once weekly, biweekly, twice monthly, or monthly and the unit dose contains from 1mg to 50 mg of the compound or pharmaceutically acceptable salt thereof for a once weekly dosing regimen, from 2 mg to 100 mg of the compound or pharmaceutically acceptable salt thereof for a once biweekly or twice monthly dosing regimen, and from 4 mg to 200 mg of the compound or pharmaceutically acceptable salt thereof for a once monthly dosing regimen.

2. The use of claim 1, wherein the subject is a human.

3. The use of claim 2, wherein the dosing regimen is once per week.

4. The use of claim 3, wherein the unit dose contains 1mg to 50 mg of the compound or pharmaceutically acceptable salt thereof.

5. The use of claim 3, wherein the unit dose contains 1mg to 20 mg of the compound or pharmaceutically acceptable salt thereof.

6. The use of claim 3, wherein the unit dose contains 1mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, or 10 mg of the compound or a pharmaceutically acceptable salt thereof.

7. The use of claim 2, wherein the dosing regimen is once every two weeks or twice a month.

8. The use of claim 7, wherein the unit dose contains from 2 mg to 100 mg of the compound or pharmaceutically acceptable salt thereof.

9. The use of claim 7, wherein the unit dose contains from 2 mg to 40 mg of the compound or pharmaceutically acceptable salt thereof.

10. The use of claim 7, wherein the unit dose contains 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, or 20 mg of the compound or a pharmaceutically acceptable salt thereof.

11. The use of claim 2, wherein the dosing regimen is once monthly.

12. The use of claim 11, wherein the unit dose contains from 4 mg to 200 mg of the compound or pharmaceutically acceptable salt thereof.

13. The use of claim 11, wherein the unit dose contains from 4 mg to 80 mg of the compound or pharmaceutically acceptable salt thereof.

14. The use of claim 11, wherein the unit dose contains 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, or 20 mg; 21mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg or 30 mg, 31mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg or 40 mg of the compound or a pharmaceutically acceptable salt thereof.

15. The use according to any one of claims 1 to 14 for the treatment of HIV infection, AIDS or ARC.

16. The use of any one of claims 1-14 for the treatment of HIV infection, AIDS, or ARC, wherein the compound is:

。

Background

Human immunodeficiency virus (HIV-1) infection is a serious disease state that, if left untreated, ultimately destroys the host immune system, leading to Acquired Immune Deficiency Syndrome (AIDS) and premature death. Despite advances in antiretroviral therapy (ART), HIV remains a global epidemic and a global public health priority. In 2012, 3500 ten thousand people were estimated to be infected with (live with) HIV (global report: uneds report about the global AIDS epidemic in 2013. uneds/JC 2502/1/E). In the united states, an estimated 120 million people are infected with HIV, and approximately 50,000 people become newly infected annually. Individuals seropositive for HIV are initially asymptomatic, but typically develop AIDS-related complex (ARC) followed by AIDS. Over 650,000 people in the united states die from AIDS, and an increase in over 14,000 deaths is reported annually. Treatment may help people with HIV live a longer, healthier life, but currently only 30% of people with HIV in the united states successfully have their virus controlled. (center for disease control and prevention. today HIV/AIDS epidemic. month 7 of 2015).

Nucleoside reverse transcriptase inhibitors (NRTIs or NsRTIs) inhibit HIV reverse transcriptase and block HIV replication. They are one of the class 6 HIV antiretroviral drugs (ARVs) used as components of an effective and durable multi-drug regimen that typically combines two NRTIs (or NRTI and NtRTI) with a non-nucleoside reverse transcriptase inhibitor, an integrase chain transfer inhibitor, or a protease inhibitor. Combination therapy maximizes treatment response and minimizes the emergence of drug resistance.

Since HIV replication is not simultaneous, antiretroviral agents need to be present in the patient continuously to effectively suppress viremia. For most drug classes, including protease inhibitors, integrase inhibitors, and non-nucleoside reverse transcriptase inhibitors, efficacy is determined by circulating drug concentration, and the aim of administration is to provide circulating drug concentrations (i.e., Cmin) that exceed those required to inhibit viral replication (i.e., IC50 or IC95) throughout the dosing interval. In contrast, upon entry into cells, NRTIs and nucleotide reverse transcriptase inhibitors (NtRTIs, such as tenofovir) enter the obligate intracellular anabolic pathway (obligate intracellular anabolic pathway) for conversion to the active phosphorylated form, and it is their intracellular half-life rather than plasma concentration that determines their sustained action. All currently approved NRTIs and NtRTIs are administered at least once daily.

4 '-ethynyl-2-fluoro-2' -deoxyadenosine (EFdA) is a nucleoside reverse transcriptase inhibitor that is useful in vitro (Kawamoto, a., Kodama, e., Sarafianos s. f. et al, int, j. biochem. Cell biol.;40(11):2410-20 [2008]ohrui, H., Kohgo, S., Hayakawa, H, et al,Nucleosides, Nucleotides & Nucleic Acids, 26, 1543-1546 [2007]) And in vivo (Hattori, S., Ide, K., Nakata, H. et al., antibodies, and Chemotherapy,53, 3887-3893 [2009]) Blocking HIV-1 and SIV virus replication.

U.S. Pat. No. 7339053 describes EFdA (referred to in the '053 patent as 2' -deoxy-4 '-C-ethynyl-2-fluoroadenosine) and 4' -ethynyl-2-chloro-2 '-deoxyadenosine (referred to herein as ECdA; referred to in the' 053 patent as 2-chloro-2 '-deoxy-4' -C-ethynyladenosine). EFdA and ECdA have the following chemical structures:

。

both compounds are metabolized in the cell to their active triphosphate synthetic metabolites, which inhibit HIV reverse transcriptase. In contrast to currently available NsRTIs and ntrtis (lacking 3'-OH groups to block incorporation of incoming nucleotides) for the treatment of HIV infection, EFdA and ECdA retain the 3' OH group and by blocking primers in the Reverse Transcriptase (RT) active site: translocation of the template, and prevention of incorporation of incoming deoxyribonucleotide triphosphates (dNTPs) acts as a chain terminator. Furthermore, it is believed that the folding of the modified ribose ring of EFdA and ECdA helps to inhibit reverse transcriptase by placing the 3' OH in the vector, where phosphate transfer from the incoming nucleotide is inefficient. (Michailidis E, et al, 4 '-ethynyl-2-fluoro-2' -deoxyadenosine triphosphate inhibits the mechanism of HIV-1 reverse transcriptase, J Biol Chem 284: 35681-35691 [2009]; Michailidis E, et al, 4 '-ethynyl-2-fluoro-2' -deoxyadenosine (EFdA) inhibits HIV-1 reverse transcriptase by multiple mechanisms, J Biol Chem 289: 243354-245648 [2014 ]).

