阅读说明：本技术 同时检测hba1/2、hbb和hbd基因位点多种突变的方法和试剂盒 (Method and kit for simultaneously detecting multiple mutations of HBA1/2, HBB and HBD gene sites ) 是由 李佳琪 卢玉林 谢田田 毛爱平 任志林 于 2021-09-26 设计创作，主要内容包括：本发明涉及一种同时检测HBA1/2、HBB和HBD基因位点多种突变的引物组、试剂盒和方法。其中所述试剂盒包括以下试剂：(1)用于多重PCR扩增的试剂；和(2)用于构建三代测序文库的试剂。其中所述方法包括以下步骤：(1)制备受试者样本；(2)多重PCR同时扩增所述样本中HBA1/2、HBB和HBD基因片段；(3)构建三代测序文库；(4)测序并分析HBA1/2、HBB和HBD基因突变类型。(The present invention relates to a simultaneous detection HBA1/2 、 HBB And HBD primer group, kit and method for multiple mutations of gene locus. Wherein the kit comprises the following reagents: (1) reagents for multiplex PCR amplification; and (2) reagents for constructing a three-generation sequencing library. Wherein the method comprises the steps of: (1) preparing a sample of a subject; (2) multiplex PCR simultaneous amplification in said sample HBA1/2、HBB And HBD a gene fragment; (3) constructing a third generation sequencing library; (4) sequencing and analysis HBA1/2、HBB And HBD the type of gene mutation.)

1. For simultaneous amplificationHBA1/2, HBB and HBDA primer set for gene mutation, wherein the primer set comprises:

1) an HBA forward primer selected from one or more of: HBA-F1, HBA-F2, HBA-F3, HBA-F4, HBA-F5;

2) an HBA reverse primer selected from one or more of: HBA-R1, HBA-R2;

3) an HBBD forward primer selected from one or more of: HBBD-F1, HBBD-F2, HBBD-F3, HBBD-F4, HBBD-F5, HBBD-F6, HBBD-F7, HBBD-F8 and HBBD-F9; and

4) an HBBD reverse primer selected from one or more of: HBBD-R1, HBBD-R2, HBBD-R3;

wherein the position of the primers on the genome is shown in the following table:

。

2. the primer set of claim 1, wherein the primer set comprises 19 primers as set forth in claim 1.

3. The primer set of claim 2, wherein the primer sequences in the primer set are as follows:

。

4. the primer set according to claim 2, wherein the primer is added with 5-50nt of DNA of different sequence at 5' end, i.e. Barcode, for distinguishing different samples.

5. A kit capable of simultaneous detectionHBA1/2, HBB and HBDA plurality of mutations at a gene locus, the kit comprising the following reagents:

(1) for multiplex PCR amplificationHBA1/2, HBB and HBDAn agent for a gene fragment; and

(2) reagents for constructing a third generation sequencing library;

wherein the reagent for multiplex PCR amplification comprises the primer set according to any one of claims 1 to 4.

6. The kit of claim 5, wherein the mutations comprise at least one or more of:

HBA1/2all point mutations within the primer range on the gene locus;

representing the 30 large fragment deletions indicated;

selected from α α α anti3.7, α α α anti4.2, HK α, anti HK α; 6 structural variations of α α α α α anti3.7 and α α α α anti 4.2;

HBBandHBDall point mutations within the primer range on the gene locus;

28 large fragment deletions as shown in table 2; and

2 structural variations selected from Hb Anti-Lepore and Hb Miyada.

7. The kit of claim 5, wherein the multiplex PCR amplification is accomplished in a single reaction tube.

8. The kit of claim 5, wherein the kit is for detectingHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

9. The kit of claim 5, wherein the reagents for multiplex PCR amplification further comprise a DNA polymerase, a reaction buffer.

10. The kit of claim 5, wherein the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

11. The kit of claim 5, wherein the reagents for constructing a third generation sequencing library comprise end repair enzymes, linkers, ligases, DNA purification beads, reaction buffers and exonucleases.

12. Test subjectHBA1/2, HBB and HBDA method of site mutation of a gene comprising the steps of:

(1) preparing a sample of a subject;

(2) multiplex PCR simultaneous amplification in said sampleHBA1/2, HBB and HBDA gene fragment;

(3) constructing a third generation sequencing library;

(4) sequencing and analysisHBA1/2, HBB and HBDA type of gene mutation;

wherein the multiplex PCR step employs the primer set of any one of claims 1 to 4.

