阅读说明：本技术 一种牛血红蛋白制品中牛源基因组dna定量检测方法及其应用 (Quantitative detection method for bovine-derived genomic DNA in bovine hemoglobin product and application of quantitative detection method ) 是由 史国营 游可为 张彦鹏 董欣 陈浩源 于 2020-05-11 设计创作，主要内容包括：本发明涉及一种牛血红蛋白制品中牛源基因组DNA定量检测方法及其应用,具体提供了牛源血红蛋白制品中牛基因组DNA的荧光定量PCR检测方法,其包括：对所述牛源血红蛋白制品中的DNA进行提取,和利用荧光定量PCR方法对提取的DNA进行扩增检测。该方法对从人工聚合的牛血红蛋白中纯化牛源DNA进行特异性扩增和荧光检测,实现了对生化药物制品中牛源成分的快速、准确检测。(The invention relates to a quantitative detection method and application of bovine genomic DNA in a bovine hemoglobin product, and particularly provides a fluorescent quantitative PCR detection method of bovine genomic DNA in a bovine hemoglobin product, which comprises the following steps: extracting DNA in the bovine hemoglobin product, and carrying out amplification detection on the extracted DNA by using a fluorescent quantitative PCR method. The method carries out specific amplification and fluorescence detection on the bovine-derived DNA purified from the artificially polymerized bovine hemoglobin, and realizes the rapid and accurate detection of bovine-derived components in biochemical pharmaceutical products.)

1. A fluorescent quantitative PCR detection method of bovine genomic DNA in bovine hemoglobin products comprises the following steps:

extracting DNA from said bovine hemoglobin preparation, and

carrying out amplification detection on the extracted DNA by using a fluorescent quantitative PCR method;

wherein:

the extraction comprises the following steps:

1) adding 20 mu L of protease K solution and 300 mu L of lysate GHL into a 2ml centrifuge tube every 250 mu L of the bovine hemoglobin product, uniformly mixing by oscillation, performing lysis at 75 ℃ for 15min, and reversely mixing for 3 times every 5 times;

2) adding 300 mu L of isopropanol into the product obtained in the step 1), uniformly mixing by oscillation for 10sec, adding 15 mu L of magnetic bead suspension GH, uniformly mixing by oscillation for 1min, standing for 9min totally, and uniformly mixing by oscillation for 1min every 3 min; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

3) adding 900 mu L buffer GDZ into the product obtained in the step 2), and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

4) adding 500 mu L of buffer GDZ into the product obtained in the step 3), and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

5) taking the 2ml centrifuge tube off the magnetic frame, adding 250 mu L rinsing liquid, and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

6) taking the 2ml centrifuge tube off the magnetic frame, adding 250 mu L rinsing liquid, and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

7) placing the 2ml centrifuge tube on a magnetic frame, airing for 10-15min at room temperature, taking the 2ml centrifuge tube off the magnetic frame, adding 50-100 mu L of elution buffer TB, uniformly mixing by oscillation, incubating for 10min at 56 ℃, and reversely mixing for 3 times, wherein each time is 3-5 times;

8) placing the 2ml centrifuge tube on a magnetic frame, standing for 2min, and transferring the DNA solution to a new centrifuge tube after the magnetic beads are completely adsorbed to obtain a DNA extracting solution;

the bovine hemoglobin product has a volume of at least 2mL,

the rinsing liquid comprises the following components: 100mmol/L NaCl, 10mmol/L Tris-HCl pH7.5, 75% -85% (preferably 80%) ethanol, 0.4% -0.6% (preferably 0.5%) Triton X-100,

the protease K solution, the lysis solution GHL, the magnetic bead suspension GH, the buffer GDZ and the elution buffer TB are from a DP705-1 magnetic bead kit of Tiangen Biochemical technology (Beijing) Co., Ltd;

in the fluorescent quantitative PCR method:

the sequence of the upstream primer Bos-ACTB-1F2 used for amplification is as follows: 5'-TTCTGAAGTGAACCTCATTCTGGG-3' (SEQ ID NO: 11), the sequence of the downstream primer Bos-ACTB-1R2 is 5'-CACCACAAGGGGCAGTCG-3' (SEQ ID NO: 12), and the sequence of the probe Bos-ACTB-P1 is: 5'-CGGCACACTCGGCTGTGTTCCTTGC-3' (SEQ ID NO: 3);

wherein:

the bovine hemoglobin product is prepared by the following method:

1) collecting bovine blood using a sterile container containing an anticoagulant;

2) washing the bovine blood by an ultrafiltration method after the bovine blood collection is finished;

3) separating the cells of the washed bovine blood by a centrifugation method or a membrane filtration method to obtain bovine red blood cells,

lysing the bovine blood erythrocytes to obtain a hemoglobin solution;

or, performing hemoglobin dissolution treatment on the washed bovine blood by a dissolution method to obtain a hemoglobin solution;

4) deoxidizing the hemoglobin solution to obtain a deoxidized hemoglobin solution, so as to stabilize the hemoglobin solution;

5) purifying the deoxygenated hemoglobin solution, thereby reducing non-specific blood cell components, wherein the purification is accomplished by chromatography;

6) ultrafiltering the purified deoxygenated hemoglobin solution through a 30,000Da hollow fiber membrane to a desired hemoglobin concentration, thereby stabilizing the purified deoxygenated hemoglobin solution;

7) ultrafiltering the deoxygenated purified hemoglobin solution obtained in step 6) through a 30,000Da hollow fiber membrane and exchanging the filtrate by diafiltration with a storage buffer comprising 2.63g/L trisodium phosphate dodecahydrate, 7.0g/L disodium phosphate heptahydrate, and 2.0g/L acetylcysteine;

8) crosslinking and polymerizing the deoxygenated and purified hemoglobin solution obtained in the step 7) with glutaraldehyde;

9) reducing the polymerized purified deoxyhemoglobin obtained in step 8) with sodium borohydride;

10) stabilizing the polymeric purified deoxyhemoglobin by subjecting the polymeric purified deoxyhemoglobin obtained in step 9) to diafiltration to obtain a polymeric hemoglobin solution;

11) filtering the polymerized hemoglobin solution obtained in the step 10) to obtain a final polymerized hemoglobin solution;

12) and filling the final polymerized hemoglobin solution by using a flexible bag or a penicillin bottle to obtain the bovine-derived hemoglobin product.

2. The detection method according to claim 1, wherein the 5 'end and the 3' end of the probe are each labeled with a compound, the 5 'end-labeled compound is selected from Fluorescein Isothiocyanate (FITC), Carboxyfluorescein (FAM), Hexachloro-6-methylfluorescein (HEX), and the 3' end-labeled compound is selected from 6-carboxytetramethylrhodamine (TAMRA) and broad spectrum quencher BHQ-1(Black HoleQuencer 1);

alternatively, the amplification reaction conditions are: pre-denaturation at 95 ℃ for 5min and denaturation at 94 ℃ for 30 sec; annealing at 58 ℃ for 30 seconds; 72 ℃ extension for 15 seconds, amplification for 40 cycles, and final 72 ℃ extension for 5 minutes.

3. The assay of claim 1, wherein, in the method of preparing said bovine hemoglobin product, the filtration of step 11) is a 0.5 μm depth filtration, a 0.2 μm sterile filtration, and at least one additional 0.2 μm sterile filtration;

or in the method for preparing the bovine hemoglobin product, the final hemoglobin solution is filled in a flexible bag or a penicillin bottle in a sterile and oxygen-free mode to obtain a product which can be stored for a long time.

4. The test method according to claim 1, wherein the centrifugation is performed under conditions of 12500XG for 25min at 10 ℃ in the preparation of the bovine-derived hemoglobin product, or the membrane filtration is performed to remove leukocytes, or the hemoglobin elution treatment is performed using a 20mOsm CSB buffer solution comprising 7.9g/L sodium chloride and 6.0g/L sodium citrate dihydrate.

5. The method of detecting according to claim 1, wherein the method of preparing said bovine-derived hemoglobin preparation comprises lysing said bovine red blood cells by: the bovine red blood cells were subjected to cell lysis and sequential diafiltration on 100kDa and 30kDa membranes.

6. The detection method according to claim 1, wherein in the method for preparing the bovine-derived hemoglobin preparation, in the step 4), the oxygen removal is performed by: pumping the hemoglobin solution through two liquid phase degassing membranes arranged in series at a flow rate of 500mL/min, flowing nitrogen in countercurrent at 75psi, removing oxygen until the dissolved oxygen reading is below 0.02 mg/mL;

alternatively, in the method of making the bovine-derived hemoglobin article, the deoxygenation further comprises the step of passing the deoxygenated hemoglobin solution through a 0.3 μm and at least one 0.22 μm depth filter after the deoxygenation.

