阅读说明：本技术 一种磷酸烯醇式丙酮酸羧激酶及其应用 (Phosphoenol pyruvate carboxykinase and application thereof ) 是由 陈海琴 陈汉钦 常璐璐 赵建新 张灏 陈卫 于 2021-08-31 设计创作，主要内容包括：本发明公开了一种磷酸烯醇式丙酮酸羧激酶及其应用,属于基因工程以及微生物工程技术领域。本发明披露了磷酸烯醇式丙酮酸羧激酶是糖异生途径的限速酶,参与胞内碳通量的分配,该基因对总脂质积累和多不饱和脂肪酸积累均有负调控作用。本发明通过抑制高山被孢霉的Mapepck基因的表达,可以降低糖异生水平并导致总糖水平下降从而促进脂质的积累,并在发酵后期显著提高花生四烯酸ARA产量,还能使菌株提前到达脂质最大积累时间,相比于出发菌株更具有产脂优势。本发明在工业生产中具备广泛的应用价值。(The invention discloses phosphoenolpyruvate carboxykinase and application thereof, belonging to the technical field of genetic engineering and microbial engineering. The invention discloses phosphoenolpyruvate carboxykinase which is a rate-limiting enzyme of gluconeogenesis pathway, participates in distribution of intracellular carbon flux, and has negative regulation and control effects on accumulation of total lipid and accumulation of polyunsaturated fatty acid. According to the invention, by inhibiting the expression of the Mapepck gene of mortierella alpina, the gluconeogenesis level can be reduced, the total sugar level is reduced, the accumulation of lipid is promoted, the ARA yield of arachidonic acid is obviously improved at the later stage of fermentation, the maximum accumulation time of lipid can be reached by the strain in advance, and the method has the advantage of lipid production compared with the original strain. The invention has wide application value in industrial production.)

1. Use of phosphoenolpyruvate carboxykinase for increasing lipid synthesis ability of Mortierella alpina, wherein the phosphoenolpyruvate carboxykinase is one of (a) or (b):

(a) 1, a protein consisting of an amino acid sequence shown in SEQ ID NO; alternatively, the first and second electrodes may be,

(b) a polypeptide having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO. 1.

2. The use according to claim 1, wherein the expression of phosphoenolpyruvate carboxykinase is reduced in Mortierella alpina.

3. The use according to claim 2, wherein the improvement in lipid synthesis capacity of Mortierella comprises but is not limited to (a) - (c):

(a) increase the accumulation of total lipids;

(b) increasing the conversion of intracellular carbohydrates to lipids;

(c) the ratio of polyunsaturated fatty acids is increased.

4. The use according to claim 3, wherein the lipid includes, but is not limited to, phospholipids, glycerides or arachidonic acid.

5. A method for improving the yield of Mortierella alpina lipid, which comprises knocking down the expression of phosphoenolpyruvate carboxykinase in Mortierella alpina, wherein the phosphoenolpyruvate carboxykinase is one of (a) or (b):

(a) 1, a protein consisting of an amino acid sequence shown in SEQ ID NO; alternatively, the first and second electrodes may be,

(b) a polypeptide having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO. 1.

6. The method of claim 5, wherein the expression level of phosphoenolpyruvate carboxykinase is reduced by RNA interference.

7. The method of claim 5, wherein the fragment with the nucleotide sequence shown in SEQ ID NO. 2 is selected as the interference fragment, an RNA interference plasmid is constructed, the RNA interference plasmid is transferred into Mortierella alpina to construct a recombinant strain, and the recombinant strain is used for fermentation production of lipid.

8. A method for producing lipid is characterized in that a recombinant strain with reduced phosphoenolpyruvate carboxykinase is inoculated into a fermentation system to produce the lipid, and the recombinant strain takes mortierella alpina as an original strain.

9. The method of claim 8, wherein the fermentation system comprises 30-80 g/L glucose, 2.0-2.5 g/L ammonium tartrate, 1.0-2.0 g/L yeast extract, 5-10 g/L potassium dihydrogen phosphate, 1.0-3.0 g/L disodium hydrogen phosphate, 1.0-2.0 g/L magnesium sulfate heptahydrate, 0.01-0.1 g/L calcium chloride dihydrate, and trace elements.

10. The method according to claim 9, wherein the activated strain is added into a shake flask fermentation system according to the volume ratio of 1-2%, and cultured for not less than 96 hours at 25-30 ℃ and 180-220 rpm;

or adding the recombinant strain activated for 24-48 h into a fermentation system of a fermentation tank according to the volume ratio of 1-2%, and culturing at 25-30 ℃ and the ventilation volume of 1.0-2.0 vvm and the pH value of 6.0 +/-0.1 for not less than 72 h.

Technical Field

The invention relates to phosphoenolpyruvate carboxykinase and application thereof, in particular to a method for promoting lipid accumulation by adjusting carbon source distribution between sugar and lipid of oleaginous fungi, belonging to the technical field of genetic engineering and microbial engineering.