EFdA is a potent antiretroviral drug in an in vitro HIV replication assay and exhibits comparable antiviral activity against clinical isolates in all subtypes that have been evaluated. It is rapidly anabolized to active triphosphate in vitro in both lymphoid derived cell lines and peripheral blood mononuclear cells, and the intracellular half-life of EFdA triphosphate (EFdA-TP) exceeds 72 hours. (Stoddart, C. A., Galkina, et al, oral administration of the nucleoside EFdA (4 '-ethynyl-2-fluoro-2' -deoxyadenosine) provided rapid suppression of HIV viremia in humanized mice, as well as favorable pharmacokinetic properties in mice and rhesus monkeys, Antimicrob Agents Chemother, 2015 Jul; 59(7): 4190-4198, disclosed online on 5/4/2015).

EFdA has been shown to have efficacy in animal models of HIV infection, including humanized mouse models and SIV-infected rhesus monkey models. Pharmacokinetic studies of orally administered EFdA in mice and macaques demonstrated rapid uptake and robust conversion of nucleosides to active triphosphates in Peripheral Blood Mononuclear Cells (PBMCs). Drug concentrations achieved in both humanized mice and rhesus monkeys were effective in inhibiting viremia when administered to HIV and SIV infected animals, respectively. PBMCs isolated from uninfected monkeys 24 hours after drug administration were resistant to SIV infection (supra).

The current combination of medications available for HIV infection act to suppress viremia, allowing the virus to be controlled. HIV drug therapy is life-long, and strict adherence to treatment regimens is critical to maintaining viral suppression, reducing the risk of drug resistance, and minimizing the risk of transmission. Effective and safe well-tolerated drugs that are easily taken at low dosing frequency have the potential to improve patient compliance and long-term treatment success. For the prevention of HIV infection, the only pre-exposure prophylaxis (PrEP) treatment approved by the U.S. food and drug administration that is currently available is TRUVADA (emtricitabine/tenofovir DF) for the prevention of HIV infection in uninfected persons.

Currently available orally administered antiretroviral drugs are administered once daily. Less frequent dosing may help alleviate the practical challenges and cumulative psychological effects of daily dosing of HIV drugs. Long-lasting ARTs may help patients to regain a greater sense of normality and provide flexibility, which may affect their way of living, working, traveling, interacting with others, and seeing themselves. Furthermore, the training of other chronic diseases requiring lifelong treatment, such as osteoporosis and type 2 diabetes, suggests that some patients adapt and may prefer once-a-week dosing regimens, which may lead to improved drug compliance relative to once-a-day dosing regimens.

By administering a single agent or a combination of agents, it is desirable to have additional prophylactic therapy options for people at risk of HIV infection. In addition, it is desirable to have an oral dosing option for HIV therapy (both treatment and prevention of HIV infection), which may be administered less frequently than daily dosing, to provide a further alternative to patients.

Summary of The Invention

The present invention relates to the use of 4 '-ethynyl-2-fluoro-2' -deoxyadenosine (EFdA) or 4 '-ethynyl-2-chloro-2' -deoxyadenosine (ECdA) for pre-exposure prevention (prap) treatment, i.e. EFdA or ECdA, or a pharmaceutically acceptable salt or co-crystal of either agent, for the prevention of HIV infection in an individual not infected with HIV, said individual being at risk of said infection. Prophylactic treatment can be by any route or method of administration, including but not limited to oral, parenteral, or administration using implantable compositions or devices.

The invention also includes treating an individual infected with HIV by parenteral administration of an EFdA or an ecla, or a pharmaceutically acceptable salt or co-crystal of either agent, using a once weekly or less frequent dosing regimen. It also includes treating an HIV-infected individual by administering an EFdA or ECdA using an implantable composition or device that is implanted into the individual once a week or less frequently to deliver an active agent during the time interval from one implantation to the next.

The invention further relates to orally administering to a subject an EFdA or an ecla, or a pharmaceutically acceptable salt or co-crystal of either agent, using an oral dosing regimen for HIV therapy, wherein the EFdA or ecla is administered less frequently than once daily. For example, the EFdA or ECdA can be administered orally in a dosage regimen of twice weekly, once biweekly, twice monthly or once monthly for the inhibition of HIV reverse transcriptase, the treatment of HIV infection, the prevention of HIV infection, and the prevention, treatment and/or delay in the onset or progression of AIDS and/or ARC.

Description of the drawings

Figure 1 is a graph of the viral load changes in SIV-infected monkeys from the "weekly efficacy in HIV-infected SIV-infected macaque model" study described in example 1.

Figure 2 is a graph (linear scale) of the mean PBMC concentration versus time curve of EFdA Triphosphate (TP) after 3 weeks of administration of once weekly oral doses of EFdA to healthy fasted subjects (lower, semi-logarithmic graph).

Fig. 3 is a graph of mean EFdA plasma concentration versus time curves (linear scale, first 24 hours post dose) after 3 weeks of once weekly oral dose administration of EFdA to healthy fasted subjects (lower, semi-logarithmic graph) (N =6, LOQ = 3.41 nM).

Detailed Description

One embodiment of the present invention, referred to herein as embodiment A, relates to a method of preventing HIV infection comprising administering to an HIV-uninfected individual an effective amount of a compound of structural formula I

Or a pharmaceutically acceptable salt or co-crystal thereof, wherein X is-F or-Cl. An effective amount of the compound can be administered to an individual once daily, twice weekly, once weekly, biweekly, twice monthly or once monthly or at less frequent intervals, such as once quarterly, twice annually or once annually, for the prevention of HIV infection. In one aspect of this embodiment, an effective amount of the compound can be administered to a subject using a dosing regimen in which a compound of formula I, or a pharmaceutically acceptable salt or co-crystal thereof, is administered to a subject less frequently than once daily.

For prophylactic use against HIV infection in uninfected individuals, the compound of formula I or a salt or co-crystal thereof may be administered by any means that causes the active agent to come into contact with the site of action of the agent. They can be administered as individual prophylactic agents or combinations of prophylactic agents by conventional means available for use with drugs. They may be administered alone, but are generally administered with a pharmaceutical carrier selected based on the chosen route of administration and standard pharmaceutical practice. The compounds of formula I may be administered, for example, orally (e.g., by tablet or capsule), parenterally (including subcutaneous, intravenous, intramuscular, or intrasternal injection, or other infusion techniques), or by inhalation spray, in the form of one or more unit dose pharmaceutical compositions containing an effective amount of the compound, alone or in combination, and conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles for the prevention of HIV infection. The compounds of formula I may also be administered parenterally by implantable drug delivery compositions or devices adapted to provide an effective amount of the compound over an extended period of time.