7. The detection method according to claim 1, wherein, in the method for producing the bovine-derived hemoglobin product, the chromatography system is performed using a cepstrum SCG chromatography system equipped with a GE Healthcare XK borosilicate column (5cm I.D.. times.100 cm long) packed with an anion exchange packing, the bed height being 70 ± 5 cm;

alternatively, in the method of preparing the bovine hemoglobin product, the buffer of the chromatography system is prepared using water for injection and filtered through a 10kDa membrane to further reduce pyrogen content, the buffer comprising: (1) and (3) buffer solution A: 2.42g/L tris base, adjusted to pH 9.0. + -. 0.1, (2) buffer B: 6.05g/L Tris base, pH 7.0. + -. 0.1 adjusted, (3) buffer C: 2.42g/L Tris base, 58.38g/L NaCl, adjusted to pH 8.9. + -. 0.1.

8. The detection method according to claim 1, wherein in the method for preparing the bovine-derived hemoglobin preparation, the polymerization is carried out at a temperature of 42 ± 2 ℃, the concentration of glutaraldehyde solution is 6.2g/L, and the mass ratio of the glutaraldehyde to the deoxygenated purified hemoglobin is 0.037: 1;

alternatively, in the method of preparing the bovine hemoglobin product, the glutaraldehyde is added through a static mixer to ensure rapid and uniform mixing with the hemoglobin, and when the addition of the glutaraldehyde is complete, the temperature of the reaction mixture is cooled to below 25 ℃;

alternatively, in the method for preparing the bovine-derived hemoglobin product, the reaction mixture is subjected to diafiltration concentration through a 30,000Da hollow fiber membrane so that the hemoglobin concentration is 60-70 g/L.

9. The assay of claim 1, wherein, in the method of preparing said bovine hemoglobin product, said aqueous solution of sodium borohydride comprises 9.45g/L sodium borohydride, 4.58g/L sodium borate decahydrate, and 0.91g/L sodium hydroxide, said aqueous solution of sodium borohydride is filtered through a 10,000Da membrane to reduce pyrogen content;

or, in the method for preparing the bovine hemoglobin product, in the step 9), the aqueous solution of sodium borohydride is mixed with the polymerization purified deoxyhemoglobin solution obtained in the step 8) under the conditions that the temperature is 18-25 ℃ and the flow rate is 7 ml/min;

or, in the method for preparing the bovine-derived hemoglobin product, in the step 10), the polymerized and purified deoxyhemoglobin obtained in the step 9) is concentrated by a 30kd ultrafiltration membrane until the concentration of the hemoglobin is 100 +/-5 g/L.

10. The method of detecting according to claim 1, wherein in the method of preparing said bovine-derived hemoglobin preparation, said washing of said bovine blood is performed by: pumping anticoagulated bovine blood at a flow rate of 200-.

Technical Field

The invention relates to the field of molecular biology, in particular to a quantitative detection method for bovine-derived genomic DNA in a bovine hemoglobin product and application thereof.

Background

With the development of biotechnology, a number of genetically cloned proteins have been cloned via prokaryotes, such as E.coli, simple eukaryotes, such as Pichia pastoris, and mammalian cells, such as the Chinese hamster ovary cell line (CHO), the HEK293 cell line from human kidney, the Vero cell line from Vero cells and the murine myeloma cell line NS 0. The expression of cytokines, polypeptide hormones, enzymes and antibodies can be accomplished using these recombinant expression systems. These expression systems are sometimes difficult to work with proteins that are long in amino acid sequence, conformationally specialized, have complex higher order structures, and particularly form native complexes, particularly, the proteins have rich natural sources, the effect and the cost of the production of the natural source proteins through extraction and purification are easier to control, the biochemical medicaments which take viscera, blood and tissues of animals such as pigs, cows, sheep and the like as raw materials also occupy a certain market in the medical market, in the production process of the biological products of animal origin, on one hand, the traceable analysis of animal species and tissue characteristics is needed, the incorporation of animal materials of other sources in the production is prevented to ensure that the produced medicaments have good consistency, and simultaneously, it is also desirable to control the DNA residual of the raw animal (host) in the product produced so that it does not enter the body causing unpredictable toxic side effects.

TaqMan^TMThe probe method, as a newly developed technology, has the advantages of high sensitivity, good specificity, simple operation and accurate quantification, and thus becomes a preferred method in the field. Nucleic acid detection aiming at material source control is concerned with detection of animal-derived components of unexpected origin, and the selected gene is mostly from mitochondrial genes or fragments of related animals, similar to food adulteration, because the mitochondrial copy number of the non-nuclear gene is high, the detection is easyAnd mitochondria have a plurality of highly variant regions, such as cytochrome B coding gene cytb, cytochrome C oxidase I gene CoxI, ATP synthesis related genes ATP6, ATP8, 12S RNA gene, highly variant d-loop region, etc. The detection method mainly comprises a traditional dye method, a probe method and various test strip methods.

For recombinant protein drugs and vaccine products, two residual DNA detection methods are specified in the 3407 general rule of the 2015 edition of Chinese pharmacopoeia, the first method is a DNA probe hybridization method, the second method is a fluorescent staining method, but for probes originally used for specific hosts or species in the two methods, the expected detection sensitivities are respectively 100pg/100 mu l (probe method) and 1.25ng/ml (dye method), and the method and the detection principle are limited, and the sensitivity, the precision and the quantitative accuracy are limited when large-dose biological and biochemical preparations are detected. In practical application, the existing relevant standards for identifying the PCR species of pigs, cattle and sheep refer to the industrial standard of Chinese entry-exit inspection and quarantine. The actual two methods (pharmacopoeia and entry-exit inspection and quarantine industry standard) are different from sample detection to application purposes, the pharmacopoeia stipulates that a detection target is genome DNA of a host and needs quantification to judge residual conditions, entry-exit quality inspection aims at detection, mitochondrial DNA is mostly adopted as a target to improve detection sensitivity, and the magnitude relation corresponding to the genome DNA is difficult to realize. Therefore, a third method for quantitative detection of residual DNA, namely a quantitative PCR probe method, is specifically specified in the third method public manuscript of general rule 3407 exogenous DNA residual quantity determination of the fourth pharmacopoeia of the chinese pharmacopoeia commission, published in 2019, 6 months, and primers and probe sequences used in the quantitative PCR method of the probe method of biological products derived from CHO cells, Vero cells, NS0, escherichia coli, pichia and the like are specified.

The TaqMan method uses an oligonucleotide Taman probe with specific sequence, the 5 'end and the 3' end of which are respectively marked by fluorescence and a quenching agent and a pair of primers with specific sequence to complete the detection. FIG. 1 shows the operation principle of TaqMan probe method, in which the TaqMan probe method utilizes the 5 '-exonuclease activity of thermostable polymerases such as Taq DNApolymerase or Tth DNApolymerase, when the probe is bound to an amplification product, the 5' end of the probe is cleaved to quench the fluorescent group, the reporter group emits light and is detected, the generated fluorescent signal is proportional to the amount of the amplification product in the sample, and the Ct value (threshold cycle number) of the amplification can be used to calculate the number of templates in the reaction, thereby determining the initial concentration.

The oxygen-carrying hemoglobin prepared by separating, extracting and subsequently processing and purifying the oxygen-carrying hemoglobin has important application and economic value as a substitute of red blood cells. Since the unstable tetramer can be dissociated to cause various side effects by initially using human hemoglobin without any modification, the research in the future mostly takes the stable polymer formed by crosslinking as the development direction. There is no reliable method for detecting bovine genomic DNA remaining in the product.

For the source determination of biochemical medicines, foods and feeds from cattle, in the past, the industrial standard method of import and export inspection and quarantine is mainly used, and the method is more suitable for tracing the raw materials of processed foods and feeds. The invention patent with the application number of CN201310670600.4 discloses a detection method for species identification by amplifying bovine mitochondrial fragments, wherein the detection method is easy to obtain although mitochondrial DNA copy number is high, and the detection method uses a colloidal gold test strip to replace electrophoresis, thereby simplifying the experiment. The invention patent with publication number CN110305973A discloses a TaqMan probe method for quantitatively detecting DNA content in fresh meat and products, namely a primer, a probe and a kit for synchronously detecting bovine and donkey sources, and similarly, the method takes mitochondrial DNA as a detection gene, and aims to distinguish the sources of food raw materials such as bovine, donkey, chicken and the like, and because the detection mitochondrial DNA cannot represent the content of genomic DNA, a quantitative detection method taking nuclear genes as targets needs to be developed. The invention discloses a kit for rapidly identifying bovine-derived components in food and application thereof (publication No. CN 109825609A). A rapid detection method is established by taking ighmbp2 gene of bovine genomic DNA as a standard gene, and the method uses a test strip to complete qualitative detection, cannot realize quantitative analysis of the genomic DNA, and therefore cannot be used for detecting residual host DNA in pharmaceutical protein.