13. The method of claim 12, wherein the mutation comprises at least one or more of:

HBA1/2all point mutations within the primer range on the gene locus;

representing the 30 large fragment deletions indicated;

selected from α α α anti3.7, α α α anti4.2, HK α, anti HK α; 6 structural variations of α α α α α anti3.7 and α α α α anti 4.2;

HBBandHBDall point mutations within the primer range on the gene locus;

28 large fragment deletions as shown in table 2; and

2 structural variations selected from Hb Anti-Lepore and Hb Miyada.

14. The method of claim 12, wherein the method is for detectingHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

15. The method of claim 12, wherein the multiplex PCR amplification is accomplished in a single reaction tube.

16. The method of claim 12, wherein the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

17. A system for detecting gene locus mutation, which can detect the testee at the same timeHBA1/2, HBB and HBDA plurality of mutations at a locus of a gene, the system comprising the following modules:

(1) an acquisition module: obtaining a subject sample;

(2) an amplification module: multiplex PCR simultaneous amplification in said sampleHBA1/2, HBB and HBDA gene fragment;

(3) a library construction module: constructing a third generation sequencing library;

(4) a sequencing module: sequencing and analysisHBA1/2, HBB and HBDA type of gene mutation;

wherein the amplification module employs the primer set according to any one of claims 1 to 4.

18. The system of claim 17, wherein the system is used to detectHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

19. The system of claim 17, wherein the multiplex PCR amplification is accomplished in a single reaction tube.

20. The system of claim 17, wherein the third generation sequencing is selected from PacBio sequencing by pacfic Biosciences, inc or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

Technical Field

The invention relates to simultaneous detection by utilizing a third-generation long-read sequencing platformHBA1/2, HBB and HBDPrimer combination and method for multiple mutations of gene, and kit suitable for the method.

Background

The loss or deficiency of alpha-globin or beta-globin synthesis leads to thalassemia, also known as thalassemia (abbreviated as thalassemia). The thalassemia is mainly divided into alpha-thalassemia and beta-thalassemia, is the most common monogenic genetic disease in the world, belongs to autosomal recessive inheritance, and high-incidence areas comprise southern China, southeast Asia, Mediterranean areas, India, middle east, Africa and other areas^1,2,3。

The human alpha-globin gene cluster is located on chromosome 16 and comprises 7 gene loci: 5' -HBZ-HBZps-HBM-HBA1ps-HBA2(α1)-HBA1(α1)-HBQ-3'. Therein is only provided withHBA1AndHBA2both genes have the ability to encode globin in both embryos and adults.HBA1AndHBA2mutations of genes include deletion-type mutations and non-deletion-type mutations. The most common deletion type in ChinaHBA1AndHBA2the mutation of the gene is-alpha 3.7, -alpha 4.2, and-SEA, and the non-deletion mutation is HBA2: c.369C>G，HBA2: c.377T>C，HBA2: c.427T>C. The six gene mutations account for 98 percent of the total alpha-thalassemia of Chinese population, so the existing clinical routine molecular diagnosis mainly aims at the mutations^3,4,5. With the continuous elucidation of the mechanisms underlying α -thalassemia, more and more types of mutations are discovered. In combination with the Ithanet, HbVar, LOVD and LOVD-China Dieqizhi databases, deletions of about 50 α -globin gene cluster regions have been found worldwide, and over 900HBA1AndHBA2non-deletion mutations in the gene may result in reduced or absent expression of alpha-globin. In addition, there are some rare structural variations, such as α α α anti3.7, α α anti4.2, HK α α and anti HK α α. The traditional Gap-PCR method is difficult to detect rare structural variation, can not distinguish HK alpha and-alpha 3.7 and anti HK alpha and-alpha 4.2, and can cause misdiagnosis in screening⁶. And different PCR systems are needed to accurately distinguish the genotypes, and the simultaneous detection cannot be realized in the same system. These show that the alpha-thalassemia has a wider gene mutation spectrum, the screening range of the existing alpha-thalassemia gene defect is enlarged, and the omission of abnormal genotypes is effectively avoided.