Solid formulations suitable for oral administration (e.g., powders, pills, capsules, and tablets) can be prepared according to techniques known in the art, and can use solid excipients such as starches, sugars, kaolin, lubricants, binders, disintegrants, and the like. Liquid preparations suitable for oral administration (e.g., suspensions, syrups, elixirs and the like) can be prepared according to techniques known in the art and can employ any of the usual media, such as water, glycols, oils, alcohols and the like. For oral administration, solid dosage forms, in particular tablets, are preferred.

Parenteral compositions of the compounds of formula I may be prepared according to techniques known in the art and typically employ sterile water as a carrier and optionally other ingredients such as stabilizers and/or dissolution aids. Injectable solutions or suspensions may be prepared according to methods known in the art, for example, in which the carrier comprises saline solution, dextrose solution, or a solution containing a mixture of saline and dextrose. Implantable compositions can also be prepared according to methods known in the art, for example, wherein the carrier comprises the active chemical ingredient and a suitable excipient (e.g., a polymer), or using an implantable device for drug delivery.

Further description of processes suitable for preparing Pharmaceutical compositions having compounds of formula I and ingredients suitable for use in such compositions are provided in The Remington's Pharmaceutical Sciences, 18 th edition, edited by A.R. Gennaro, Mack Publishing Co., 1990 and Remington-The Science and Practice (Remington-The Science and Practice of Pharmacy), 22 th edition, published by Pharmaceutical Press and Philadelphia College of Pharmacy at University of The Sciences 2012, ISBN 978085711-6 and previous versions. Parenteral formulations are described, for example, in Wright, Jeremy c, and Burgess, Diane j, (editorial) long acting injections and implants (advances in the science of delivery) ((Long Acting Injections and Implants(Advances in Delivery Science services)), Springer New York-Dordrecht-Heidelberg-London, 2012, Print.

In one aspect of embodiment a, the compound of formula I may be administered for prevention of HIV infection using any suitable dosing regimen, such as, but not limited to, once daily, twice weekly, once biweekly, twice monthly, once quarterly, twice annually, or once annually. In another aspect, a unit dose of a compound of formula I may be administered twice weekly, once biweekly, twice monthly, once quarterly, twice annually, or once annually for the prevention of HIV infection. In another aspect of embodiment a, the compound of formula I may be administered once a week, once every two weeks, twice a month, once a quarter (i.e., once every 3 months), twice a year (i.e., once every 6 months), or once a year.

In another aspect of embodiment a, wherein in addition to the dosing regimens described above, the compound of formula I may be administered parenterally using a less frequent dosing regimen, such as, but not limited to, once every 18 months or once every two years (bi-annual or once every one year).

Typically, the dosage at each administration at each time interval will increase with increasing time interval between each administration.

The preferred method or route of administration may also vary depending on the time interval between doses in the dosage regimen. For example, an effective amount of a compound of formula I for prophylactic use can be administered orally at intervals such as, but not limited to, once daily, twice weekly, once biweekly, twice monthly or once monthly. While one unit dose is preferably administered orally at each dosing interval, one or more oral unit doses can be administered at each dosing interval as needed to deliver the appropriate amount of active agent.

Alternatively, an effective amount of a compound of formula I for prophylactic use may be administered parenterally, for example, but not limited to, once a week, once every two weeks, twice a month, once a quarter, twice a year, once a year, or at longer intervals, for example, but not limited to, once every 18 months or once every two years. The longer the interval between each administration of the active agent, the larger the active dose that may be required for each administration. Thus, one or more unit doses may be administered as needed to deliver an appropriate amount of active agent, e.g., one or more injections or infusions of the compound of formula I, or one or more implant compositions or devices, at each dosing interval.

Any dosage regimen for prophylactic use may be a continuous dosage regimen or an intermittent dosage regimen.

For prophylactic treatment, the amount of EFdA or ECdA in a unit dose may be from 0.1 mg to 500 mg; or 0.1 to 400 mg or more, for use in longer interval dosage regimens. The dosage of each unit dose will vary depending upon the time interval between doses in the dosage regimen.

Another embodiment of the present invention, referred to herein as embodiment B, is directed to methods of inhibiting HIV reverse transcriptase, treating or preventing infection by HIV in a subject in need thereof, including treating or preventing viremia, and treating, preventing and/or delaying the onset or progression of AIDS or ARC, using a dosing regimen wherein a compound of formula I, or a pharmaceutically acceptable salt or co-crystal thereof, is administered orally to the subject less frequently than once daily. Typically, the dosage at each administration at each time interval will increase with increasing time interval between each administration.

The EFdA or ECdA, optionally in salt or co-crystal form, can be administered orally by any means that causes the active agent to come into contact with the site of action of the agent. The compounds may be administered orally as individual therapeutic agents or combinations of therapeutic agents in a conventional manner useful with pharmaceuticals. It may be administered alone, but is typically administered with an orally administered pharmaceutical carrier of choice, containing an effective amount of the compound and one or more conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles. Solid formulations suitable for oral administration, such as, but not limited to, tablets, capsules, powders, pills, can be prepared according to techniques known in the art, and solid excipients, such as starches, sugars, kaolin, lubricants, binders, disintegrants and the like can be used. Liquid preparations suitable for oral administration (e.g., suspensions, syrups, elixirs and the like) can be prepared according to techniques known in the art and can employ any of the usual media, such as water, glycols, oils, alcohols and the like. For oral administration, solid dosage forms, in particular tablets, are preferred.

One aspect of embodiment B is a method of inhibiting HIV reverse transcriptase, treating HIV infection, including treating or preventing HIV viremia, and treating, preventing and/or delaying the onset or progression of AIDS or ARC in an HIV-infected individual, comprising orally administering to the individual an effective amount of EFdA or ECdA as a unit dose, wherein the dosing interval of the dosing regimen ranges from about once every 3 days to about once every 30 days (i.e., once a month). Examples of dosing regimens for oral administration of an EFdA or ECdA useful in the methods include twice weekly dosing, once biweekly dosing, twice monthly dosing, and once monthly dosing. The selected dosing regimen will use a dosage per administration suitable to provide a delay in the treatment of HIV infection, AIDS or ARC, the prevention of AIDS or ARC, and/or the onset or progression of AIDS or ARC during each administration to the next time interval.