For quantitative detection of genome DNA, detection of single copy gene is preferred, and the gene has no too much variation and can be clearly distinguished from other species. Although various genes can be selected, the coding genes of the common reference genes beta-Actin and GAPDH are still preferred target genes, especially beta-Actin. Cai et al, which aims at the cattle beta-Actin gene, establish a quantitative PCR detection method based on the TaqMan probe method to distinguish cattle and mutton from other sources of foods (Yijun Cai et al, Meat Science 134(2017) 119-123, intercalary evaluation of area-time PCR detection method for bouine and over-derived material), which has good Meat product source DNA identification capability and sensitivity, and also designs a multiplex PCR detection method aiming at the beta 0 action gene, the physical culture and the like, so as to realize DNA detection of three times of continuous 10-fold dilution, and the lowest detection limit reaches 0.048 ng/reaction (China journal of bioengineering, 2017, 37(9)48-59. establishment of a method for synchronously and quantitatively detecting 6 animal-derived components by Taqman multiplex real-time fluorescence PCR). Rene' Ko focused on animal meat identification, and established a detection method for distinguishing common meat (Eur Food Res Technol (2011)232: 151-155. multiple real-time PCR for the detection and quantification of DNA from bean, pork, horse and other). For protein products extracted from bovine blood, detection of residual bovine DNA in the protein products needs to have high specificity, can be distinguished from common pharmaceutical protein production host cells and human-derived DNA susceptible to detection interference due to the pharmaceutical protein production host cells, needs to have sufficient sensitivity, can realize detection of low-concentration samples, and finally needs to have certain precision and detection recovery rate in order to realize accurate DNA quantification. However, the sequences of primers and probes used in the above research papers are mainly for identification purposes, and are targeted for food-derived meat in terms of specific design targets, there is no sufficient consideration for the recovery rate and the linear range of detection, and the primers and probes designed in the above documents are not effective for discriminating common drug-producing cells.

Therefore, further research is needed for the quantitative detection method of bovine genomic DNA in bovine hemoglobin products.

Disclosure of Invention

The present application is based on the discovery and recognition by the inventors of the following facts and problems:

firstly, the method comprises the following steps:

for the preparation of bovine genomic DNA from a conventional sample, e.g. a conventional blood, cell or tissue sample, e.g. bovine Meat samples can be prepared by conventional animal sample genomic DNA preparation methods or commercial kits, as embodied by the invention In the example 1, DNA in beef can be extracted by a column centrifugal method to obtain DNA with required quality. However, the inventors have discovered The same method is not effective for extracting residual DNA of drug protein. Moreover, even if the Tiangen Biochemical technology is changed (North) Jing) company DP705-1 magnetic bead kit, due to the residual in the high concentration protein sample The incomplete removal of the components results in serious PCR reaction inhibition, and the use requirements cannot be met at all.

Based on the discovery of the problems, the inventor provides a new extracted cow through a great amount of innovative experiments Method for preparing DNA from hemoglobin product by using DP705-1 magnetic bead reagent of Tiangen Biochemical technology (Beijing) Ltd The extraction method of the box is based on that only the rinsing liquid in the box is replaced, and the composition of the replaced rinsing liquid is 100mmol/L NaCl, 10mmol/LTris-HCl pH7.5, 75% -85% ethanol, and 0.4% -0.6% Triton X-100.

In one aspect, the inventors have found that 0.01pg of incorporated plasmid is undetectable in the original rinse formulation, and that improved rinsing The liquid formulation can stably detect 0.001pg doped plasmid, eliminate the matrix effect brought by the sample and realize the detection of the sample The magnitude of the sensitivity is improved. It can be seen that only by biochemical science and technology of Tiangen (North) in comparison with the original rinsing liquid protocol Jing) company DP705-1 magnetic bead kit, the rinsing liquid PWD is replaced by the rinsing liquid of the application, but the detection sensitivity is realized The sensitivity is obviously improved (at least two orders of magnitude), an unexpected technical effect is achieved, and the method is used for the prior artGo out of essence A sexual contribution.

On the other hand, it is well known to those skilled in the art that in conventional PCR, in some cases, the PCR product may be added to a buffer solution Chemical additives or auxiliary solvents to improve amplification specificity by reducing mismatches and to improve amplification by removing secondary structures ²⁺Efficiency. However, it should be noted that the use of chemical additives or co-solvents may affect primer annealing, template denaturation, Mg binding to And enzyme activity. At the same time, they can interfere with certain downstream applications-for example, the drying of nonionic detergents in gene chip experiments And (4) disturbing. Therefore, buffer composition and its concentration should be carefully considered for successful PCR amplification and downstream experimental applications. To pair Conventional chemical additives or auxiliary solvents and their recommended concentrations are indicated in the table below for the person skilled in the art.

The contents of the above table can be found in the literature: bartlett JMS, Stirling D (2003) pcrprotocols. in: methodsin molecular biology (2nd ed.) Totowa: Humana Press, or, see the following website:

https://www.thermofisher.com/cn/zh/home/life-science/cloning/cloning- learning-center/invitrogen-school-of-molecular-biology/pcr-education/pcr- reagents-enzymes/pcr-component-considerations.html

as can be seen from the above table, in the conventional PCR, the recommended concentration of Tritonx-100 is 0.05-0.1%, because of the high concentration The stain interferes with the function of Taq DNA polymerase, etc. Thus, as is conventionally understood by those skilled in the art, if modified The rinsing liquid formula contains Tritonx-100 with concentration higher than 0.05-0.1%, and partial residue is possible to cause Interference of paired amplification, therefore, Trit should be avoided as much as possibleonx-100 is present at a concentration above 0.1%.

However, the inventors of the present application have revolutionized the adjustment of Triton X-100 concentrations to 0.4-0.6% (e.g., to 0.5%), much higher than the recommended concentration of Tritonx-100 (0.05-0.1%), and surprisingly found that improvements using the present invention The rinsing liquid is rinsed twice, each time 250 mu L, not only does not interfere the amplification, but also realizes the detection sensitivity Significantly improved (at least two orders of magnitude). Therefore, compared with the prior art, the improved extraction method of the invention not only has the advantages of The method is non-obvious and achieves unexpected technical effects, and makes outstanding substantial contribution to the prior art.

Secondly, the method comprises the following steps:

in the fluorescent quantitative PCR method, the inventor designs and synthesizes four groups of primer probe combinations which are respectively primer probe combinations 1. A primer probe combination 2, a primer probe combination 3 and a primer probe combination 1-1. Finally, the inventors selected primer-probe combination 1-1 PCR amplification was performed (upstream primer sequence: 5'-TTCTGAAGTGAACCTCATTCTGGG-3', downstream primer sequence 5- CACCACAAGGGGCAGTCG-3', the probe sequence is: 5'-CGGCACACTCGGCTGTGTTCCTTGC-3') because:

first, the inventor finds that in a Taqman probe method qPCR system, a primer probe combination 1 and a primer probe combination 2 The amplification efficiencies were 87% and 96%, respectively, while the amplification efficiency of primer probe set 3 was only 77%, thus, primer probe set 1 And 2, compared with the primer probe combination 3, the amplification efficiency is obviously higher.

Secondly, the inventors found that the amplification efficiency of the primer probe combination 2 in amplification is lower than 0.01 ng/. mu.L The decrease was rapid and also an amplification signal appeared after a Ct of 33 for the No Template Control (NTC). As can be seen, primer Probe combination 2 Although slightly more efficient than the amplification of primer-probe combination 1, non-specific amplification may occur, interfering with the results at low concentrations, and detection The sensitivity is reduced, and the actual detection requirement cannot be met.

Thirdly, the inventor finds thatFine tuning of the sequence of primer-probe combination 1 (extension of the length of the amplification product) The length is about 100bps, the distance between the 3 'end of the upstream primer and the fluorescence labeled base at the 5' end of the labeled probe is shortened to 2 nucleotides The position of the primers which are adjusted to be more different from the human gene sequence) is obtained, the specificity is strong, the amplification efficiency is high, and more importantly, the Ct value-template concentration curve can be used for templates with the concentration of less than 0.0001 pg/mu l Efficient detection, good linearity, no amplification signal at all times without template control (NTC), and lowest template detection concentration as low as 1 × 10- ^{7 2}ng/mu L, compared with the primer probe combination 2 (the sensitivity is only 10-ng/mu L), the sensitivity is improved by at least 5 orders of magnitude, and the method achieves Unexpected technical effects are achieved, and substantial contribution is made to the prior art.