The human beta-globin gene cluster is located on chromosome 11 and comprises 5 gene loci: 5' -HBE-HBG2-HBG1-HBD(δ)-HBB(beta) -3'. WhereinHBBThe gene encodes globin in adults, and all four other genes are expressed during embryonic development, or expressed in very low amounts in adults. The vast majority of mutations leading to beta-thalassemia are non-deletion, and the minority are large fragment deletions^7,8. The comprehensive Ithanet, HbVar, LOVD and LOVD-China Dieqin database has been found to be more than 1000 in the worldHBBNon-deletion mutations of genes. 129 non-deletion type mutations of beta-globin genes are found in Chinese population so far, but the main detection at present is mainly known and common 17-site 19 mutations comprising c.82C>A、c.52A>T, c.94delC, c.126_129delCTTT, c.216_217insA, c.216_217insT, etc⁹. The 19 mutations account for about 99% of the beta-thalassemia mutation composition ratio in south China, a targeted detection system is established according to the 19 mutations, but a feasible method for realizing one-time detection of all the mutations is not available at presentHBBDeletion type and non-deletion type mutation of gene.

HBDThe gene encodes globin in embryonic development, and more than 50 deleted HPFH/delta beta-thalassemia and 130 delta-globin gene mutations have been reported to date¹⁰. Delta-thalassemia is a clinically unproductive thalassemia caused by mutations in the delta-globin gene leading to HbA₂Reduced levels, although delta-thalassemia is not clinically significant, functional disruption of delta-globin may lead to HbA₂Is abnormal and depends on the HbA of the patient₂The measurement may complicate the diagnosis of beta-thalassemia¹¹. In the epidemic area of the thalassemia, since the coexistence of HPFH or delta thalassemia and alpha or beta thalassemia can cause the misdiagnosis of thalassemia, the detection of deletion of HPFH/delta beta thalassemia and delta-globin gene mutation is important. There are also some rare structural variations, such as anti-Lepore, etc. Increase ofHBDThe genetic diagnosis can effectively reduce the misdiagnosis and missed diagnosis of the thalassemia.

The existing kit for detecting the deletion type and non-deletion type mutation of the thalassemia genes is mostly based on multiple Gap-PCRPCR-RDB and the like, mainly detects 3 common methodsHBA2And 17HBBThe site of gene mutation. These detection kits are mainly limited in several ways:

1. the detection of the related mutation of deletion type and non-deletion type alpha-, beta-and delta-thalassemia can not be simultaneously detected in the same system;

2. only common thalassemia mutations are detected, the coverage range is limited, and omission is easily caused, such as rare thalassemia mutationsHBA1/2、HBB And HBDGene point mutation, and structural variation such as anti-Lepore, alpha anti3.7, alpha anti4.2 and the like;

3. the conventional Gap-PCR cannot distinguish alpha-thalassemia-alpha 3.7 deletion and HK alpha structure variation, cannot distinguish-alpha 4.2 deletion and anti HK alpha structure variation, and can cause a certain degree of false detection;

4. when in useHBA1/2、HBBAndHBDwhen two or more mutations exist on a gene locus at the same time, the existing method cannot distinguish cis-mutation from trans-mutation.

Disclosure of Invention

In view of this, the present invention provides a method based on multiplex PCR amplification and third-generation sequencing for simultaneous detectionHBA1/ 2. HBB and HBDMultiple mutations in a gene region. The multiple PCR amplification can realize simultaneous amplification in a single reaction tubeHBA1/2, HBB and HBDthe third generation sequencing platform has the characteristics of reading length, measuring length, high calibration accuracy, high flux and the like, and can realize accurate, rapid and high-flux detectionHBA1/2, HBB and HBDAnd (3) gene mutation. The method provided by the invention is simple and convenient to operate, the multiple PCR and third-generation library are reliable in quality and strong in repeatability, and the application of the third-generation sequencing technology to clinical detection is facilitated.

The invention aims to solve the current stageHBA1/2, HBB and HBDThe gene mutation detection has the problems of low precision, incapability of simultaneously detecting various deletion and non-deletion mutations, incapability of determining whether the mutations are linked, incapability of detecting unusual mutations, omission, false detection and the like in clinic. Simultaneous amplification by multiplex PCRHBA1/2, HBB and HBDGene mutation fragment and preparation of third-generation sequencing library to realize accurate and rapid detection of multiple samplesHBA1/2, HBB and HBDMultiple mutations of the gene are targeted.

The first aspect of the present invention provides a primer set which can amplify simultaneouslyHBA1/2, HBB and HBDMultiple mutations of a gene, for example, can be detected simultaneously:HBA1/2all point mutations within the primer range at the gene locus, 30 large fragment deletions (including- -SEA, - - α 3.7, - - α 4.2, - -THAI and- -FIL, etc., as shown in Table 1) and 6 structural variations (α α α anti3.7, α α anti4.2, HK α, anti HK α; α α α α anti3.7, and α α α α anti 4.2);HBBandHBDall point mutations in the primer range on the gene locus, 28 large fragment deletions (including Chinese)^Gγ(^Aγ δ β)0-Thal and SEA-HPFH, etc., as shown in Table 2) and 2 structural variations (Hb Anti-Lepore and Hb Miyada).

