阅读说明：本技术 6α-乙基-23(S)-甲基胆酸在制备治疗周围神经脱髓鞘类疾病的药物中的应用 (Application of 6 alpha-ethyl-23 (S) -methyl cholic acid in preparation of medicine for treating peripheral nerve demyelinating diseases ) 是由 刘晓宇 孙诚 于 2020-06-28 设计创作，主要内容包括：本发明公开了一种6α-乙基-23(S)-甲基胆酸在制备治疗周围神经脱髓鞘类疾病的药物中的应用。本发明提供了激动剂6α-乙基-23(S)-甲基胆酸的新用途,且效果好；研究机理的方法简便,准确。(The invention discloses application of 6 alpha-ethyl-23 (S) -methyl cholic acid in preparing a medicament for treating peripheral nerve demyelinating diseases. The invention provides a new application of an agonist 6 alpha-ethyl-23 (S) -methyl cholic acid, and the effect is good; the method for researching the mechanism is simple, convenient and accurate.)

1. Application of 6 alpha-ethyl-23 (S) -methyl cholic acid in preparing medicine for treating peripheral nerve demyelinating diseases is provided.

2. The use of 6 α -ethyl-23 (S) -methylchollic acid according to claim 1 for the preparation of a medicament for the treatment of peripheral nerve demyelinating diseases characterized by: the mechanism research method comprises the following steps:

(1) cell processing

The experimental object is primary schwann cells; taking the sciatic nerve tissues of SD rats born on one day, then obtaining primary cells by a method of pancreatin and collagenase digestion, and obtaining Schwann cells with the purity of more than 90% by adopting cytarabine and HRG factors; the purified cells were planted in six-well plates, with different treatment groups set: control group, cAMP positive control group, treatment concentration is 1 mM; 6 alpha-ethyl-23 (S) -methyl cholic acid treatment groups, wherein the treatment concentrations are 5, 10, 25 and 125 mu M respectively; and cAMP and 6 α -ethyl-23 (S) -methylchollic acid dual treatment group; collecting samples after 24 hours of treatment, and repeating the experiment for three times;

(2) extraction of total RNA of Xuewang cell and detection of gene expression

Extracting total RNA of Schwann cells by using Trizol reagent of Invitrogen company, and synthesizing a cDNA first chain by using a reverse transcription kit of Roche company; SYBR Green Supermix from Roche company is used for gene expression analysis, and the instrument is iQ5 Multicolor Real-Time PCR Detection System from Bio-Rad company; analytical results 2^-△△CtCalculating mRNA level; levels of mRNA were calibrated with the 18S housekeeping gene; the primer sequences used were as follows:

18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

Krox20 forward primer: TGGGTTTAAGTATGGCTGTATA

Krox20 negative primer: AGTTAGTGGTTCTGTGTTAGA

MPZ Forward primer: GGATAAGAAATAGCGGTTAGC

MPZ negative primer: TTGAGGCTGGTTCTACTG

OCT6 forward primer: TTCCTAATTTCTGACCCATCT

OCT6 negative primer: GCAATAAAGATACAAAGAGAATGG

(3) Xuewang cell protein extraction and protein expression detection

Putting each well of a six-well plate for culturing the Schwann cells into a solution added with precooled cell protein lysate: 25mM Tris-HCl, pH 7.4; 100mM NaF; 50mM Na₄P₂O₇；10mM Na₃VO₄(ii) a 10mM EGTA; 10mM EDTA; 1% NP-40; 10 mu g/ml Leuppeptin; 10 μ g/ml Aprotinin; 2mM PMSF; 20nM Okadaic acid; the cells were transferred in their entirety to pre-cooled 1.5ml EP tubes and lysed extensively on ice for 20min, followed by refrigerated centrifugation at 13000rpm, 4 ℃, 20 min; after centrifugation, transferring the supernatant into a new 1.5ml centrifuge tube; measuring the protein content of the sample by using a BCA protein quantitative kit of Pierce company, adjusting the protein concentration of all samples to the same level according to the obtained result, adding a loading buffer solution, uniformly mixing, boiling at 100 ℃ for 5min, and cooling to room temperature for Western blot analysis;

separating the extracted total protein sample by polyacrylamide gel electrophoresis, and transferring the protein in the gel to a PVDF membrane; blocking the PVDF membrane after the transfer printing for 1 hour by using TBST buffer solution containing 5 percent of bovine serum albumin; incubating the sealed PVDF membrane with a specific primary antibody at 4 ℃ overnight; washing the PVDF membrane with TBST for three times, reacting with corresponding secondary antibody at room temperature for 1 hour, and washing the PVDF membrane with TBST for three times; finally, the PVDF film is reacted by a chemiluminescence reaction system and exposed to an X-ray film; quantification of the expression level of each protein was analyzed by the software Quantity-One (Bio-Rad);