To this end, in a first aspect of the present invention, the present invention provides a fluorescent quantitative PCR method for detecting bovine genomic DNA in a bovine hemoglobin product, comprising:

extracting DNA from said bovine hemoglobin preparation, and

carrying out amplification detection on the extracted DNA by using a fluorescent quantitative PCR method;

wherein:

the extraction comprises the following steps:

1) adding 20 mu L of protease K solution and 300 mu L of lysate GHL into a 2ml centrifuge tube every 250 mu L of the bovine hemoglobin product, uniformly mixing by oscillation, performing lysis at 75 ℃ for 15min, and reversely mixing for 3 times every 5 times;

2) adding 300 mu L of isopropanol into the product obtained in the step 1), uniformly mixing by oscillation for 10sec, adding 15 mu L of magnetic bead suspension GH, uniformly mixing by oscillation for 1min, standing for 9min totally, and uniformly mixing by oscillation for 1min every 3 min; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

3) adding 900 mu L buffer GDZ into the product obtained in the step 2), and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

4) adding 500 mu L of buffer GDZ into the product obtained in the step 3), and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

5) taking the 2ml centrifuge tube off the magnetic frame, adding 250 mu L rinsing liquid, and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

6) taking the 2ml centrifuge tube off the magnetic frame, adding 250 mu L rinsing liquid, and uniformly mixing for 2min by oscillation; then placing the 2ml centrifugal tube on a magnetic frame and standing for 30sec, and adsorbing liquid after the magnetic beads are completely adsorbed;

7) placing the 2ml centrifuge tube on a magnetic frame, airing for 10-15min at room temperature, taking the 2ml centrifuge tube off the magnetic frame, adding 50-100 mu L of elution buffer TB, uniformly mixing by oscillation, incubating for 10min at 56 ℃, and reversely mixing for 3 times, wherein each time is 3-5 times;

8) placing the 2ml centrifuge tube on a magnetic frame, standing for 2min, and transferring the DNA solution to a new centrifuge tube after the magnetic beads are completely adsorbed to obtain a DNA extracting solution;

the bovine hemoglobin product has a volume of at least 2mL,

the rinsing liquid comprises the following components: 100mmol/L NaCl, 10mmol/L Tris-HCl pH7.5, 75% -85% (preferably 80%) ethanol, 0.4% -0.6% (preferably 0.5%) Triton X-100,

the protease K solution, the lysis solution GHL, the magnetic bead suspension GH, the buffer GDZ and the elution buffer TB are from a DP705-1 magnetic bead kit of Tiangen Biochemical technology (Beijing) Co., Ltd;

in the fluorescent quantitative PCR method:

the sequence of the upstream primer Bos-ACTB-1F2 used for amplification is as follows: 5'-TTCTGAAGTGAACCTCATTCTGGG-3' (SEQ ID NO: 11), the sequence of the downstream primer Bos-ACTB-1R2 is 5'-CACCACAAGGGGCAGTCG-3' (SEQ ID NO: 12), and the sequence of the probe Bos-ACTB-P1 is: 5'-CGGCACACTCGGCTGTGTTCCTTGC-3' (SEQ ID NO: 3);

wherein:

the bovine hemoglobin product is prepared by the following method:

1) collecting bovine blood using a sterile container containing an anticoagulant;

2) washing the bovine blood by an ultrafiltration method after the bovine blood collection is finished;

3) carrying out cell separation on the washed bovine blood by a centrifugation method or a membrane filtration method to obtain bovine red blood cells, and cracking the bovine red blood cells to obtain a hemoglobin solution;

or, performing hemoglobin dissolution treatment on the washed bovine blood by a dissolution method to obtain a hemoglobin solution;

4) deoxidizing the hemoglobin solution to obtain a deoxidized hemoglobin solution, so as to stabilize the hemoglobin solution;

5) purifying the deoxygenated hemoglobin solution, thereby reducing non-specific blood cell components, wherein the purification is accomplished by chromatography;

6) ultrafiltering the purified deoxygenated hemoglobin solution through a 30,000Da hollow fiber membrane to a desired hemoglobin concentration, thereby stabilizing the purified deoxygenated hemoglobin solution;

7) ultrafiltering the deoxygenated purified hemoglobin solution obtained in step 6) through a 30,000Da hollow fiber membrane and exchanging the filtrate by diafiltration with a storage buffer comprising 2.63g/L trisodium phosphate dodecahydrate, 7.0g/L disodium phosphate heptahydrate, and 2.0g/L acetylcysteine;

8) crosslinking and polymerizing the deoxygenated and purified hemoglobin solution obtained in the step 7) with glutaraldehyde;

9) reducing the polymerized purified deoxyhemoglobin obtained in step 8) with sodium borohydride;

10) stabilizing the polymeric purified deoxyhemoglobin by subjecting the polymeric purified deoxyhemoglobin obtained in step 9) to diafiltration to obtain a polymeric hemoglobin solution;

11) filtering the polymerized hemoglobin solution obtained in the step 10) to obtain a final polymerized hemoglobin solution;

12) and filling the final polymerized hemoglobin solution by using a flexible bag or a penicillin bottle to obtain the bovine-derived hemoglobin product.

In the composition of the rinsing liquid, "75% to 85% ethanol" means that the volume of ethanol is 75 to 85mL per 100mL of the rinsing liquid. "0.4% -0.6% Triton X-100" is understood in the same manner.

In some embodiments, the probe is labeled at the 5 'end and the 3' end with a compound, the 5 'end labeled compound is selected from Fluorescein Isothiocyanate (FITC), Carboxyfluorescein (FAM), Hexachloro-6-methylfluorescein (HEX), and the 3' end labeled compound is selected from 6-carboxytetramethylrhodamine (TAMRA) and broad spectrum quencher BHQ-1(Black HoleQuencer 1).

In some embodiments, the amplification reaction conditions are: pre-denaturation at 95 ℃ for 5min and denaturation at 94 ℃ for 30 sec; annealing at 58 ℃ for 30 seconds; 72 ℃ extension for 15 seconds, amplification for 40 cycles, and final 72 ℃ extension for 5 minutes.

In some embodiments, the method of preparing the bovine-derived hemoglobin preparation, the filtration in step 11) is a 0.5 μm depth filtration, a 0.2 μm sterile filtration, and at least one additional 0.2 μm sterile filtration.

In some embodiments, in the method for preparing the bovine hemoglobin product, the final hemoglobin solution is filled in a flexible bag or vial in a sterile and oxygen-free manner to obtain a product that can be stored for a long period of time.

In some embodiments, the method of preparing the bovine-derived hemoglobin preparation, the centrifugation is performed under conditions of 12500XG for 25min at 10 ℃, or the membrane filtration is performed to achieve the cell separation by way of leukocyte removal, or the hemoglobin dissolution treatment is performed using a 20mOsm CSB buffer comprising 7.9g/L sodium chloride and 6.0g/L sodium citrate dihydrate.

In some embodiments, in the method of preparing the bovine-derived hemoglobin preparation, the lysing the bovine red blood cells is performed by: the bovine red blood cells were subjected to cell lysis and sequential diafiltration on 100kDa and 30kDa membranes.

In some embodiments, in the method of preparing the bovine-derived hemoglobin preparation, in step 4), the oxygen removal is performed by: the hemoglobin solution was pumped through two liquid phase degassing membranes arranged in series at a flow rate of 500mL/min, with a counter current flow of nitrogen at 75psi, and oxygen removed until the dissolved oxygen reading was below 0.02 mg/mL.

In some embodiments, the method of making the bovine-derived hemoglobin article further comprises, after deoxygenating, the step of passing the deoxygenated hemoglobin solution through a 0.3 μm and at least one 0.22 μm depth filter.

In some embodiments, in the method of making the bovine-derived hemoglobin preparation, the chromatography system is performed using a cepstrum SCG chromatography system equipped with a GE Healthcare XK borosilicate column (5cm i.d. × 100cm long) packed with anion exchange packing, with a bed height of 70 ± 5 cm.

In some embodiments, in the method of preparing the bovine-derived hemoglobin preparation, the buffer of the chromatography system is prepared using water for injection and filtered through a 10kDa membrane to further reduce pyrogen content, the buffer comprising: (1) and (3) buffer solution A: 2.42g/L tris base, adjusted to pH 9.0. + -. 0.1, (2) buffer B: 6.05g/L Tris base, pH 7.0. + -. 0.1 adjusted, (3) buffer C: 2.42g/L Tris base, 58.38g/L NaCl, adjusted to pH 8.9. + -. 0.1.

In some embodiments, in the method of making the bovine-derived hemoglobin preparation, the polymerization is carried out at a temperature of 42 ± 2 ℃, the concentration of glutaraldehyde solution is 6.2g/L, and the mass ratio of glutaraldehyde to deoxygenated purified hemoglobin is 0.037: 1.

In some embodiments, in the method of making the bovine-derived hemoglobin preparation, the glutaraldehyde is added through a static mixer to ensure rapid and uniform mixing with the hemoglobin, and when the addition of the glutaraldehyde is complete, the temperature of the reaction mixture is cooled to below 25 ℃.

In some embodiments, the method of making the bovine-derived hemoglobin preparation, the reaction mixture is concentrated by diafiltration through a 30,000Da hollow fiber membrane to a hemoglobin concentration of 60-70 g/L.

In some embodiments, in the method of making the bovine-derived hemoglobin preparation, the aqueous solution of sodium borohydride comprises 9.45g/L of sodium borohydride, 4.58g/L of sodium borate decahydrate, and 0.91g/L of sodium hydroxide, which is filtered through a 10,000Da membrane to reduce pyrogen content.

In some embodiments, in the method for preparing the bovine-derived hemoglobin preparation, in step 9), the aqueous solution of sodium borohydride is mixed with the polymerization-purified deoxyhemoglobin solution obtained in step 8) at a temperature of 18 to 25 ℃ and a flow rate of 7 ml/min.

In some embodiments, in the method for preparing the bovine-derived hemoglobin preparation, in step 10), the polymerization-purified deoxyhemoglobin obtained in step 9) is concentrated by a 30kd ultrafiltration membrane to a hemoglobin concentration of 100 ± 5 g/L.

In some embodiments, in the method of preparing the bovine-derived hemoglobin preparation, the washing the bovine blood is performed by: pumping anticoagulated bovine blood at a flow rate of 200-.