In another aspect of this embodiment, the dosing regimen is a continuous dosing regimen. Generally, for the treatment of HIV infection or AIDS, the treatment or prevention of viremia, and the prevention of the onset or progression of AIDS or ARC in HIV-infected individuals, the selected continuous dosing regimen is maintained as long as a therapeutic effect is needed or desired.

For the treatment of HIV-infected patients, maintaining inhibition of viremia is a desirable goal. To achieve this, it is preferred to administer the EFdA or the ECdA using a continuous dosage regimen in combination with the administration of one or more additional anti-HIV agents, as long as HIV viremia is effectively inhibited without recurrence of viremia.

Another aspect of embodiment B is a method of preventing HIV infection in an individual not infected with HIV, the method comprising orally administering to the individual an effective amount of an EFdA or an ecla as a unit dose, wherein the dosing interval of the dosing regimen ranges from about once every 3 days to about once every 30 days. Examples of dosing regimens for preventing HIV infection that can be used for oral administration of EFdA or ECdA include twice weekly dosing, once biweekly dosing, twice monthly dosing, and once monthly dosing. In one aspect of this embodiment, the dosage regimen is a continuous dosing regimen. In another aspect of this embodiment, the dosage regimen is an intermittent dosing regimen.

To prevent HIV infection in uninfected individuals, EFdA or ECdA may be administered orally using one or more of the dosing regimens described herein (e.g., twice weekly, once biweekly, twice monthly, and once monthly) using a continuous dosing regimen or an intermittent dosing regimen, as long as it is necessary or desirable to prevent or reduce the risk of HIV transmission. The selected dosing regimen will use a dosage per administration that is appropriate to provide a prophylactic effect during the time interval from each administration to the next.

While one unit dose is preferably administered orally at each dosing interval, one or more oral unit doses can be administered at each dosing interval as needed to deliver the appropriate amount of active agent.

For an intermittent dosing regimen for preventing HIV infection in an uninfected individual, adherence to the dosing regimen for a single period (e.g., one dose per week of a once-weekly dosing regimen) or adherence to the dosing regimen for a continuously repeating period (e.g., one dose per week for 3 weeks with a once-weekly dosing regimen) may be followed by a period of no dosing followed by another period with a dosing regimen. Examples of intermittent dosing regimens for preventing HIV infection include, but are not limited to, administering an effective dose of EFdA or ECdA once a week for 1 or 2 weeks, then not administering for 1 or 2 months, then restarting administration of EFdA or ECdA once a week for 1 or 2 weeks. The total period of time that an individual may use an intermittent dosing regimen may be, for example, from about 1 week to the remaining life of the patient, wherein the frequency of dosing regimens over the period of time in which they are used is less than once daily dosing, as described herein.

For oral (e.g., tablet or capsule) administration, the dosage units may each contain 0.1 mg to 500 mg; or 0.1 to 400 mg of EFdA or ECdA. The dosage per unit dose will vary depending upon the time interval between doses in the dosage regimen. Examples of the amount of the unit dose of EFDA or a pharmaceutically acceptable salt or co-crystal thereof include, but are not limited to, the following.

For the twice weekly dosing schedule: each unit dose may contain EFdA or ECdA in an amount of 0.5 mg to 25 mg, alternatively 0.5 mg to 10 mg; or more specifically 0.5 mg, 1mg, 2 mg, 3 mg, 4 mg or 5 mg.

For once weekly dosing schedule: each unit dose may contain EFdA or ECdA in an amount of 1mg to 50 mg, alternatively 1mg to 20 mg; or more specifically 1mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg or 10 mg.

For a biweekly or twice monthly dosing regimen: each unit dose may contain EFdA or ECdA in an amount of 2 mg to 100 mg, alternatively 2 mg to 40 mg; or more specifically 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg or 20 mg.

For a once monthly dosing schedule: each unit dose may contain EFdA or ECdA in an amount of 4 mg to 200 mg, alternatively 4 mg to 80 mg; or more specifically 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg or 20 mg; 21mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg or 30 mg, 31mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg or 40 mg.

The dose of ECdA can be about 2-4 times higher than the dose of EFdA.

When EFdA or ECdA is administered in salt or co-crystal form, reference to the amount of compound in milligrams or grams is based on the weight of the compound in free form (i.e. not in salt or non-co-crystal form).

The minimum dose of EFdA or ECdA will vary with the dosing regimen and whether the intended use is for the treatment and/or prevention of HIV infected individuals or for the prevention of non-HIV infected individuals. A non-limiting example of once weekly oral administration for an individual infected with HIV is a unit dose comprising about 10 mg EFdA or ECdA for the treatment and/or prevention of a disease state as described above. A non-limiting example of a once weekly oral administration for preventing HIV infection in an uninfected individual is a unit dose comprising about 2 mg of EFdA or ECdA.

Another embodiment of the present invention, referred to herein as embodiment C, is directed to methods of inhibiting HIV reverse transcriptase, treating HIV infection, including treating viremia, and treating, preventing and/or delaying the onset or progression of AIDS or ARC, using a dosing regimen by parenterally administering to an HIV-infected individual an effective amount of a compound of formula I, or a pharmaceutically acceptable salt or co-crystal thereof, wherein the compound is administered parenterally at a frequency of less than once daily.

The compounds of formula I can be administered parenterally in unit dosage pharmaceutical compositions containing an effective amount of the compound and conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles for the treatment of HIV-infected individuals, including subcutaneous injections, intravenous, intramuscular or intrasternal injections, or other infusion techniques (one or more injections or infusions can be administered as needed to deliver appropriate amounts of the active agent at each dosing interval) or by inhalation spray. The compounds of formula I may also be administered parenterally by implantable drug delivery compositions or devices adapted to provide an effective amount of the compound over an extended period of time. The preparation of a parenteral composition for use in individuals not infected with HIV as described above (see embodiment a) is equally applicable to the preparation of a parenteral composition for use in the treatment of HIV-infected individuals. HIV-infected individuals should be treated using a continuous dosing regimen.

In one aspect of embodiment C, a unit dose of an effective amount of a compound of formula I may be administered parenterally at intervals such as, but not limited to, once a week, once every two weeks, twice a month, once a quarter, twice a year, or once a year, or at longer intervals such as, but not limited to, once every 18 months or once every two years.

In another aspect of embodiment C, the compound may be administered parenterally at monthly, quarterly, twice annually, or yearly intervals.

The longer the interval between each administration of the active agent, the larger the active dose that may be required for each administration. Thus, one or more unit doses may be administered as needed to deliver an appropriate amount of active agent per dosing interval, e.g., one or more injections or infusions or one or more implant compositions or devices comprising a compound of formula I.