(4) establishment of in vivo animal model

The animal model adopts a one-day-born red-skin mouse; sciatic nerve tissue from red skin rats injected with 6 α -ethyl-23 (S) -methylcholytic acid was used for follow-up studies; the control group was red skin mice injected with PBS; each set of experiments had 6 biological replicates;

(5) transmission electron microscopy morphological analysis

Taking sciatic nerves of different groups, transversely cutting the tissues for 1-2mm, and soaking in mixed solution containing 4% paraformaldehyde and 2.5% glutaraldehyde for 24 hr; tissue samples were fixed in 1% osmium tetroxide for 1 hour and embedded in Epon812 epoxy; staining the slices with lead citrate and uranyl acetate, and observing under a transmission electron microscope of 80 KV; g ratio is the ratio of the average inner diameter of axons to the average diameter of fibers, and is analytically calculated using Image J software;

(6) behavioural analysis

An accelerating rotating rod device is adopted in the rod rotating experiment; mice were habituated in the laboratory for 30 minutes prior to testing; by swinging the mice, the mice were placed on the twill horses and trained in an accelerated mode for 3 days at intervals of 3 minutes and 5 minutes on the twill horses; repeating the training at a constant speed until the mouse is able to rest on the bar for at least 300 seconds; for the official test, the mice were placed on a rotating drum and the carousel was set to acceleration mode, i.e. accelerated at a speed of 4 to 40 rpm in 5 minutes; recording the time of movement on the rod before the drop is measured;

(7) results

The results show that the treatment of 6 alpha-ethyl-23 (S) -methyl cholic acid can remarkably promote the protein expression of the early growth factor 20 and the octamer-binding transcription factor 6 gene; the expression of p-AMPK and p-S6K is detected, and the result shows that the treatment of 6 alpha-ethyl-23 (S) -methyl cholic acid can obviously increase the activity of p-S6K and reduce the activity of p-AMPK, namely that the 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777) promotes the development and formation of sciatic nerve myelin; the results of the behavioral experiments show that the rotating rod balancing capability of the mice treated by the 6 alpha-ethyl-23 (S) -methyl cholic acid is superior to that of wild mice; the transmission electron microscope results show that the subcutaneous injection of INT777 causes the sciatic nerve myelin sheath of the mice to increase in thickness and promote the myelin sheath to develop compared with the wild mice.

Technical Field

The invention relates to a new application of 6 alpha-ethyl-23 (S) -methyl cholic acid.

Background

The existing drugs for treating peripheral nerve demyelinating diseases have certain defects in the aspects of treatment effect and the like, and new drugs need to be further searched and developed. The effect of 6 alpha-ethyl-23 (S) -methyl cholic acid has not been reported to prepare medicines for treating peripheral nerve demyelinating diseases.

Disclosure of Invention

The invention aims to provide application of effective 6 alpha-ethyl-23 (S) -methyl cholic acid in preparing a medicament for treating peripheral nerve demyelinating diseases.

The technical solution of the invention is as follows:

application of 6 alpha-ethyl-23 (S) -methyl cholic acid in preparing medicine for treating peripheral nerve demyelinating diseases is provided.