Technical terms used in the description of the present invention are explained:

primer: starting material for DNA synthesis. Typically a pair of single-stranded oligonucleotides, and after hybridization to the template, DNA synthesis begins at its 3' end.

Marking: methods for coupling detectable signal molecules (e.g., haptens, fluorescence, radioactivity, etc.) to single-stranded oligonucleotides.

Nucleic acid (A): the generic names deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Probe DNA: the invention relates to a single-stranded DNA molecule capable of being specifically combined with a PCR product, which adopts the principle of a TaqMan probe, wherein a fluorescent group is marked at the 5 'end of the TaqMan probe, a quenching group is marked at the 3' end of the TaqMan probe, the quenching group quenches the self fluorescence when the TaqMan probe is in a non-reaction state, and after the TaqMan probe is combined with a template, exonuclease cuts off a base with the fluorescent group, the quenching is eliminated, and a fluorescent signal is emitted.

Ct value: threshold cycle number, the number of amplification cycles at which the fluorescent signal generated in one PCR reaction reaches a set threshold.

Advantageous effects

1. The invention is a detection method for carrying out quantitative analysis on host residual DNA in a biological product by using a TaqMan probe method, and can realize accurate quantitative analysis on bovine genomic DNA (deoxyribonucleic acid) residual in a protein product extracted from a bovine by carrying out quantitative detection on beta-actin gene in the bovine genomic DNA, thereby reducing the risk of using medicaments;

2. and (3) fast: the detection process of the detection method is completed within 60 minutes;

3. sensitivity: the limit of quantification of the detection method of the invention can reach 0.1ng genome DAN/reaction.

4. The linear range is wide: the linear range of the detection method can reach 10⁹The sample preparation process can be simplified, and experimental links can be reduced;

5. low cross reaction: the detection method has low cross reaction with common miscible species, and has no cross reaction with human, CHO (Chinese hamster ovary) and mouse species.

Drawings

FIG. 1 is the principle of TaqMan probe method for detecting bovine genomic DNA;

FIG. 2 shows the extraction and quality control of standard bovine genomic DNA, wherein M is DNA molecular weight marker, 1kb ladder (TaKaRa), Bov-DNA: preparing bovine genome DNA lipo-glycogel;

FIG. 3 is a sequence determination of amplified bovine beta-actin gene fragment;

fig. 4 is a melting curve for different primer-probe combination amplifications, where, left: combination 1; the method comprises the following steps: combination 2; and (3) right: combination 3;

FIG. 5 is a Ct-concentration curve of primer probe combination 2(SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7) against a positive plasmid serial dilution template;

FIG. 6 is a Ct-concentration curve of primer probe combinations 1-1(SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 3) against positive plasmid serial dilution template;

FIG. 7 is a Ct-concentration curve for a positive plasmid serial dilution template;

FIG. 8 is a pictorial view of a farm of cattle according to an embodiment of the present invention;

FIG. 9 is a live-action view of collected bovine blood according to an embodiment of the present invention;

FIG. 10 is a schematic flow chart of washing the collected blood according to an embodiment of the present invention;

FIG. 11 is a schematic diagram of a membrane filtration field test exploration according to an embodiment of the present invention;

FIG. 12 is a schematic flow diagram of a membrane filtration process according to an embodiment of the present invention;

FIG. 13 is a schematic illustration of a dissolution process field trial exploration, in accordance with an embodiment of the present invention;

FIG. 14 is a schematic flow diagram of a dissolution process according to an embodiment of the invention;

FIG. 15 is a schematic flow diagram of cell lysis and diafiltration according to an embodiment of the invention;

FIG. 16 is a schematic flow diagram of filtered deoxygenation according to an embodiment of the present invention;

FIG. 17 is a schematic flow diagram of chromatographic purification of hemoglobin according to an embodiment of the present invention;

FIG. 18A is a schematic flow chart illustrating deoxygenation of purified hemoglobin according to an embodiment of the present invention;

FIG. 18B is a schematic flow chart illustrating deoxygenation of purified hemoglobin according to an embodiment of the present invention;

FIG. 19A is a schematic flow chart of the polymerization of purified hemoglobin with glutaraldehyde according to an embodiment of the present invention;

FIG. 19B is a schematic diagram of a process for reducing glutaraldehyde-crosslinked hemoglobin with sodium borohydride in accordance with an embodiment of the present invention;

FIG. 20 is a schematic view of a gas residue-free canning apparatus according to an embodiment of the present invention;

FIG. 21 is a schematic view of a canned product according to an embodiment of the invention;

FIG. 22A is a schematic diagram showing the homology between the subunit alpha human and bovine amino acid sequences contained in hemoglobin consisting of a stabilized hemoglobin solution according to an embodiment of the present invention;

FIG. 22B is a schematic diagram showing the amino acid sequence homology between human and bovine subunits contained in hemoglobin from a stabilized hemoglobin solution according to an embodiment of the present invention;

FIG. 23 is a schematic flow chart of washing collected blood according to an embodiment of the present invention;

FIG. 24 is a schematic flow chart of cell lysis according to an embodiment of the present invention;

FIG. 25 is a schematic flow diagram of filtered deoxygenation according to an embodiment of the present invention;

FIG. 26 is a schematic flow diagram of chromatographic purification of hemoglobin according to an embodiment of the present invention;

FIG. 27A is a schematic flow chart illustrating deoxygenation of purified hemoglobin according to an embodiment of the present invention;

FIG. 27B is a schematic flow chart illustrating deoxygenation of purified hemoglobin according to an embodiment of the present invention;

FIG. 28 is a schematic flow chart of the polymerization of purified hemoglobin with glutaraldehyde according to an embodiment of the present invention;

FIG. 29 is a schematic diagram of a process for reducing glutaraldehyde-crosslinked hemoglobin with sodium borohydride in accordance with an embodiment of the present invention;

FIG. 30 is a schematic view of an aseptic filtration process according to an embodiment of the present invention;

fig. 31 is a schematic diagram of an aseptic and anaerobic filling system for performing a vial filling operation on hemoglobin according to an embodiment of the present invention;

FIG. 32 is an enlarged view of a portion of the structure of FIG. 31;

fig. 33 is a schematic diagram of an aseptic and anaerobic filling system for performing a vial filling operation on hemoglobin according to an embodiment of the present invention;

fig. 34 is a schematic diagram of an aseptic and anaerobic filling system for performing a vial filling operation on hemoglobin according to an embodiment of the present invention;

FIG. 35 is an image of a separation system used in the method of red blood cell purification according to an embodiment of the present invention;

FIG. 36 is a schematic view of a separation system used in the method for purifying erythrocytes according to the embodiment of the present invention;

FIG. 37 is an image of an aggregation assembly according to an embodiment of the present invention;

FIG. 38 is a tomographic field image of an embodiment of the present invention;

FIG. 39 is a graph showing the results of detection of column effect before sample application in accordance with the embodiment of the present invention;

FIG. 40 is a graph image of tomographic 1 data according to an embodiment of the present invention;

FIG. 41 is a graph image of tomographic 2 data according to an embodiment of the present invention;

FIG. 42 is an image of SDS-PAGE purity measurement of a sample collected by chromatography 2 according to example of the present invention, wherein 1 indicates C500, 2 indicates AEX breakthrough 1, 3 indicates AEX breakthrough 2, 4 indicates AEX washing peak, 5 indicates AEX elution peak, 6 indicates AEX elution peak tail, 7 indicates AEX regeneration peak, and 8 indicates Marker;

FIG. 43 is an image of a primary filter arrangement according to an embodiment of the invention;

FIG. 44 is a schematic view of a primary filtration apparatus according to an embodiment of the present invention;

FIG. 45 is an image of an assembly for a 100KD diafiltration process according to an embodiment of the present invention;

FIG. 46 is a schematic diagram of components used in a 100KD diafiltration process according to an embodiment of the present invention;

FIG. 47 is an image of a module for a 30KD diafiltration concentration process according to an embodiment of the present invention;

FIG. 48 is an image of an assembly for degassing membrane deoxygenation treatment in accordance with an embodiment of the present invention;

FIG. 49 is a schematic view of an assembly for degassing membrane deoxygenation treatment in accordance with an embodiment of the present invention;

FIG. 50 is a design drawing for commercial scale production of an embodiment of the present invention;

FIG. 51 is a negative-level warehouse layout of an embodiment of the present invention;

FIG. 52 is a diagram of a two-level QC, development, utility room design according to an embodiment of the present invention;

fig. 53 is an EDQM certificate image obtained by a farm collecting bovine blood according to an embodiment of the present invention.

Detailed Description

The following detailed description of embodiments of the invention is intended to be illustrative, and is not to be construed as limiting the invention.

As used herein, unless otherwise indicated herein or otherwise evident from the context, the term "about" is to be understood as within the normal tolerance of the art, e.g., within 2 standard deviations of the mean. "about" can be understood as being within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05% or 0.01% of the stated value. Unless the context indicates otherwise, all numbers provided herein are to be modified by the term "about".

The phrase "aberrantly expressed" is used to refer to an expression level that deviates from (i.e., increases or decreases in expression level of) a normal reference expression level of a gene.

The term "agent" refers to any small protein or other compound, antibody, nucleic acid molecule or polypeptide, or fragment thereof.