The invention, including all embodiments, aspects and descriptions set forth herein, also relates to the use of an EFdA or an ECdA administered with one or more anti-HIV agents in a dosing regimen as described above. An "anti-HIV agent" is any agent that is effective, directly or indirectly, in inhibiting HIV, treating or preventing infection by HIV, and/or treating, preventing or delaying the onset or progression of AIDS or ARC. It is understood that anti-HIV agents are effective in treating, preventing, or delaying HIV infection or the onset or progression of AIDS and/or a disease or condition caused thereby or associated therewith. For example, the compounds of formula I may be administered effectively in combination with an effective amount of one or more other anti-HIV agents selected from HIV antivirals, immunomodulators, anti-infectives, or vaccines useful in the treatment of HIV infection or AIDS, whether during the pre-and/or post-exposure period.

The invention includes pharmaceutical compositions comprising an effective amount of an EFdA or an ecla and a pharmaceutically acceptable carrier. The compositions may comprise an EFdA or an ecla as the sole active ingredient or may comprise one or more additional active ingredients. Accordingly, the invention also includes pharmaceutical compositions comprising an effective amount of an EFdA or an ecla and a pharmaceutically acceptable carrier, said pharmaceutical compositions further comprising an effective amount of one or more other anti-HIV agents selected from one or more of an HIV antiviral agent, an immunomodulatory agent, and an anti-infective agent. In this embodiment, the anti-HIV agent is an antiviral agent selected from one or more of an HIV protease inhibitor, an HIV reverse transcriptase inhibitor, an HIV integrase inhibitor, an HIV fusion inhibitor, an HIV entry inhibitor, and an HIV maturation inhibitor.

Suitable HIV antivirals for use in combination with the compounds of the present invention include, but are not limited to, for example, those listed in table a.

Table a: antiviral agents for the treatment of HIV infection or AIDS

Name (R)	Type (B)
		Abacavir, ABC and Ziagen	nRTI
Abacavir + lamivudine, Epzicom	nRTI
		Abacavir, lamivudine, zidovudine and Trizivir	nRTI
Amprenavir, Agenerase-	PI
		Atazanavir, Reyataz	PI
AZT, zidovudine, azidothymidine, Retrovir	nRTI
		Capivirine	nnRTI
Darunavir, Prezista	PI
		ddC, zalcitabine, dideoxycytidine and Hivid	nRTI
ddI, didanosine, dideoxyinosine, Videx-	nRTI
		ddI (enteric coating), Videx EC-	nRTI
Delavadine, DLV, Rescriptor-	nnRTI
		Korokitevir, Tivicay-	InI
doravirine, MK-1439	nnRTI
		Efavirenz, EFV, Sutiva and Stocrin-	nnRTI
Efavirenz + emtricitabine + tenofovir DF, Atriplatin-	nnRTI + nRTI
		Etivagivir	InI
Emtricitabine, FTC, Emtriva-	nRTI
		Emtricitabine + tenofovir DF, Truvada-	nRTI
emvirine, Coactinon®	nnRTI
		Enfuvirdi, Fuzeon-	FI
Enteric coated didanosine, Videx EC-	nRTI
		Etravirine, TMC-125	nnRTI
Fosrenavir calcium and Lexiva granules	PI
		Dinavir indene, Crixivan-	PI
Lamivudine, 3TC, Epivir-	nRTI
		Lamivudine + zidovudine, Combivir	nRTI
Lopinavir	PI
		Lopinavir + ritonavir, Kaletra-	PI
Malavirus, Selzentry-	EI
		Nelfinavir, Viracept-	PI
Nevirapine, NVP, Viramune	nnRTI
		PPL-100 (also known as PL-462) (Ambrilia)	PI
Letergevir, MK-0518, IsentressTM	InI
		Rilpivirine	nnRTI
Ritonavir, Norvir-	PI
		Saquinavir, Invirase, Fortovase ® granules	PI
Stavudine, d4T, didehydro deoxythymidine, Zerit ® granules	nRTI
		Tenofovir DF (DF = dipyridamole fumarate), TDF, Viread ®	nRTI
Tenofovir alafenamide fumarate, TAF	nRTI
		Tiranavir, Aptivus-	PI
vicriviroc	EI

EI = entry inhibitor; FI = fusion inhibitor; InI = integrase inhibitor; PI = protease inhibitor; nRTI = nucleoside reverse transcriptase inhibitors; nnRTI = non-nucleoside reverse transcriptase inhibitors. Some of the drugs listed in table a were used in the form of salts; for example, abacavir sulfate, delavirdine mesylate, indinavir sulfate, atazanavir sulfate, nelfinavir mesylate, saquinavir mesylate.

It is to be understood that the scope of combinations of the compounds of formula I with anti-HIV agents is not limited to the HIV antivirals listed in table a, but in principle includes any combination with any pharmaceutical composition useful in the treatment and/or prevention of HIV and AIDS. HIV antivirals and other agents are commonly used in these combinations in their conventional dosage ranges and regimens as reported in the art, including, for example, the dosages described in physician's Desk Reference, Thomson PDR, 57 th edition (2003), 58 th edition (2004), or 59 th edition (2005) and physician's Desk Reference (68 th edition) (2014), Montvale, NJ: PDR Network. In these combinations, the dosage ranges of the compounds of the invention may be the same as those listed above.

The invention also includes an EFdA or ECdA for use in the preparation of a medicament useful for any one or more of inhibiting HIV reverse transcriptase, treating HIV infection, preventing HIV infection, or treating, preventing and delaying the onset or progression of AIDS or ARC in a subject in need thereof. It further comprises administering an EFdA or ECdA in combination with one or more other anti-HIV agents selected from one or more of an HIV antiviral agent, an immunomodulator and an anti-infective agent, for the manufacture of a medicament for any one or more of inhibiting HIV reverse transcriptase, treating HIV infection, preventing HIV infection, treating AIDS, or preventing or delaying the onset or progression of AIDS in an individual in need thereof. In this embodiment of the invention, the anti-HIV agent is an antiviral agent selected from one or more of an HIV protease inhibitor, an HIV reverse transcriptase inhibitor, an HIV integrase inhibitor, an HIV fusion inhibitor, an HIV entry inhibitor, and an HIV maturation inhibitor.

Another embodiment of the present invention encompasses the methods, pharmaceutical compositions, medicaments, uses and combinations set forth herein wherein the HIV of interest is HIV-1. Thus, for example, in any of the methods, pharmaceutical compositions, medicaments, uses and combinations using the dosage regimens set forth herein, EFdA or ECdA is used in an amount effective against HIV-1; when used in combination with one or more anti-HIV agents, each additional anti-HIV agent is an HIV-1 antiviral agent selected from one or more of an HIV-1 protease inhibitor, an HIV-1 reverse transcriptase inhibitor, an HIV-1 integrase inhibitor, an HIV-1 fusion inhibitor, an HIV-1 entry inhibitor, or an HIV-1 maturation inhibitor.