The mechanism research method comprises the following steps:

(1) cell processing

The experimental object is primary schwann cells; taking the sciatic nerve tissues of SD rats born on one day, then obtaining primary cells by a method of pancreatin and collagenase digestion, and obtaining Schwann cells with the purity of more than 90% by adopting cytarabine and HRG factors; the purified cells were planted in six-well plates, with different treatment groups set: control group, cAMP positive control group, treatment concentration is 1 mM; 6 alpha-ethyl-23 (S) -methyl cholic acid treatment groups, wherein the treatment concentrations are 5, 10, 25 and 125 mu M respectively; and cAMP and 6 α -ethyl-23 (S) -methylchollic acid dual treatment group; collecting samples after 24 hours of treatment, and repeating the experiment for three times;

(2) extraction of total RNA of Xuewang cell and detection of gene expression

Extracting total RNA of Schwann cells by using Trizol reagent of Invitrogen company, and synthesizing a cDNA first chain by using a reverse transcription kit of Roche company; SYBR Green Supermix from Roche company is used for gene expression analysis, and the instrument is iQ5 Multicolor Real-Time PCR Detection System from Bio-Rad company; analytical results 2^-△△CtCalculating mRNA level; levels of mRNA were calibrated with the 18S housekeeping gene; the primer sequences used were as follows:

18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

Krox20 forward primer: TGGGTTTAAGTATGGCTGTATA

Krox20 negative primer: AGTTAGTGGTTCTGTGTTAGA

MPZ Forward primer: GGATAAGAAATAGCGGTTAGC

MPZ negative primer: TTGAGGCTGGTTCTACTG

OCT6 forward primer: TTCCTAATTTCTGACCCATCT

OCT6 negative primer: GCAATAAAGATACAAAGAGAATGG

(3) Xuewang cell protein extraction and protein expression detection

Putting each well of a six-well plate for culturing the Schwann cells into a solution added with precooled cell protein lysate: 25mM Tris-HCl, pH 7.4; 100mM NaF; 50mM Na₄P₂O₇；10mM Na₃VO₄(ii) a 10mM EGTA; 10mM EDTA; 1% NP-40; 10 mu g/ml Leuppeptin; 10 μ g/ml Aprotinin; 2mM PMSF; 20nM Okadaic acid; the cells were transferred in their entirety to pre-cooled 1.5ml EP tubes and lysed extensively on ice for 20min, followed by refrigerated centrifugation at 13000rpm, 4 ℃, 20 min; after centrifugation, transferring the supernatant into a new 1.5ml centrifuge tube; measuring the protein content of the sample by using a BCA protein quantitative kit of Pierce company, adjusting the protein concentration of all samples to the same level according to the obtained result, adding a loading buffer solution, uniformly mixing, boiling at 100 ℃ for 5min, and cooling to room temperature for Western blot analysis;

separating the extracted total protein sample by polyacrylamide gel electrophoresis, and transferring the protein in the gel to a PVDF membrane; blocking the PVDF membrane after the transfer printing for 1 hour by using TBST buffer solution containing 5 percent of bovine serum albumin; incubating the sealed PVDF membrane with a specific primary antibody at 4 ℃ overnight; washing the PVDF membrane with TBST for three times, reacting with corresponding secondary antibody at room temperature for 1 hour, and washing the PVDF membrane with TBST for three times; finally, the PVDF film is reacted by a chemiluminescence reaction system and exposed to an X-ray film; quantification of the expression level of each protein was analyzed by the software Quantity-One (Bio-Rad);

(4) establishment of in vivo animal model

The animal model adopts a one-day-born red-skin mouse; sciatic nerve tissue from red skin rats injected with 6 α -ethyl-23 (S) -methylcholytic acid was used for follow-up studies; the control group was red skin mice injected with PBS; each set of experiments had 6 biological replicates;

(5) transmission electron microscopy morphological analysis

Taking sciatic nerves of different groups, transversely cutting the tissues for 1-2mm, and soaking in mixed solution containing 4% paraformaldehyde and 2.5% glutaraldehyde for 24 hr; tissue samples were fixed in 1% osmium tetroxide for 1 hour and embedded in Epon812 epoxy; staining the slices with lead citrate and uranyl acetate, and observing under a transmission electron microscope of 80 KV; g ratio is the ratio of the average inner diameter of axons to the average diameter of fibers, and is analytically calculated using Image J software;

(6) behavioural analysis

An accelerating rotating rod device is adopted in the rod rotating experiment; mice were habituated in the laboratory for 30 minutes prior to testing; by swinging the mice, the mice were placed on the twill horses and trained in an accelerated mode for 3 days at intervals of 3 minutes and 5 minutes on the twill horses; repeating the training at a constant speed until the mouse is able to rest on the bar for at least 300 seconds; for the official test, the mice were placed on a rotating drum and the carousel was set to acceleration mode, i.e. accelerated at a speed of 4 to 40 rpm in 5 minutes; recording the time of movement on the rod before the drop is measured;