"alteration" refers to a change (increase or decrease) in the molecular weight distribution of a stabilization technique or reaction, as detected by standard art-known methods such as those described herein. As used herein, a change includes at least a 5% change in the level of crosslinking, for example at least a 5% to 95% or 100% change in the level of stabilization of the crosslinking molecule. For example, the alteration comprises at least a 5% -10% change in protein stability, preferably a 25% change, more preferably an 80% change, and most preferably a 590% or greater change in the size of the stabilizing molecule.

"improving" refers to reducing, inhibiting, attenuating, reducing, arresting or stabilizing the development or progression of a disease.

The term "antibody" (Ab) as used herein includes monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired biological activity. The term "immunoglobulin" (Ig) is used interchangeably herein with "antibody".

By "binding" a molecule is meant having a physicochemical affinity for the molecule.

"control" or "reference" refers to a comparative standard. In one aspect, as used herein, a sample or subject that is "altered as compared to a control" is understood to have a level that is statistically different from a normal, untreated or control sample. Control samples include, for example, cells in culture, one or more laboratory test animals, or one or more human subjects. Methods of selecting and testing control samples are within the ability of those skilled in the art. The analyte may be a naturally occurring substance that is expressed or produced by a cell or organism (e.g., an antibody, a protein), or a substance that is produced by a reactive substance to form a covalent bond (e.g., glutaraldehyde). The amount of change and the measured value may vary depending on the method used for detection. The determination of statistical significance is within the ability of those skilled in the art, e.g., the number of standard deviations from the mean that constitute a positive result.

"detecting" refers to identifying the presence, absence, or amount of an agent to be detected, e.g., a nucleic acid molecule, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

"detectable label" refers to a composition that, when attached (e.g., directly or indirectly) to a molecule of interest, allows the latter to be detected, for example, by spectroscopic, photochemical, biochemical, immunochemical, or other chemical means. Direct labeling may occur through a bond or interaction linking the label to the molecule, while indirect labeling may occur through the use of a linker or bridging moiety that is directly or indirectly labeled.

The "detecting step" can use any of a variety of known methods to detect the presence of a nucleic acid (e.g., methylated DNA) or polypeptide. Types of detection methods in which probes may be used include Western blots, Southern blots, dot or slot blots and Northern blots.

The terms "effective amount" and "therapeutically effective amount" of a formulation or formulation component refer to a sufficient amount of the formulation or component, alone or in combination, to provide the desired effect. For example, an "effective amount F" refers to the amount of a compound, alone or in combination, required to ameliorate the symptoms of anemia and/or iron deficiency relative to an untreated patient. The effective amount of active compound for use in the practice of the present invention for the therapeutic treatment of a disease will depend on the mode of administration, the age, weight and general health of the subject. Finally, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. Such an amount is referred to as an "effective" amount.

The term "fragment" refers to a portion of a protein molecule. This portion preferably comprises at least the molecule of hemoglobin or the heme iron portion of the original protein construct. For example, the fragment may comprise 1, 2 or 4 side chains of the native hemoglobin molecule and of the beta fragment. However, the present invention also includes such protein fragments so long as they exhibit the desired biological activity from the full-length globular protein structure, e.g., in many embodiments of the invention including illustrative polyamino acid fragments of total weight of about 16000kD, about 32000kD (including all intermediate weights). Similarly, if the protein fragment is a siderophore (heme group), protein fragments of almost any length are used.

The terms "isolated," "purified," or "biologically pure" refer to a material that is not associated to a varying degree with the components that normally accompany it as found in its natural environment. "isolated" refers to the degree of separation from the original source or environment. "purified" means separated by a higher degree of separation.

A "purified" or "biologically pure" protein is sufficiently free of other materials that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, the stable protein of the polymer fragment of the present invention is purified if it is substantially free of cellular material, viral material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized, as well as all other stromal red blood cells or other blood proteins or blood components and cellular debris. Purity, homogeneity and stability are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" may mean that the nucleic acid or protein produces a substantial band in the electrophoresis gel. For proteins that can be modified, e.g., phosphorylated, glycosylated or polymerized, different modifications can result in different isolated proteins that can be purified separately.

Similarly, "substantially pure" refers to a protein or polypeptide that is isolated from the components that naturally accompany it. Typically, proteins and polypeptides are substantially pure when they are present in at least 95% and even 99% of their content, free of other proteins and naturally occurring organic molecules with which they are naturally associated.

An "isolated polypeptide" refers to a polypeptide of the invention that is isolated from components that naturally accompany it. Typically, a polypeptide is isolated free of proteins and naturally occurring organic molecules with which it is naturally associated when the polypeptide is at least 60% by weight. Preferably, the preparation is at least 75% in content, more preferably at least 90% in content, most preferably at least 99% in content of the polypeptide of the invention. The isolated polypeptide fraction and/or protein of the invention may be obtained, for example, by extraction from a natural source, by expression of recombinant nucleic acids encoding such a substance; or by chemical synthesis of the protein. Purity can be measured by any suitable method, such as column chromatography, polyacrylamide gel, electrophoresis or HPLC analysis.

The term "immobilized" or "attached" refers to a probe (e.g., a nucleic acid or protein) and a solid support, wherein the binding between the probe and the solid support is sufficient to be stable under the conditions of binding, washing, analysis, and removal. The binding may be covalent or non-covalent. The covalent bond may be formed directly between the probe and the solid support, or may be formed by a cross-linking agent, or by the inclusion of a specific reactive group on the solid support or the probe or both molecules. The non-covalent binding may be one or more of electrostatic, hydrophilic and hydrophobic interactions. Non-covalent binding includes covalent attachment of the molecule to a carrier and non-covalent binding of the biotinylated probe to the molecule. Immobilization may also involve a combination of covalent and non-covalent interactions.

The term "marker" refers to any protein or polynucleotide having an altered expression level or activity associated with a disease or disorder, such as neoplasia.

"modulate" refers to alteration (increase or decrease). These changes are detected by standard art-known methods, such as those described herein.

The term "normal amount" refers to a normal amount of the complex in an individual who is not known to be diagnosed with cancer or various metabolic and physiological disease states. The amount of molecules can be measured in a test sample and compared to a "normal control level" using techniques such as reference limits, discrimination limits or risk definition thresholds to define cut-off points and outliers (e.g., for neoplasia, hypoxia, ischemia). "normal control level" refers to the level of one or more proteins (or nucleic acids) or a combined protein index (or combined nucleic acid index) typically found in a subject known not to have cancer or a physiological hypoxic state. Such normal control levels and cut-offs can vary depending on whether the molecule is used alone or in a formula that combines other proteins into an index. Alternatively, the normal control level may be a database of protein patterns from previously tested subjects that have not converted to cancer within a clinically relevant time period. It may also be a condition of reduced oxygen tension, measured as MMHG, characterized by hypoxia or ischemia. In another aspect, the normal control level can be a level relative to normal cellular function and oxidation level.

The determined level may be the same as the control level or the cutoff level or the threshold level, or may be increased or decreased with respect to the control level or the cutoff level or the threshold level. In some aspects, the control subject is a matched control of the same species, gender, ethnicity, age group, smoking status, Body Mass Index (BMI), current treatment regimen status, medical history, or a combination thereof, but unlike the subject diagnosed and evaluated, the control does not suffer from the disease or is not at risk of suffering from the disease or reflects signs and symptoms of hypoxia.

The determined level may be an increased level relative to the control level. As used herein, the term "increased relative to a level (e.g., expression level, biological activity level, etc.)" refers to any% increase over a control level. The level of increase may be at least or about a 5% increase, at least or about a 10% increase, at least or about a 15% increase, at least or about a 20% increase, at least or about a 25% increase, at least or about a 30% increase, at least or about a 35% increase, at least or about a 40% increase, at least or about a 45% increase, at least or about a 50% increase, at least or about a 55% increase, at least or about a 60% increase, at least or about a 65% increase, at least or about a 70% increase, at least or about a 75% increase, at least or about an 80% increase, at least or about an 85% increase, at least or about a 90% increase, or at least or about a 95% increase, relative.

The determined level may be a reduced level relative to the control level. As used herein, the term "reduced relative to a level (e.g., expression level, biological activity level, etc.)" refers to any% reduction below a control level. The level of reduction may be at least or about a 1% reduction, at least or about a 5% reduction, at least or about a 10% reduction, at least or about a 15% reduction, at least or about a 20% reduction, at least or about a 25% reduction, at least or about a 30% reduction, at least or about a 35% reduction, at least or about a 40% reduction, at least or about a 45% reduction, at least or about a 50% reduction, at least or about a 55% reduction, at least or about a 60% reduction, at least or about a 65% reduction, at least or about a 70% reduction, at least or about a 75% reduction, at least or about an 80% reduction, at least or about an 85% reduction, at least or about a 90% reduction, or at least or about a 95.

Protein molecules useful in the methods of the invention include any nucleic acid molecule encoding a polypeptide of a heme iron composition of the invention, or a fragment thereof. Such protein-stable molecules need not be 100% identical to an endogenous nucleic acid sequence, but typically exhibit substantial identity, e.g., at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity.