Table 1: is detectableHBA1/2Deletion of 30 large segments on gene

Table 2: is detectableHBBAndHBDdeletion of 28 large fragments on gene

The primer combination can simultaneously detect and distinguish three mutation types of-alpha 3.7, alpha anti4.2 and HK alpha, and can also simultaneously detect and distinguish three mutation types of-alpha 4.2, alpha anti3.7 and anti HK alpha.

According to one embodiment of the present invention, the primer set includes:

1) an HBA forward primer selected from one or more of: HBA-F1, HBA-F2, HBA-F3, HBA-F4, HBA-F5;

2) an HBA reverse primer selected from one or more of: HBA-R1, HBA-R2;

3) an HBBD forward primer selected from one or more of: HBBD-F1, HBBD-F2, HBBD-F3, HBBD-F4, HBBD-F5, HBBD-F6, HBBD-F7, HBBD-F8 and HBBD-F9; and

4) an HBBD reverse primer selected from one or more of: HBBD-R1, HBBD-R2, HBBD-R3.

Wherein, the primer design schematic diagram is shown in fig. 1A to fig. 1B, and the primer genome coordinate position range is shown in table 3. The primer can amplifyHBA1/2, HBB and HBDThe complete entire sequence of the gene, including any type of mutated sequence within the primer. Preferably, the amplification product of each primer is less than 25 Kb. Preferably, degenerate base primers are used if the primers have SNPs placed therein.

Table 3: position information of primer

According to a preferred embodiment, the primer set comprises 19 primers as described above. More preferably, wherein the primer sequences are shown as SEQ ID NO 1-19 in Table 4.

Table 4: primer information

In one embodiment, 5 to 50nt of DNA (Barcode) with different sequences, i.e., barcodes, are added to the 5' end of the primers and can be used to distinguish different samples.

In one embodiment, the 5' end Barcode of the F and R primers may be the same or different, and may be selected by one skilled in the art as desired.

According to a preferred protocol, the primer set is used for multiplex PCR amplificationHBA1/2, HBB and HBDA gene fragment. By combining with the subsequent PacBio sequencing platform, all primers in the range of the primers can be detectedHBA1/2, HBB and HBDMutation type of gene fragment.

A second aspect of the invention provides a device that can detect simultaneouslyHBA1/2, HBB and HBDA kit for multiple mutations in a gene comprising the following reagents:

(1) for multiplePCR amplificationHBA1/2, HBB and HBDAn agent for a gene fragment; and

(2) reagents for constructing a third generation sequencing library.

According to one embodiment of the present invention, wherein the reagents for multiplex PCR amplification include a DNA polymerase, a reaction buffer, and a primer set.

According to one embodiment of the invention, wherein the primer set is selected from the primer sets described herein above.

According to one embodiment of the present invention, the primer family includes 19 primers as described above, the primer design is schematically shown in fig. 1A to fig. 1B, and the coordinate position range of the primer genome is shown in table 3. The primer can amplifyHBA1/ 2. HBB and HBDThe complete entire sequence of the gene, including any type of mutated sequence within the primer. Preferably, the amplification product of each primer is less than 25 Kb. Preferably, degenerate base primers are used if the primers have SNPs placed therein.

According to a preferred embodiment, said 19 primer sequences are shown as SEQ ID NO 1-19 in Table 4, respectively.

In one embodiment, 5 to 50nt of DNA (Barcode) with different sequences is added to the 5' end of the primer, which can be used to distinguish different samples.

In one embodiment, the 5' end Barcode of the F and R primers may be the same or different and may be selected by one skilled in the art as desired.

In one embodiment, the PCR amplification product may or may not be purified before proceeding to the next reaction, and may be selected by those skilled in the art as desired.

According to a preferred embodiment, wherein the kit can simultaneously detect:HBA1/2all point mutations within the primer range at the gene locus, 30 large fragment deletions (including- -SEA, - - α 3.7, - - α 4.2, - -THAI and- -FIL, etc., as shown in Table 1) and 6 structural variations (α α α anti3.7, α α anti4.2, HK α, anti HK α; α α α α anti3.7, and α α α α anti 4.2);HBBandHBD28 point mutations within the primer range on the gene locusDeletion of large fragment (including Chinese)^Gγ(^Aγ δ β)0-Thal and SEA-HPFH, etc., as shown in Table 2) and 2 structural variations (Hb Anti-Lepore and Hb Miyada).