EFdA and/or ECdA can also exhibit activity against HIV-2 when administered twice weekly, once weekly, or less frequently in the dosage regimens described herein. EFdA or ECdA may also exhibit activity against resistant forms of HIV (e.g. NRTI-related mutants M184V, M184I, K65R).

The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular disease state, and the individual undergoing therapy. In some cases, depending on the potency or individual response of the compound, it may be desirable to deviate upwards or downwards from a given dose. The amount and frequency of administration can be adjusted at the discretion of the attending clinician taking these factors into account.

In another embodiment of the present invention, in each of the methods, pharmaceutical compositions, medicaments, uses, combinations, aspects and other embodiments described and/or claimed herein, the compound of formula I is EFdA or a pharmaceutically acceptable salt or co-crystal thereof (i.e., wherein X is-F).

In another embodiment of the present invention, in each of the methods, pharmaceutical compositions, medicaments, uses, combinations, aspects and other embodiments described and/or claimed herein, the compound of formula I is an ecla or a pharmaceutically acceptable salt or co-crystal thereof (i.e., wherein X is Cl).

For the sake of brevity, the phrase "or a pharmaceutically acceptable salt or co-crystal thereof" is not always recited herein after the terms "compound of formula I", "EFdA" or "ecka". However, reference to the use of a compound of formula I, EFdA or ecla in the methods, pharmaceutical compositions, medicaments, uses, combinations, aspects and other embodiments described and/or claimed herein is intended to encompass the use of a compound of formula I, EFdA or ecla (where each term occurs) or a pharmaceutically acceptable salt or co-crystal thereof.

The term "individual" or "patient" as used herein refers to an animal, preferably a mammal, most preferably a human, who has been or will become the subject of treatment, including prophylactic treatment, observation or experiment. Human subjects or patients include (1) those infected with HIV and with or without AIDS, who are seeking to treat HIV infection, ARC or AIDS, and/or prevent and/or delay the onset or progression of ARC or AIDS, and (2) those not infected with HIV, who are seeking or receiving prophylactic treatment to prevent or reduce the risk of HIV transmission. In one embodiment of the invention, in each of the methods, pharmaceutical compositions, medicaments, uses, combinations, aspects and other embodiments described and/or claimed herein, the subject is a human subject.

The term "effective amount" as used herein refers to an amount of a compound that is sufficient to inhibit HIV reverse transcriptase, inhibit HIV replication, exert a prophylactic effect and/or exert a therapeutic effect after administration. One embodiment of an "effective amount" is a "therapeutically effective amount," which is an amount of the compound effective to inhibit HIV reverse transcriptase, inhibit HIV replication (any of the foregoing, which may also be referred to herein as an "inhibiting effective amount"), treat an HIV infection, treat AIDS or ARC, and/or slow the progression of AIDS or ARC in a patient. Another embodiment of an "effective amount" is a "prophylactically effective amount", which is an amount of the compound effective to prevent infection by HIV, delay the onset of AIDS or ARC, or prevent AIDS or ARC in a patient. It is to be understood that in an HIV-infected individual, an effective amount may be both a therapeutically effective amount, e.g., for treating an HIV infection, and a prophylactically effective amount, e.g., for preventing or reducing the risk of developing AIDS or ARC or delaying the onset or progression of AIDS or ARC.

Preventing (or arresting) HIV infection in an uninfected individual is intended to mean arresting or reducing the likelihood of HIV infection in an individual. In an individual infected with HIV, prevention (or prevention) of AIDS or ARC is intended to mean preventing or reducing the likelihood of developing AIDS or ARC in the individual.

Another embodiment of an "effective amount" includes an amount of an EFdA or an ECdA that reduces viremia in an HIV-infected individual or prevents HIV infection in an uninfected person exposed to the virus.

In the combination therapy of the present invention, an effective amount may refer to each individual agent or the combination as a whole, wherein the amounts of all agents administered in combination are effective together, but wherein the component agents of the combination may or may not be present alone in effective amounts which are considered to be effective for that component agent when administered alone. The term "administering" and variants thereof (e.g., "administering" a compound) with respect to the methods herein refers to providing a compound to an individual in need of treatment or prevention, and includes self-administration and administration to a patient by another person. When an EFdA or ecla is provided in combination with one or more other active agents (e.g., antiviral agents useful in treating or preventing HIV infection or AIDS), "administering" and variants thereof are each understood to include providing the EFdA or ecla and the one or more other agents to the individual either simultaneously (i.e., all on the same dosing regimen schedule) or non-simultaneously (if the one or more other agents cannot be administered on the same dosing regimen schedule as the EFdA or ecla). When the combined agents are administered simultaneously, they may be administered together in a single composition, or they may be administered separately.

SIV = simian immunodeficiency virus; VL = viral load; LLQ = lower limit of quantitation.

The dosing regimen of the invention is described above with a frequency of administration of EFdA or ECdA less than once daily. Dosage regimens may also be described herein in terms of "intervals" between administrations. The term "continuous dosing regimen" as used herein refers to a dosing regimen that is repeated without interruption as long as the clinician or patient desires or deems appropriate the desired therapeutic or prophylactic effect. The term "intermittent dosing regimen" as used herein refers to a dosing regimen for one or more limited periods of time for periodic prophylaxis to prevent or reduce the risk of HIV transmission, wherein the dosing regimen is discontinued after a period of time or between periods when the dosing regimen is employed.

The present invention provides a regimen wherein unit doses of the EFdA or ECdA are administered periodically according to a dosing interval selected from the group consisting of once weekly dosing, twice weekly dosing, once biweekly dosing, twice monthly dosing, and once monthly dosing. The phrase "once weekly" administration as used herein refers to the administration of a unit dose of EFdA or ECdA once weekly, i.e. once within a seven day period, preferably on the same day of the week. In a once weekly dosing regimen, the dose is typically administered about every seven days. A non-limiting example of a once weekly dosing regimen would require that a unit dose of EFdA or ECdA be administered daily. Preferably, the unit dose is administered once every 7 days, but once-weekly dosing regimens include dosing regimens in which the unit dose is administered every 5 to 10 days, so long as two consecutive doses fall within two different weekly periods.