For most applications, the stringency of the washing steps after hybridization will also vary. The strictly controlled washing/mixing conditions can be defined by the buffer concentration, the dispersion conditions and the temperature of the glutaraldehyde reaction. As described above, the controlled stringency can be increased by reducing the salt concentration or by increasing the temperature. Other variations of these conditions will be apparent to those skilled in the art. Hybridization/conjugation techniques are well known to those skilled in the art and are described, for example, in Benton and Advis (Science196:180, 1977); grunstein and Hogness (proc.natl.acad.sci., USA 72:3961, 1975); ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); berger and Kimmel (targeting molecular cloning technology, 1987, Academic Press, New York); and Sambrook et al, Molecular Cloning, A Laboratory Manual, Cold Spring harbor Laboratory Press, New York.

"neoplasia" refers to a disease or disorder characterized by hyperproliferation or reduced apoptosis. Illustrative tumors in which the invention may be used include, but are not limited to, pancreatic cancer, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythrocytic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphomas (hodgkin's disease, non-hodgkin's disease), wald's macroglobulinemia, heavy chain diseases and solid tumors such as sarcomas and carcinomas (e.g., malignant lymphoma), fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyoma, rhabdomyosarcoma, colon cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, bladder cancer, intramedullary cancer, bronchial cancer, renal cell carcinoma, liver cancer, nile ductal carcinoma, choriocarcinoma, seminoma, embryonic carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, glioblastoma multiforme, astrocytoma, medulloblastoma, craniopharyngioma, epididymoma, spongioblastoma, acoustic neuroma, oligodendroglioma, glioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

As used herein, "obtaining" as described in "obtaining an agent" includes synthesizing, purchasing, or otherwise obtaining an agent.

As used herein, the term "or" is to be understood as being inclusive unless specifically indicated or otherwise evident from the context. As used herein, the terms "a", "an" and "the" are to be construed as either singular or plural unless otherwise indicated herein or apparent from the context.

The phrase "pharmaceutically acceptable carrier" is well known in the art and includes pharmaceutically acceptable materials, compositions or excipients suitable for administration of the compounds of the present invention to a mammal. The carrier comprises a liquid or solid filler, diluent, excipient, solvent or encapsulating material involved in carrying or transporting the subject agent from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include sugars such as lactose, glucose and sucrose; gelatin; an excipient; pyrogen-free water; isotonic saline; ringer's solution; ethanol; phosphate buffer; and other non-toxic compatible materials used in pharmaceutical formulations.

The term "protein" or "polypeptide" or "peptide" refers to any chain of more than two natural or unnatural amino acids, regardless of post-translational modifications (e.g., glycosylation or phosphorylation), as described herein, making up all or part of a naturally occurring or non-naturally occurring polypeptide or peptide.

A "primer set" refers to a set of oligonucleotides that can be used, for example, in PCR. The primer set consists of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80,100,200,250,300,400,500,600 or more primers.

The term "prevention" refers to the administration of an agent or composition to a clinically asymptomatic individual at risk of developing, susceptible to or susceptible to a particular adverse condition, disorder or disease, and thus relates to the prevention of the occurrence of symptoms and/or their underlying cause.

Ranges can be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It will also be understood that a plurality of values are disclosed herein, and that each value is also disclosed herein as "about" that particular value, in addition to the value itself. It should also be understood that throughout the application, data is provided in a number of different formats and represents endpoints, starting points, and ranges for any combination of data points. For example, if a particular data point "10" and a particular data point "15" are disclosed, it is understood that greater than, greater than or equal to, less than or equal to, and equal to 10 and 15 and between 10 and 15 are considered disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13 and 14 are also disclosed.

Ranges provided herein are to be understood as shorthand for all values falling within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or subrange selected from 1 to 50, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 and all intervening fractional values between the foregoing integers, e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to subranges, "nested subranges" extending from either end of the range are specifically contemplated. For example, nested sub-ranges of exemplary ranges 1-50 may include 1-10, 1-20, 1-30, and 1-40 in one direction, or 50-40, 50-30, 50-20, and 50-10 in another direction.

By "reduced" is meant a negative change of at least 10%, 25%, 50%, 75% or 100%.

A "reference sequence" is a defined sequence that is used as a basis for sequence comparison or comparison of gene expression. The reference sequence may be a subset or all of the specified sequence; for example, a fragment of a full-length cDNA or gene sequence, or the entire cDNA or gene sequence. For polypeptides, the length of a reference polypeptide sequence is typically at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, even more preferably about 35 amino acids, about 50 amino acids or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence is typically at least about 40 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, even more preferably about 100 nucleotides or about 300 or about 500 nucleotides or any integer therebetween.

The term "sample" as used herein refers to a biological sample obtained for in vitro evaluation. Exemplary tissue samples for the methods described herein include tissue samples from neoplasia or circulating exosomes. With respect to the methods disclosed herein, the sample or patient sample preferably may comprise any body fluid or tissue. In some embodiments, the bodily fluid includes, but is not limited to, blood, plasma, serum, lymph, breast milk, saliva, mucus, semen, vaginal secretions, cellular extracts, inflammatory fluids, cerebrospinal fluid, feces, vitreous humor, or urine obtained from the subject. In some aspects, the sample is a composite panel of at least two of a blood sample, a plasma sample, a serum sample, and a urine sample. In exemplary aspects, the sample comprises blood or a fraction thereof (e.g., plasma, serum, a fraction obtained by leukocyte isolation). Preferred samples are whole blood, serum, plasma or urine. The sample may also be a partially purified fraction of a tissue or body fluid.

The reference sample may be a "normal" sample, from a donor without the disease or condition fluid, or from normal tissue of a subject with the disease or condition. The reference sample can also be from an untreated donor or cell culture that is not treated with the active agent (e.g., no treatment or administration of the carrier alone). A reference sample may also be taken at a "zero time point" prior to contacting the cell or subject with the agent to be tested or therapeutic intervention or at the start of the intended study.

"solid support" describes a strip, polymer, bead or nanoparticle. The strip may be a nucleic acid probe (or protein) -coated porous or non-porous solid support strip comprising a nucleic acid probe linked to a support to prepare a conjugate and immobilizing the conjugate on a porous solid support. Well-known carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylase, natural and modified cellulose, polyacrylamide, Gabbros and magnetite. For the purposes of the present invention, the nature of the carrier may be soluble or insoluble to some extent. The support material may have virtually any possible structural configuration, as long as the conjugated molecule is capable of binding to a binding agent (e.g., an antibody or nucleic acid molecule). Thus, the support structure may be spherical, such as beads, or cylindrical, such as the inner surface of a test tube, or the outer surface of a rod. Alternatively, the surface may be flat, such as a sheet, or a test strip, etc. For example, the support comprises polystyrene beads. Those skilled in the art will know of many other suitable carriers for binding antibodies or antigens, or be able to determine such carriers by routine experimentation. In other aspects, the solid support comprises a polymer to which the agent is chemically bound, immobilized, dispersed, or associated. The polymeric support may be a polymeric network and may be prepared in bead form (e.g. by suspension polymerisation). The location of the active site incorporated into the polymeric carrier depends on the type of polymeric carrier. For example, in a swollen gel bead polymer support, the active sites are uniformly distributed throughout the bead, whereas in a macroporous bead polymer support, they are predominantly on the inner surface of the macropores. The solid support, e.g. device, comprises a binding agent, either alone or together with a binding agent for at least one, two, three or more other molecules.

The term "specifically binds" refers to a compound or antibody that recognizes and binds to a polypeptide of the invention, but which does not substantially recognize and bind to other molecules in a sample, such as a biological sample, which naturally includes a polypeptide/conjugated purified protein of the invention.

"substantially identical" refers to a polypeptide/protein or nucleic acid molecule (e.g., any of the amino acid sequences described herein) or nucleic acid sequence (e.g., any of the nucleic acid sequences described herein) that is at least 80% identical to a reference amino acid sequence. Preferably, such sequences are at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

The term "subject" as used herein includes all members of the animal family susceptible to the disorder. In some aspects, the subject is a mammal, and in some aspects, the subject is a human. The method is also applicable to companion animals such as dogs and cats as well as livestock such as cows, horses, sheep, goats, pigs and other domesticated and wild animals.

A subject, disorder or syndrome "having or suspected of having" a particular disease has a sufficient number of risk factors, or exhibits a sufficient number of signs or symptoms of the disease, disorder or syndrome, or a combination of these signs or symptoms, such that a capable individual will diagnose or suspect that the subject has the disease, disorder or syndrome. Methods for identifying subjects having or suspected of having a cancer-associated disorder are within the ability of those skilled in the art. The subjects having and suspected of having a particular disease, disorder or syndrome need not be in two distinct groups.

As used herein, "susceptible to" or "at risk of developing a particular disease or disorder" refers to an individual that is more likely to develop a disease or disorder than the general population based on genetic, environmental, health, and/or other risk factors. The increase in likelihood of developing a disease may be an increase of about 10%, 20%, 50%, 100%, 150%, 200% or more.