According to a preferred embodiment, the kit can simultaneously detect and distinguish three types of mutations-alpha 3.7, alpha anti4.2 and HK alpha, and can also simultaneously detect and distinguish three types of mutations-alpha 4.2, alpha anti3.7 and anti HK alpha.

According to a preferred embodiment, wherein the kit is for detectionHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

According to a preferred embodiment, wherein the multiplex PCR amplification is performed in a single reaction tube.

In one embodiment, the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by ONT.

According to a preferred embodiment, wherein the reagents for constructing the three-generation PacBio library include end-repair enzymes, linkers, ligases, DNA purification beads, 80% ethanol, DNA repair mix, reaction buffer and exonucleases.

In one embodiment, PacBio library adaptor ligation may use blunt-end ligation or TA ligation.

In one embodiment, the PacBio universal blunt-end linker sequence is 5 '-pattctctctctctcttcctcctcctccgttgttgttgttgagagagagagat-3', and the blunt-end stemcyclic structure linker aptamer is formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

In one embodiment, the PacBio universal TA linker sequence is 5 '-pattctctctctcttttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

In one embodiment, the PacBio linker may or may not be Barcode, and may be selected by one skilled in the art as desired.

In one embodiment, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by one skilled in the art as desired.

According to a preferred embodiment, the PacBio library is matched to the Pacific Biosciences sequencing platform.

According to a preferred embodiment, wherein the reagents for constructing the three-generation Nanopore library include a terminal repair enzyme, a linker, a ligase, a DNA purification magnetic bead, 80% ethanol and a reaction buffer.

In one embodiment, Nanopore library adaptor ligation may be by blunt end ligation or TA ligation.

In one embodiment, the Nanopore linker may or may not be a Barcode, and may be selected by one skilled in the art as desired.

In one embodiment, the Nanopore linker is either Barcode, designed by the company ONT, or Barcode, designed by itself, and can be selected as desired by one skilled in the art.

According to a preferred embodiment, the Nanopore library is matched to the ONT corporation sequencing platform.

In a third aspect of the invention, there is provided a method of detecting a subjectHBA1/2, HBB and HBDA method of gene mutation comprising the steps of:

(1) preparing a sample of a subject;

(2) in a multiplex PCR amplified sampleHBA1/2, HBB and HBDA mutated segment of the gene;

(3) constructing a third generation sequencing library;

(4) sequencing and analysisHBA1/2, HBB and HBDThe type of gene mutation. Wherein the multiplex PCR amplification uses the primer set of the present invention described above.

The method of the invention can detect the subjects simultaneouslyHBA1/2, HBB and HBDThe gene is multi-mutated.

According to one embodiment of the invention, the multiplex PCR amplificationThere were 19 primers, the schematic design of the primers is shown in FIGS. 1A to 1B, and the coordinate position range of the genome of the primers is shown in Table 3. The primer can amplifyHBA1/2, HBB and HBDThe complete entire sequence of the gene, including any type of mutated sequence within the primer. Preferably, the amplification product of each primer is less than 25 Kb. Preferably, degenerate base primers are used if the primers have SNPs placed therein.

According to a preferred embodiment, the primer sequences are shown in Table 4 as SEQ ID NO 1-19.

In one embodiment, 5 to 50nt of DNA (Barcode) with different sequences can be added to the 5' end of the primer for distinguishing different samples.

In one embodiment, the 5' end Barcode of the F and R primers may be the same or different and may be selected by one skilled in the art as desired.

In one embodiment, the PCR amplification product may or may not be purified before proceeding to the next reaction, and may be selected by those skilled in the art as desired.

According to a preferred embodiment, wherein the method can simultaneously detect:HBA1/2all point mutations within the primer range at the gene locus, 30 large fragment deletions (including- -SEA, - - α 3.7, - - α 4.2, - -THAI and- -FIL, etc., Table 1) and 6 structural variations (α α α anti3.7, α α α anti4.2, HK α, anti HK α; α α α α anti3.7, and α α α α α anti 4.2);HBBandHBDall point mutations in the primer range on the gene locus, 28 large fragment deletions (including Chinese)^Gγ(^Aγ δ β)0-Thal and SEA-HPFH et al, Table 2) and 2 structural variations (Hb Anti-Lepore and Hb Miyada).