(7) results

The results show that the treatment of 6 alpha-ethyl-23 (S) -methyl cholic acid can remarkably promote the protein expression of the early growth factor 20 and the octamer-binding transcription factor 6 gene; the expression of p-AMPK and p-S6K is detected, and the result shows that the treatment of 6 alpha-ethyl-23 (S) -methyl cholic acid can obviously increase the activity of p-S6K and reduce the activity of p-AMPK, namely that the 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777) promotes the development and formation of sciatic nerve myelin; the results of the behavioral experiments show that the rotating rod balancing capability of the mice treated by the 6 alpha-ethyl-23 (S) -methyl cholic acid is superior to that of wild mice; the transmission electron microscope results show that the subcutaneous injection of INT777 causes the sciatic nerve myelin sheath of the mice to increase in thickness and promote the myelin sheath to develop compared with the wild mice.

The invention provides a new application of an agonist 6 alpha-ethyl-23 (S) -methyl cholic acid, and the effect is good; the method for researching the mechanism is simple, convenient and accurate.

Drawings

The invention is further illustrated by the following figures and examples.

FIG. 1 is a diagram showing the expression of MPZ gene activating the myelin sheath of Schwann cells at the 6 α -ethyl-23 (S) -methylchollic acid (INT777) nucleic acid level.

FIG. 2 is a graph showing the expression of Oct6 gene activating the myelin sheath of Schwann cells at the 6 α -ethyl-23 (S) -methylcholcholic acid (INT777) nucleic acid level.

FIG. 3 is a diagram showing the expression of Krox20 gene activating the myelin sheath of Schwann cells at the 6 α -ethyl-23 (S) -methylchollic acid (INT777) nucleic acid level.

FIG. 4 is a schematic representation of the expression of 6 α -ethyl-23 (S) -methyl cholic acid (INT777) at the protein level activating genes associated with the myelin sheath of Schwann cells.

FIG. 5 is a schematic representation of the pathway of 6 α -ethyl-23 (S) -methyl cholic acid (INT777) activating the p-AMPK/p-S6k signal.

Figure 6 is a schematic representation of 6 α -ethyl-23 (S) -methylchollic acid (INT777) enhancing the motor balance ability of mice (rotarod test).

FIG. 7 is a schematic diagram of 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777) promoting the development of sciatic nerve myelin in mice (electron microscopy).

FIG. 8 is a graphical representation of the effect (g ratio) of 6 α -ethyl-23 (S) -methylcholic acid (INT777) on mouse sciatic nerve myelin development.

Detailed Description

Application of 6 alpha-ethyl-23 (S) -methyl cholic acid in preparing medicine for treating peripheral nerve demyelinating diseases is provided.

The mechanism research method comprises the following steps:

firstly, experimental steps

1. Cell processing

The experimental subject is primary schwann cells. The sciatic nerve tissues of SD rats born on one day are quickly taken out, primary cells are obtained by a method of trypsinization and collagenase digestion, and Schwann cells with the purity of more than 90 percent are obtained by adopting cytarabine and HRG factors. The purified cells were planted in six-well plates, with different treatment groups set: control group, cAMP positive control group (treatment concentration is 1mM), 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777, CAS: 1199796-29-6) treatment group (treatment concentrations are 5, 10, 25, 125. mu.M respectively), and cAMP and 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777, CAS: 1199796-29-6) double treatment group. Samples were collected after 24 hours of treatment and the experiment was repeated three times.