The phrase "twice weekly" administration as used herein refers to administration of a unit dose of EFdA or ECdA twice weekly, i.e. twice within a seven day period, on two different days of each weekly period, wherein preferably the 2 days are the same weekly. In a twice weekly dosing regimen, each unit dose is typically administered about every three to four days. A non-limiting example of a twice weekly regimen would require that a unit dose of EFdA or ECdA be administered on a weekday and wednesday. Preferably, the unit dose is administered every 3 to 4 days, but a twice weekly dosing regimen includes a dosing regimen wherein the unit dose is administered every 2 to 5 days, so long as two doses are administered in each weekly period.

The phrase "once every two weeks" as used herein refers to administration of a unit dose of EFdA or ECdA once a two week period, i.e. once a fourteen day period, preferably on the same day of a two week period. In a once every two week dosing regimen, each unit dose is typically administered once every fourteen days. A non-limiting example of a once every two weeks dosing regimen would require administration of unit doses of EFdA or ECdA every other weekday. Preferably, the unit dose is administered once every 14 days, but a once every two weeks dosing regimen includes a dosing regimen wherein the unit dose is administered every 12 to 16 days, so long as two consecutive doses fall within two different once every two weeks periods.

The phrase "twice-a-month" administration as used herein refers to the administration of two (twice or twotimes) unit doses of EFdA or ECdA over a daily calendar month period. A twice monthly regimen is used, with the doses preferably being given on the same two days of the month. In a twice-monthly dosing regimen, each unit dose is typically administered about every fourteen to sixteen days. A non-limiting example of a twice-monthly dosing regimen would require dosing on or about the first day of the month and on or about the fifteenth day of the month, i.e., the middle point of the month. Preferably, the unit dose is administered every 14 to 16 days, but a twice monthly dosing regimen includes a dosing regimen wherein the unit dose is administered every 13 to 18 days, so long as two doses are administered within a monthly period. A twice-monthly regimen is defined herein as a dosing regimen that is different from and does not include once every two weeks because the two regimens have different periodicities and result in different numbers of doses being administered over a long period of time. For example, over a period of one year, a total of about twenty-four doses will be administered according to a twice-monthly schedule (because there are twelve calendar months in a year), while a total of about twenty-six doses will be administered according to a once every two weeks schedule (because there are about fifty-two weeks in a year).

The phrase "once monthly" administration as used herein refers to administration of a unit dose of EFdA or ECdA once over a monthly period, i.e., once over a daily calendar month period, preferably on the same day over each monthly period. In a once-monthly dosing regimen, each unit dose is typically administered once every 28-31 days. A non-limiting example of a once-monthly dosing regimen would require administration of a unit dose of EFdA or ECdA on or about the first day of the month. Preferably, the unit dose is administered once every 28-31 days, but a once monthly dosing regimen includes a dosing regimen wherein the unit dose is administered every 27 to 33 days, so long as two consecutive doses fall within two different monthly periods.

The phrase "once-a-quarter" administration as used herein refers to the administration of a unit dose of EFdA or ECdA once within a 3 month period, i.e. once per day over a quarterly period, preferably on the same day per quarterly period. In a once-quarterly dosing regimen, each unit dose is typically administered once every 84-93 days. A non-limiting example of such a dosing regimen would require administration of a unit dose of EFdA or ECdA on or about the first day of the first month of each quarterly period. Preferably, the unit dose is administered once every 84-93 days, but a once-quarterly dosing regimen includes a dosing regimen wherein the unit dose is administered every 81 to 99 days, provided that two consecutive doses fall within two different 3 month periods.

The phrase "twice-a-year" administration as used herein refers to the administration of a unit dose of EFdA or ECdA once over a 6 month period, i.e. once over a 6 calendar month period, preferably on the same date over each of the two-times-a-year periods. In a twice-a-year dosing regimen, each unit dose is typically administered every 168-186 days. A non-limiting example of such a dosing regimen would require administration of a unit dose of EFdA or ECdA on or about the first day of the first month of each two-times-a-year period. Preferably, the unit dose is administered once every 168- ­ 186 days, but a twice-a-year dosing regimen includes a dosing regimen wherein the unit dose is administered every 162- ­ 198 days, provided that the two consecutive doses fall within two different 6-month periods.

The phrase "once-a-year" administration as used herein refers to the administration of a unit dose of EFdA or ECdA once over a 12 month period, i.e. once over a 12 calendar month period, preferably on the same date within each once-a-year period. In a once-a-year dosing regimen, each unit dose is typically administered once every 336-372 days. A non-limiting example of such a dosing regimen would require administration of a unit dose of EFdA or ECdA on or about the first day of the first month of each once-a-year period. Preferably, the unit dose is administered once every 336-.

The EFdA or ECdA may be administered in the form of a pharmaceutically acceptable salt or a pharmaceutically acceptable co-crystal. The terms "pharmaceutically acceptable salt" and "pharmaceutically acceptable co-crystal" refer to salts or co-crystals that are not biologically or otherwise undesirable (e.g., are neither toxic nor otherwise deleterious to the recipient thereof). Since EFdA or ECdA contain at least one basic group on the fluoroadenine base, the invention encompasses the corresponding pharmaceutically acceptable salts. Since EFdA or ECdA contains at least one basic group, i.e. a group which can be protonated, on the adenine base, it can be used according to the invention in the form of its acid addition salts with inorganic or organic acids, such as, but not limited to, salts with hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, nitric acid, benzenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, trifluoroacetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, pivalic acid, succinic acid, and the like. EFdA or ECdA can be used according to the invention in the form of their acid co-crystals with inorganic or organic acids, such as, but not limited to, salts with benzenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, trifluoroacetic acid, tartaric acid, lactic acid, salicylic acid, benzoic acid, formic acid, propionic acid, pivalic acid, succinic acid, and the like. Salts and co-crystals can be obtained from EFdA or ecla by conventional methods known to those skilled in the art, for example by combination with organic or inorganic acids or bases in solvents or dispersants, or by ion exchange with other salts.

As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients, as well as any product which results from combination of the specified ingredients. Ingredients suitable for inclusion in a pharmaceutical composition are pharmaceutically acceptable ingredients, which means that the ingredients must be compatible with each other and not deleterious to the recipient thereof.

Example 1

Weekly efficacy in HIV-infected SIV-infected macaque model

Oral efficacy studies were conducted at the New Ibiiia Research Center (NIRC) of lafutite, louisiana. After 5 days of treatment with BAYTRIL (5 mg/kg, IM, SID), 20 monkeys were inoculated intravenously with SIVmac 251. After 3 days, venous blood was collected every 2-5 days (2 times weekly) for viral load testing and monitored to stable viremia (where 3 consecutive samples were within 3-fold of each other after the peak of acute viremia). Plasma SIV viral RNA levels were determined using branched DNA technology in Siemens Diagnostics, burckli, california.