According to a preferred embodiment, the method can simultaneously detect and distinguish three types of mutations-alpha 3.7, alpha anti4.2 and HK alpha, and can also simultaneously detect and distinguish three types of mutations-alpha 4.2, alpha anti3.7 and anti HK alpha.

According to a preferred embodiment, wherein the method is for detectingHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

According to a preferred embodiment, wherein the multiplex PCR amplification is performed in a single reaction tube.

In one embodiment, wherein the sample is selected from a biological sample or gDNA extracted from a sample. Wherein the biological sample is selected from cultured cell lines, blood, amniotic fluid, villi, gametes, blastocytes, synovial fluid, urine, sweat, saliva, stool, cerebrospinal fluid, ascites, pleural fluid, bile or pancreatic fluid.

In one embodiment, the third generation sequencing is selected from PacBio sequencing by Pacific Biosciences or Nanopore sequencing by ONT.

In one embodiment, PacBio library adaptor ligation may use blunt-end ligation or TA ligation.

In one embodiment, the PacBio universal blunt-end linker sequence is 5 '-pattctctctctctcttcctcctcctccgttgttgttgttgagagagagagat-3', and the blunt-end stemcyclic structure linker aptamer is formed by annealing. Different linker aptamers with Barcode can be formed by adding DNA (Barcode) with 5-50nt different sequences to the stem. The PacBio libraries with different barcodes can be sequenced mixed together.

In one embodiment, the PacBio universal TA linker sequence is 5 '-pattctctctctcttttcctcctcctcctccgttgttgttgttgagagagagatt-3', which is annealed to form a blunt-ended stem-loop structure linker aptamer. The stem can be added with DNA (Barcode) with different sequences of 5-50nt to form different linkers with Barcode

In one embodiment, the PacBio linker is a Barcode designed by PacBio corporation or a Barcode designed by itself, which can be selected by one skilled in the art as desired.

According to a preferred embodiment, the PacBio library is matched to the Pacific Biosciences sequencing platform.

According to a preferred embodiment, wherein the reagents for constructing the three-generation Nanopore library include a terminal repair enzyme, a linker, a ligase, a DNA purification magnetic bead, 80% ethanol and a reaction buffer.

In one embodiment, Nanopore library adaptor ligation may be by blunt end ligation or TA ligation.

In one embodiment, the Nanopore linker may or may not be a Barcode, and may be selected by one skilled in the art as desired.

In one embodiment, the Nanopore linker is either Barcode, designed by the company ONT, or Barcode, designed by itself, and can be selected as desired by one skilled in the art.

According to a preferred embodiment, the Nanopore library is matched to the ONT corporation sequencing platform.

In another aspect, the present invention relates to a system for detecting a mutation in a genetic locus, which can simultaneously detect a subjectHBA1/2, HBB and HBDA plurality of mutations at a locus of a gene, the system comprising the following modules:

(1) an acquisition module: obtaining a subject sample;

(2) an amplification module: multiplex PCR simultaneous amplification in said sampleHBA1/2, HBB and HBDA gene fragment;

(3) a library construction module: constructing a third generation sequencing library;

(4) a sequencing module: sequencing and analysisHBA1/2, HBB and HBDThe type of gene mutation. Wherein, the primer group of the invention is adopted in the amplification module.

In one embodiment, the system of the invention is used for detectionHBA1/2, HBB and HBDWhether different mutations of a gene are linked.

In a preferred embodiment, the multiplex PCR amplification according to the invention is performed in a single reaction tube.

In one embodiment, the three-generation sequencing described herein is selected from PacBio sequencing by Pacific Biosciences, Inc., or Nanopore sequencing by Oxford Nanopore Technologies (ONT).

The method based on the specific combination of PCR amplification and third-generation high-throughput sequencing can realize the simultaneous detection of a plurality of samples with high specificity, accuracy and rapidnessHBA1/2, HBB and HBDMultiple mutations in the gene.

The excellent technical effects of the method and the kit mainly lie in the following aspects:

(1) the detection range is wide. The invention can detect simultaneouslyHBA1/2, HBB and HBDAll deletion and non-deletion mutations within the gene locus primer range (tables 1 and 2).

(2) Single tube detection of multiple mutation types. The traditional method needs to set a detection system for each mutation type, and the invention simultaneously detects multiple deletion type and non-deletion type poor mutations in a reaction primer system, including rare structural variations, such as HK alpha, anti HK alpha, alpha anti3.7, alpha anti4.2, alpha anti3.7, alpha anti4.2 and the like.