2. Extraction of total RNA of Xuewang cell and detection of gene expression

Total RNA of Schwann cells was extracted using Trizol reagent (Invitrogen corporation), and first-strand cDNA synthesis was performed using reverse transcription kit (Roche corporation). The gene expression analysis was performed by SYBR Green Supermix from Roche, iQ5 Multicolor Real-Time PCR Detection System from Bio-Rad. Analytical results 2^-△△CtmRNA levels were calculated. The mRNA levels were calibrated with the 18S housekeeping gene. The primer sequences used were as follows:

18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

Krox20 forward primer: TGGGTTTAAGTATGGCTGTATA

Krox20 negative primer: AGTTAGTGGTTCTGTGTTAGA

MPZ Forward primer: GGATAAGAAATAGCGGTTAGC

MPZ negative primer: TTGAGGCTGGTTCTACTG

OCT6 forward primer: TTCCTAATTTCTGACCCATCT

OCT6 negative primer: GCAATAAAGATACAAAGAGAATGG

3. Xuewang cell protein extraction and protein expression detection

A six-well plate in which Schwann cells were cultured was placed in each well with a pre-chilled cell protein lysate (25mM Tris-HCl, pH 7.4; 100mM NaF; 50mM Na)₄P₂O₇；10mM Na₃VO₄(ii) a 10mM EGTA; 10mM EDTA; 1% NP-40; 10 mu g/ml Leuppeptin; 10 μ g/ml Aprotinin; 2mM PMSF; 20nM Okadaic acid), the cells were transferred in their entirety to a pre-cooled 1.5ml EP tube and lysed extensively on ice for 20 minutes (during which time they were shaken several times on a shaker, benefiting lysis), followed by refrigerated centrifugation (13000rpm, 4 ℃) for 20min, after which the supernatant was transferred to a new 1.5ml centrifuge tube. The protein content of the sample is determined by using a BCA protein quantitative kit of Pierce company, the protein concentration of all samples is adjusted to the same level according to the obtained result, a loading buffer solution is added and mixed uniformly, the mixture is boiled at 100 ℃ for 5min, and the mixture is cooled to room temperature for Western blot analysis.

The extracted total protein samples were separated by polyacrylamide gel electrophoresis (SDS-PAGE), and the proteins in the gel were transferred to a PVDF membrane. The PVDF membrane after the transfer was blocked with 5% bovine serum albumin in TBST (Tris-buffered saline solution/Tween) buffer for 1 hour. The blocked PVDF membrane was incubated with the specific primary antibody overnight (4 ℃). The PVDF membrane was subsequently washed three times with TBST, then with the corresponding secondary antibody at room temperature for 1 hour, and then again washed three times with TBST. Finally, the PVDF membrane was reacted with a chemiluminescent reaction system (Pierce) and exposed to X-ray film (Kodak). Quantification of the expression level of each protein was analyzed by the software Quantity-One (Bio-Rad). All antibodies were purchased from Cell Signaling Technology.

4. Establishment of in vivo animal model

Animal model one day of birth SD rats (also known as red skin rats) were used, this experiment was performed by injecting 6 α -ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) (concentration 10ug/g/d) subcutaneously in red skin rats every other day, and sciatic nerve tissue was taken six days later for subsequent studies. Control groups were injected subcutaneously in red mice with PBS, treatment time and concentration were consistent with treatment groups, and there were 6 biological replicates in each group.

5. Transmission electron microscopy morphological analysis

The sciatic nerves of the different groups were quickly removed and transected 1-2mm into tissue and soaked in a mixture containing 4% paraformaldehyde and 2.5% glutaraldehyde for 24 hours. Tissue samples were fixed in 1% osmium tetroxide for 1 hour and embedded in Epon812 epoxy. The sections were stained with lead citrate and uranyl acetate and observed under a transmission electron microscope (Japanese, JEO Co., Ltd.) of 80 KV. The g-ratio (g-ratio) is the ratio of the mean axon internal diameter to the mean fiber diameter (myelin sheath) and is calculated analytically using Image J software.

6. Behavioural analysis

To further clarify the effect of 6 α -ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) on sciatic nerve remyelination and motor recovery, we performed a rotarod behavioral assay.

The rotarod experiment used an accelerated rotarod apparatus (LE8500 model, Pan laboratory) and mice were habituated in the laboratory for 30 minutes prior to testing. Mice were gently placed on the twill horses by gently swinging them and trained in an accelerated mode (4-40 rpm) for 3 days at intervals of 3 minutes and 5 minutes on the twill horses. The training was repeated at a constant speed (16 rpm) until the mice were able to rest on the bar for at least 300 seconds. For the official test, mice were placed on a rotating drum and the carousel was set to acceleration mode, i.e. accelerated at a speed of 4 to 40 rpm over 5 minutes. The time of movement on the rod was recorded before the drop was measured.