After stable viremia was determined, SIV-infected monkeys were randomized by age, weight and viral load (n = 3 per group). A two-arm adaptive design is used where the results of group 1 inform the dose of group 2. In group 1, animals received two weekly doses of vehicle, 1.3 mg/kg EFdA or 13 mg/kg EFdA administered by oral gavage. In group 2, animals received 3.9 mg/kg or 18.2 mg/kg EFdA once weekly or 0.19 mg/kg EFdA once daily for two weeks. Blood (4ml) was drawn for viral load determination twice weekly for 3 weeks on day-2, day 0 (dosing day), days 1, 2, 3, 5, 7 (dosing day), days 8, 9, 10, 12 and 14 within the treatment period, then within the elution period. In addition, blood (1ml) was drawn at day 0 (2 hours post-dose), day 1 (24 hours post-dose), day 7 (2 hours post-dose) and day 8 (24 hours post-dose) for EFdA pharmacokinetic assessment.

SIV RNA for genotyping was isolated from 140. mu.l of plasma using QIAamp viral RNA Mini kit (Cat # 52904/52906). The reverse transcriptase region of SIVmac251 was reverse transcribed and amplified in a 20. mu.l reaction using SuperScript III RT/Platinum polymerase, primers S251RTF1 (GGCAAAAGGATTAAAGGGAC [2732-2751]) and S251RTR1 (TTTTACTTTGTCTTTGCCCC [4206-4225]) and 8. mu.l template RNA. The nested PCR reaction was performed in a 50. mu.l reaction using 3.5. mu.l of the product from the first reaction with TaKaRa LA Taq and the primers S251RTF2 (ACAATCATGACAGGGGACAC [ 2750-. After verifying a size of 1.5 kb by gel electrophoresis, the PCR product was purified using ExoSAP-IT (Affymetrix; cat #78201) and adjusted to 15 ng/ml. The PCR product (10. mu.l) was mixed with 5. mu.l of 5. mu.M sequencing primers S251RTS5 (CAGGGGACACTCCGATTAAC [2760- & 2779]), S251RTS6 (AAGGTTCTGCCTCAGGGATG [3266- & 3285]), or S251RTS7 (CTCAGTCAGGAACAAGAAGG [3755- & 3774 ]). DNA sequencing was performed in Genewiz (115 corporation Blvd, Nanplenfield, NJ 07080).

Monkeys showed a high degree of variability in response among individuals. Those with a high VL (over 10) do not react as well as those with a low VL, resulting in a large standard deviation (fig. 1). However, these groups were balanced in terms of VL and the mean data showed dose response curves for VL reduction and VL return after dosing was stopped (elution). From 3.9 to 18.2 mg/kg QW, the VL decline appeared to be near maximum, and even at 3.9 mg/kg VL inhibition was maintained for 7 days from day 7 to day 14. One monkey in the vehicle group was euthanized around day 19 because of poor clinical symptoms. There was a dose-dependent VL rebound over the elution period.

These experiments demonstrate that EFdA can be administered orally once a week to control viremia like a once daily treatment.

Example 2

Pharmacokinetics of EFdA after oral dose administration in healthy humans

The pharmacokinetics of EFdA were evaluated in single and multiple ascending dose studies in phase I. In a single dose study, three alternating groups of 8 healthy adult subjects were administered a single oral dose of EFdA oral suspension (5 to 400 mg). In each group, single doses of EFdA (n = 6) or matched placebo (n = 2) were administered blindly to the individuals for up to 3 treatment periods. Group A received 15 mg and 200 mg. Group B received 30 mg, 400 mg and 30 mg and food. Group C received 100 mg and 5 mg. In a multiple ascending dose study, three groups of 8 healthy adult subjects were administered multiple doses of EFdA oral capsules. In each group, three once weekly doses of EFdA (n = 6) or matched placebo (n = 2) were administered to the subjects on days 1, 8, and 15. Group A received 10 mg. Group B received 30 mg, and group C received 100 mg.

In a single dose study, EFdA-TP reached intracellular C_maxMedian value T_maxThe concentration in PBMC is decreased within 6-24 hours, and the apparent terminal half-life is 210-120-hours. Intracellular EFdA pharmacokinetics are largely unaffected by high fat diets. EFdA was rapidly absorbed, median T_maxIt was 0.5 hour. Plasma concentrations decreased in a biphasic manner with a rapid initial phase (C)_maxDecrease by about 10 fold over the first 6-12 hours) and slow terminal phase, with apparent terminal half-life of-50-60 hours. EFdA plasma exposure appears to increase between 5 and 400 mg roughly in a dose-proportional manner.

Intracellular EFdA-Triphosphate (TP) pharmacokinetics from multiple dose studies are shown in figure 2 and table 1. The plasma EFdA pharmacokinetics from the multiple dose study are shown in figure 3 and table 2. Results from the multiple dose study summarize results from the single dose study.

After multiple doses of 30 mg and 100 mg, it appears that the EFdA-TP AUC_0-168hrAnd Cmax accumulated moderately, while EFdA-TP C_168hrThere is little accumulation. As expected from the shorter half-life, EFdA accumulates little in plasma. At the 10 mg dose, all subjects had plasma concentrations below LLQ (3.41 nM) 48 hours and 1 week after dosing and 96 hours or 3 weeks after dosing. EFdA exposure in plasma and EFdA-TP in PBMC appeared to increase generally in a dose proportional manner.

TABLE 1 summary of intracellular EFdA-TP pharmacokinetic parameter values in PBMCs after 3 weeks of weekly oral doses of EFdA administered to healthy fasted subjects

Table 2: summary of EFdA plasma pharmacokinetic parameter values after 3 weeks of once weekly oral dose of EFdA to healthy fasted subjects

Example 3

The efficacy of a single dose monotherapy with EFDA is currently being evaluated in HIV-1 patients that have not been treated with antiretroviral therapy. In this study, a single 10 mg dose of EFDA was associated with a rapid and robust reduction in VL. At 168 hours post-dosing, a mean (95% CI) placebo-adjusted VL reduction of 1.67 log10 (1.47, 1.87) was observed. The mean VL continued to decrease by day 10, with a mean decrease of 1.78 log10 (1.59, -1.98) and no signs of relapse. The 10 mg dose is generally well tolerated, with a limited number of mild/moderate adverse experiences reported. EFDA plasma and EFDA-TP PBMC PK were similar to the data previously reported for healthy individuals. A summary of placebo-corrected changes in viral load versus baseline for the 10 mg dose is provided in table 3 below.

Table 3: placebo-corrected change in viral load of 10 mg dose of EFDA from baseline