(3) The detection accuracy is high. Conventional GAP-PCR cannot distinguish between alpha-thalassemia-alpha 3.7 deletion and HK alpha structural variation, and cannot distinguish between-alpha 4.2 deletion and anti HK alpha structural variation, which can cause a certain degree of false detection. The present invention can distinguish these deletion mutations from rare structural variations well.

(4) The samples were diversified. The template for PCR may be extracted genomic DNA, or may be a human cell line or a specific tissue.

(5) High-throughput detection. The third generation sequencing can realize 384 Barcode linkers, and actually more Barcode linkers can be designed according to needs. Or a double Barcode system of primer strip Barcode and linker strip Barcode is utilized to realize more Barcode combinations. The high throughput characteristics of the third generation sequencing platform determine that high throughput sample detection can be achieved.

(6) The accuracy is high. The dumbbell library of PacBio can be subjected to multiple rounds of reading during sequencing, and the base accuracy of the corrected sequencing result is more than 99%. And PacBio sequencing errors were random and corrected for base accuracy by sequencing depth to greater than 99.9%. Therefore, the deletion type and the non-deletion type in the detection range of the primer can be accurately readHBA1/2、HBBAndHBDand (3) gene mutation. Meanwhile, due to the characteristic of reading length and measuring length by PacBio, the method disclosed by the invention can also be used for detecting whether different mutations are linked.

(7) The detection time is flexible. The Nanopore platform can generate data in minutes, and can start data analysis in minutes or hours according to actual data volume requirements. The Nanopore platform has time advantages when the requirement for detection time efficiency is high.

Drawings

Fig. 1A to 1B: schematic design of multiplex PCR primers, wherein FIG. 1A showsHBA1/2Gene mutation, and FIG. 1B showsHBB-HBDAnd (3) gene mutation.

FIG. 2: DNA gel images of different deletion mutant samples were amplified according to the multiplex PCR method in example 1.

FIG. 3: representative ofHBA1/2, HBB and HBDGene mutation sample PacBio sequencing result graph. Wherein A is a- α 3.7/HK α α sample, B is an α α α anti3.7/α α α anti4.2 sample, C is a-THAI/+ sample, D is an HBB: c.126- -129 delCTTT/C. -11- -8delAAA transmutant sample, E is an HBD: C. -127T>C/+ samples, F are Chinese G (γ A γ δ β)0-Thal/+ samples.

Detailed Description

Example 1: amplification of differences Using the multiplex PCR method of the inventionHBA1/2, HBB and HBDGene mutation

Different types of amplification were prepared according to the following reaction schemeHBA1/2, HBB and HBDGene mutated peripheral blood sample:

on a PCR instrument, pre-amplification is carried out according to the following conditions:

after amplification was complete, 20ul of each sample was tested on a 1% DNA gel, the results are shown in FIG. 2,HBA1/2genes andHBB-HBDdifferent deletion type mutations of genes andHBBthe genes can be effectively amplified.

Example 2: construction of PacBio sequencing library Using the multiplex PCR method of the present invention

Step 1: multiplex PCR amplification

Peripheral blood samples with different types of HBA1/2, HBB and HBD gene mutations were amplified according to the following preparation reaction system:

on a PCR instrument, pre-amplification is carried out according to the following conditions:

after amplification, the amplification product was put into a centrifuge at 10000rpm for 20 min. After the centrifugation, the mixture was left standing horizontally, and 4. mu.L of the supernatant was added to a new tube.

Step 2: construction of PacBio sequencing library

The reaction system was prepared as follows:

on a PCR instrument, the reaction is carried out according to the following conditions: 37 ℃ for 20min, 25 ℃ for 15 min and 65 ℃ for 10 min. After the reaction was completed, 0.5 uL of Exonaclease III (NEB, Cat # M0206L) and 0.5 uL of Exonaclease VII (NEB, Cat # M0379L) were added and the reaction was continued at 37 ℃ for 1 hour. The DNA was purified twice using 0.6X Ampure PB beads (PacBio, Cat # 100-. The resulting DNA eluate was the target DNACBio sequencing library. The DNA concentration was determined on a Qubit 3 Fluorometer (ThermoFisher, Cat # Q33216) using a Qubit dsDNA HS reagent (ThermoFisher, Cat # Q32851). When there are multiple samples of the PacBio sequencing library, equal amounts of the library can be mixed together to prepare a mixed library.