The term "treating" as used herein refers to administering an agent or formulation to a clinically symptomatic individual with an adverse condition, thereby reducing the severity and/or frequency of the symptoms, eliminating the symptoms and/or their underlying cause, and/or promoting amelioration or repair of the injury. It will be appreciated that although treatment of a disease or condition is not precluded, it is not necessary to completely eliminate the disease, condition or symptom associated therewith.

In some cases, the compositions of the present invention are administered orally or systemically. Other modes of administration include topical, intraocular, buccal, intra/over implant or parenteral routes. The term "parenteral" includes subcutaneous, intrathecal, intravenous, intramuscular, intraperitoneal or infusion. The intravenous or intramuscular routes are not particularly suitable for long-term treatment and prophylaxis. However, in emergency situations, they may be preferred. Compositions comprising the compositions of the present invention may be added to physiological fluids such as blood. Oral administration may be preferred for prophylactic treatment due to patient convenience and dosing schedules. Parenteral administration (subcutaneous or intravenous) is preferred for more acute conditions or for the treatment of patients who cannot tolerate enteral administration due to gastrointestinal intolerance, ileus or other concomitant critical conditions.

The pharmaceutical composition may be assembled into a kit or a pharmaceutical system for use in the adjuvant treatment of the cell cycle of rapidly dividing cells, such as cancer cells. The kit or pharmaceutical system according to this aspect of the invention comprises a carrier means, such as a box, carton, tube, having one or more container means therein, such as a vial, tube, ampoule, bottle, syringe or bag, said container means being tightly confined therein. The kits or pharmaceutical systems of the invention may also include instructions for use of the kit.

Any of the compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

The transitional term "comprising" which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional unrecited elements or method steps. Rather, the transitional phrase "consisting essentially of" limiting the scope of the claims to the specified elements or components "includes excluding any elements, steps, or components not specified in the claims. The transitional phrase "consisting essentially of the material or steps that limit the scope of the claims to the specified material or steps" and those that do not materially affect the basic and novel characteristics of the claimed invention.

The oxygen-carrying hemoglobin as the substitute of erythrocyte has important application and economic value. Since the unstable tetramer can be dissociated to cause various side effects by initially using human hemoglobin without any modification, the research in the future mostly takes the stable polymer formed by crosslinking as the development direction. When the oxygen-carrying bovine hemoglobin product is applied to biological treatment, the residual host DNA of the product must be strictly tested to ensure the safety and reliability of the product.

The invention discloses a preparation method and an application method of a nucleic acid detection kit for quantitatively detecting the content of bovine (Bos taurus) derived DNA in a bovine oxygen-carrying hemoglobin product, and belongs to the field of molecular biology. The bovine hemoglobin is prepared by combining a magnetic bead nucleic acid enrichment technology in nucleic acid preparation with a probe method real-time fluorescent quantitative polymerase reaction (Realtiquative PCR) technology, and by designing a proper primer and a probe sequence, specific amplification and fluorescent detection are performed on bovine-derived DNA purified from artificially polymerized bovine hemoglobin, so that rapid and accurate detection of bovine-derived components in main feed of biochemical pharmaceutical products is realized.

The invention designs specific primers and unique probe sequences aiming at the beta-actin gene which is single-copy and has little variation in the bovine genome, adds a sample to be detected and bovine genome DNA standard samples with different concentrations in PCR reaction, and draws a standard curve of DNA concentration and Ct value by reading fluorescence signals generated by the reaction, so that the accurate content of the bovine genome DNA in the sample can be calculated, and whether the bovine genome DNA meets the requirements or not can be judged.

Therefore, the invention provides a preparation method of genome DNA in the oxygen-carrying bovine hemoglobin, which can eliminate the interference of impurities in DNA products on detection to the maximum extent and ensure high extraction efficiency. On the other hand, the invention designs a group of primer and probe combination for amplifying bovine genomic DNA, and specifically, the primer sequence is Bos-ACTB-1F 2: 5' -TTCTGAAGTGAACCTCATTCTGGG (SEQ ID NO: 11), the sequence of the downstream primer Bos-ACTB-1R2 is 5'-CACCACAAGGGGCAGTCG-3' (SEQ ID NO: 12), and the sequence of the probe Bos-ACTB-P1 is: 5'-CGGCACACTCGGCTGTGTTCCTTGC-3' (SEQ ID NO: 3).

The invention also provides a capability verification result of sample detection by using the kit and the primer combination, which comprises the linear range, sensitivity, specificity, recovery rate and the like of detection.

Specifically, the invention provides a fluorescent quantitative PCR detection method of bovine genomic DNA in bovine hemoglobin products.

In some embodiments, the method consists of two processes of extracting DNA from a bovine hemoglobin preparation and detecting the extracted DNA by amplification by a fluorescent quantitative PCR method.

In some embodiments, the magnetic bead extraction process of residual DNA comprises a specific DNA rinsing process, wherein the rinsing reagent composition is 100mmol/L NaCl, 10mmol/L Tris-HCl pH7.5, wherein the concentration of ethanol is 75%, 80% or 85%, the concentration of Triton X-100 is 0.4%, 0.5% or 0.6%, preferably the concentration of ethanol is 80%, and the concentration of Triton X-100 is 0.5%.

In some embodiments, the PCR reaction consists of a thermostable DNA polymerase, uniquely designed amplification primers and probes, dNTP mix, PCR reaction buffer, bovine genomic standards.

In some embodiments, the PCR reaction uses a bovine β -actin encoding gene as the gene of interest for amplification, and the amplification product has the sequence shown in SEQ ID NO: 1.

CCGAGGTTGCTGCCAGGCGGCCTCGGAGTGTGTATTCAGTAGGTGCACAGTACGTTCTGAAGTGAACCTCATTCTGGGGCCCCGGCACACTCGGCTGTGTTCCTTGCACTCTTCTGCATGTGCCCAGTCTGGCCCGACTGCCCCTTGTGGTGTCCCAGTATGACGCGGCCCATCTCTTCCTACAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTACGTGGCCATCCAGGCTGTGCTGTCCCTGTATGCCTCTGGCCGCACCACCGGCATCGTGATGGACTCCGGTGACGGGGTCACCCACACGGTGCCCATCTATGAGGGGTACGCCCTTCCCCATGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACGGACTACCTCATGAAGATCCTCACGGAGCGTGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTCCGTGACATCAAGGAGAAGCTCTGCTACGTGGCCCTGGACTTCGAGCAGGAGATGGCCACCGCGGCCTCCAGCTCCTCCCTGGAGAAGAGCTACGAGCTTCCTGACGGGCAGGTCATCACCATCGGCAATGAGCGGTTCCGCTGCCCTGAGGCTCTCTTCCAGCCTTCCTTCCTGGGTGAGTGAGAAGGCCCGCCCTGCCTGCCCCACACGAAGGTCACCCTGTGGCCACACTGGAGGCTAAGTCTGCCTTCTCTCTCTCCCCAGGCATGGAATCCTGCGGCATTCACGAAACTACCTTCAATTCCATCATGAAGTGTGACGTCGACATCCGCAAGGACCTCTACGCCAACACGGTGCTGTCCGGCGGGACCACCATGTACCCCGGCATCGCGGACAGGATGCAGAAAGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGGTGAGCGCCCAGCCGTAGCCGGACGGTGCAGATAGGCGTGGTGGCTGTCAAGGCGGCTGCCTTGCTCGGGTCCCATGGGTACCGGGGAGATGACGCCAGGGCCCTCACTGCCCCCTTCTCTCTCTCTCCAGATCATCGCGCCCCCTGAGCGCAAGTACTCCGTGTGGATTGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTT (SEQ ID NO:1, bovine beta-actin fragment, species: Bostaurus).

In some embodiments, the sequence of the forward primer used for amplification, Bos-ACTB-1F2, is: 5' -TTCTGAAGTGAACCTCATTCTGGG (SEQ ID NO: 11), the sequence of the downstream primer Bos-ACTB-1R2 is 5'-CACCACAAGGGGCAGTCG-3' (SEQ ID NO: 12), and the sequence of the probe Bos-ACTB-P1 is: 5'-CGGCACACTCGGCTGTGTTCCTTGC-3' (SEQ ID NO: 3).

In some embodiments, the DNA probe is labeled at the 5' end and the 3 ' end with a compound selected from the group consisting of Fluorescein Isothiocyanate (FITC), Carboxyfluorescein (FAM), Hexachloro-6-methylfluorescein (HEX), and a compound labeled at the 3 ' end selected from the group consisting of 6-carboxytetramethylrhodamine (TAMRA) and broad spectrum quencher BHQ-1(Black HoleQuencer 1).

In some embodiments, the amplification reaction conditions are: pre-denaturation at 95 ℃ for 5min and denaturation at 94 ℃ for 30 sec; annealing at 58 ℃ for 30 seconds; 72 ℃ extension for 15 seconds, amplification for 40 cycles, and final 72 ℃ extension for 5 minutes.

In some embodiments, the detection method is used for detecting the content of residual bovine genomic DNA in the extracted bovine hemoglobin alpha subunit, the extracted bovine hemoglobin beta subunit component and the polymerized bovine hemoglobin polymer.

The invention is further illustrated by the following examples.