Second, experimental results

TGR5(G protein-coupled acid receptor 1) is a G protein-coupled receptor, mainly expressed in brown fat, liver and muscle. TGR5 was able to stimulate energy expenditure in obese mice, reducing the incidence of diet-induced obesity. It has been shown that TGR5 induces an increase in the expression of glucagon like peptide (GLP-1) in obese mice, improves liver and pancreatic function, increases glucose tolerance, and causes an increase in the intracellular ATP/ADP ratio. It has been reported that GLP-1 promotes the formation of the myelin sheath of peripheral nerves by activating MAPK/ERK energy metabolism pathways. Therefore, TGR5 can maintain ATP balance of eukaryotic cells, stimulate energy metabolism, and make cellular metabolism approach physiological balance.

6 α -Ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) is an activator of TGR5, specifically increasing the activity of TGR 5. Research reports indicate that the agonist INT-777 can reduce pancreatic acinar cell necrosis of the acute pancreatitis of mice, and can also play a protective role in cognitive impairment, neuroinflammation, apoptosis and synaptic dysfunction of the mice induced by Abeta 1-42. It has also been reported that 6 α -ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) induces the expression of cAMP in organisms, which promotes the development of myelin. Thus, we investigated the relationship between 6 α -ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) and formation of the sciatic nerve myelin.

The peripheral nervous system is widely distributed in the body and plays a role in signal transmission between target organs and the central nervous system. Myelination of nerve axons is the fundamental guarantee of the functioning of the nervous system, and abnormalities in myelination can lead to the occurrence of various diseases. Peripheral nerve injury is a common clinical sign, and particularly is a disease caused by demyelination of neuron axons at injury positions caused by traffic accidents, wars, earthquakes and other accidental injuries and failure of transmission of nerve impulses. Among them, the sciatic nerve is the most important and intuitive material for studying development and regeneration of peripheral nerves. Therefore, we all used the sciatic nerve for subsequent experiments.

To investigate whether 6 α -Ethyl-23 (S) -methylchollic acid (INT777, CAS: 1199796-29-6) can promote peripheral nerve myelin formation in vivo, we used the in vitro cAMP-induced Schwann cell myelination model and treated primary cells with 6 α -Ethyl-23 (S) -methylchollic acid (INT777), an agonist of TGR5 (for time and methods detailed above). Early growth factor 20(krox20), octamer-bound transcription factor 6(oct6) and Myelin Protein (MPZ) are key genes in myelination, and our results indicate that treatment with 6 α -ethyl-23 (S) -methylcholate (INT777) at a concentration of 25, 125 μ M can effectively activate the expression of these three genes (fig. 1, 2, 3). Therefore, we used 25 μ M concentration treatment in subsequent experiments. Subsequently, we also examined the protein expression levels of these several genes. The results indicate that 6 α -ethyl-23 (S) -methylchollic acid (INT777) treatment significantly promoted protein expression of the early growth factor 20(krox20) and octamer-binding transcription factor 6(oct6) genes (fig. 4). The MAPKs pathway is well known to be a classical signaling pathway that regulates myelination, affecting the developmental process of the peripheral nerve myelin sheath. Therefore we examined the expression of p-AMPK, p-S6K. Our results indicate that 6 α -ethyl-23 (S) -methyl cholic acid (INT777) treatment can significantly increase p-S6K activity and decrease p-AMPK activity (FIG. 5), i.e., 6 α -ethyl-23 (S) -methyl cholic acid (INT777) promotes sciatic nerve myelin development. To further demonstrate the effect of 6 α -ethyl-23 (S) -methylchollic acid (INT777) on sciatic nerve myelin development, we performed related experiments in animals. Results of behavioral experiments showed that the rotarod balancing ability of 6 α -ethyl-23 (S) -methylchollic acid (INT777) treated mice was superior to that of wild type mice (fig. 6). Transmission electron microscopy results showed that subcutaneous INT777 injection resulted in increased sciatic nerve myelin thickness and facilitated myelin development in mice compared to wild-type mice (fig. 7, 8).

The results show that the agonist 6 alpha-ethyl-23 (S) -methyl cholic acid (INT777) of TGR5 can promote the development of sciatic nerve myelin sheath, promote motor balance ability and have positive treatment effect on peripheral nerve demyelination diseases.