And step 3: sequencing and analysis on a PacBio machine

According to the total concentration and molar concentration of the library, the library with an appropriate volume is reacted with a binding reagent (PacBio, Cat #101-820-200) and a primer (PacBio, Cat # 100-970-100) to prepare the final operable library. Representative sequencing results are shown in FIG. 3, where FIG. 3A is the- α 3.7/HK α α sample and FIG. 3B is α α α anti3.7/α α α anti4.2 sample, FIG. 3C- -THAI/+ sample, FIG. 3D HBB c.126- -129 delCTTT/c.11- -8delAAA transmutant sample, FIG. 3E HBD c.127T>C/+ samples, FIG. 3F are Chinese G (γ A γ δ β)0-Thal/+ samples. These results indicate that the method can simultaneously detect accuratelyHBA1/2、HBBAndHBDmultiple mutations at the gene locus.

It should be noted that the reagents, reaction conditions, etc. involved in the multiplex PCR reaction and the construction of the PacBio sequencing library can be adjusted and changed according to specific needs. It will thus be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims.

Reference to the literature

[1] Modell B, Darlison M. Bull World Health Organ. Global epidemiology of haemoglobin disorders and derived service indicators. 2008 Jun;86(6):480-7. Doi:10.2471/blt.06.036673.

[2] Chui DH. Alpha-thalassaemia and population health in Southeast Asia. Ann Hum Biol. 2005 Mar-Apr;32(2):123-30. doi: 10.1080/03014460500075084.

[3] Xuxiangmin. Mediterranean anemia prevention and control guidelines [ M ]. Beijing: civil and military medical publishers, 2011.

[4] Zhang L, Zhang Q, Tang Y, Cong P, Ye Y, Chen S, Zhang X, Chen Y, Zhu B, Cai W, Chen S, Cai R, Guo X, Zhang C, Zhou Y, Zou J, Liu Y, Chen B, Yan S, Chen Y, Zhou Y, Ding H, Li X, Chen D, Zhong J, Shang X, Liu X, Qi M, Xu X. Hum Mutat. 2019 Dec;40(12):2221-2229. LOVD-DASH: A comprehensive LOVD database coupled with diagnosis and an at-risk assessment system for hemoglobinopathies. doi: 10.1002/humu.23863. Epub 2019 Sep 11.

[5] The Chinese medical society medical genetics division hereditary diseases clinical practice guidelines are written. Holding the pen: spin, Zhanxinhua, Yang Fang, Xuxiangmin. Clinical practice guidelines for alpha-thalassemia. Journal of Chinese medical genetics. March 2020, Vol.37, No. 3.

[6] Shang X, Li Q, Cai R, Huang J, Wei X, Xu X. Molecular characterization and clinical presentation of HKαα and anti-HKαα alleles in southern Chinese subjects. Clin Genet. 2013 May;83(5):472-6. doi: 10.1111/cge.12021. Epub 2012 Oct 10.

[7] Thein SL. Molecular basis of β thalassemia and potential therapeutic targets. Blood Cells Mol Dis. 2018 May;70:54-65. doi: 10.1016/j.bcmd.2017.06.001. Epub 2017 Jun 20.

class=WordSection2>

[8] Shang X, Xu X. Update in the genetics of thalassemia: What clinicians need to know. Best Pract Res Clin Obstet Gynaecol. 2017 Feb;39:3-15. doi: 10.1016/j.bpobgyn.2016.10.012. Epub 2016 Oct 26.

[9] The Chinese medical society medical genetics division hereditary diseases clinical practice guidelines are written. Holding the pen: jade, Wu scholarly, Zhang Xinhua, Von Xiao Du, Xunxiang. Clinical practice guidelines for beta-thalassemia. Journal of Chinese medical genetics. March 2020, Vol.37, No. 3.

[10] Jie Zhang, Yang Yang, Peng Li, Yuanlong Yan, Tao Lv, Tingting Zhao, Xiaohong Zeng, Dongmei Li, Xiaoyan Zhou, Hong Chen, Jie Su, Tonghua Yang, Jing He, Baosheng Zhu. Analysis of deletional hereditary persistence of fetal hemoglobin/δβ-thalassemia and δ-globin gene mutations in Southerwestern China. Mol Genet Genomic Med. 2019 Jun;7(6):e706. doi: 10.1002/mgg3.706. Epub 2019 May 1.

[11] M Phylipsen, M V E Gallivan, S G J Arkesteijn, C L Harteveld, P C Giordano. Occurrence of common and rare δ-globin gene defects in two multiethnic populations: thirteen new mutations and the significance of δ-globin gene defects in β-thalassemia diagnostics. Int J LabHematol. 2011Feb;33(1):85-91.doi:10.1111/j.1751-553X.2010.01255.x.