Background

Mortierella alpina (m. alpina) is a strain of oleaginous filamentous fungi that can accumulate a large amount of lipids including triglycerides, phospholipids, sterols, free fatty acids, and the like, wherein Arachidonic acid (ARA) is the most abundant fatty acid and is mainly present in lipid droplets in the form of triglycerides. ARA is a long chain omega-6 PUFAs, present in human blood and vital organs, and is often used as an additive in food formulations to promote the development and health of the brain, nervous system and vascular system. The ARA-rich oil and fat produced by Mortierella alpina is certified by the safety of the United states food and drug administration, and is currently used as a commercial strain for industrial production of food-grade ARA, and is also an important model microorganism for researching lipid metabolism.

In recent years, research on mortierella alpina has been gradually expanded to genetic modification and multigroup research of lipid metabolism-related genes from strain breeding and fermentation condition optimization. At present, the whole genome sequencing and annotation work of a plurality of mortierella alpina is completed, researchers draw a lipid metabolism network diagram of the mortierella alpina according to genome data analysis, and comprehensively analyze lipid synthesis pathways of the mortierella alpina by combining transcriptome data, proteome data, lipidome data and other data, so that a valuable reference basis is provided for genetic modification of the strain. The genetic operation system suitable for the mortierella alpina is gradually established and perfected, and the yield of total fatty acids and ARA in the mortierella alpina is enhanced by modifying key enzymes in a lipid synthesis pathway of the mortierella alpina and increasing the supply of substrates and reducing power in the fatty acid synthesis process; and the construction of high-yield EPA Mortierella alpina recombinant bacteria at normal temperature and the optimization of fermentation strategy are realized by homologous and heterologous expression of omega-3 fatty acid desaturase. By deeply exploring the lipid synthesis pathway of the mortierella alpina, the method plays an active promoting role in constructing a mortierella alpina cell factory with high yield and high added value of PUFAs.

In addition to lipids, microorganisms are able to store large amounts of carbon sources in the form of sugars in cells, and therefore sugar synthesis is also an important link of carbon metabolism, participating in the diversion of carbon flux. The sugars accumulated in the cells can be divided into structural sugars and non-structural sugars, wherein the structural sugars are mainly fixed accumulation forms of cell walls and membrane polysaccharides which are usually carbon sources, and are accumulated in the early growth stage of microorganisms, such as yarrowia lipolytica and lipomyces starkeyi which are synthesized into polysaccharides in large quantities in the cell proliferation stage before nitrogen limitation in oleaginous yeast; while non-structural carbohydrates can continue to accumulate after a cell proliferation period, for example, the oil-producing filamentous fungi P.fulvum and the oil-producing microalgae Chlorella vulgaris are found to accumulate a large amount of carbohydrates during lipid accumulation after nitrogen limitation. The synthesis of the saccharides relates to the shunting of glucose-6-phosphate, and is closely related to the balance of intracellular saccharide and lipid accumulation of the oleaginous microorganisms.

The mortierella alpina has outstanding fatty acid accumulation capacity and wide development prospect. Although a great deal of research related to lipid synthesis has been carried out in mortierella alpina in early days and fermentation technology is utilized to optimize lipid production or genetic modification of lipid metabolism related genes to improve the synthesis capability of PUFAs, how to improve the lipid synthesis capability is a problem worthy of continuous excavation, and further understanding of metabolic function analysis of direct or indirect pathways of lipid synthesis and environmental adaptability of growth of mortierella alpina is required. The carbon flux flow direction in glycolysis and gluconeogenesis pathways of the oil-producing microorganisms is closely related to synthesis of lipid and carbohydrate, but at present, sugar and lipid balance in oil-producing filamentous fungi such as mortierella alpina and the like and further promotion of lipid synthesis by changing carbohydrate synthesis are not deeply researched, so that research on functions of different genes on growth of strains and a sugar and lipid accumulation process in the lipid accumulation process has guiding significance for industrial production of the mortierella alpina-derived PUFAs through regulation and control of carbohydrate metabolism-related genes on carbon flow distribution and carbohydrate and lipid synthesis pathways.

Disclosure of Invention

The inventor carries out cell total metabolite component analysis on the mortierella alpina ATCC 32222 through GC-MS technology in the prior period, and the result shows that the carbohydrate has higher proportion in the content of the intracellular total metabolite, phosphoenolpyruvate carboxykinase (PEPCK protein) is a rate-limiting enzyme of a gluconeogenesis pathway, and the gluconeogenesis process can cause pyruvate to flow out of a fatty acid synthesis pathway, provide carbon flux for the synthesis of the carbohydrate and is not beneficial to the generation of fatty acid. The gluconeogenesis pathway has 4 rate-limiting steps and requires the participation of ATP or GTP, so that the gluconeogenesis not only causes the carbon source to be in 'counter-current' but also consumes a large amount of energy. The PEPCK protein is the most important gluconeogenic enzyme in most cells, almost all substances capable of generating oxaloacetate can enter gluconeogenesis through catalysis of the PEPCK protein, and the PEPCK protein mainly catalyzes the formation of PEP and CO from the oxaloacetate₂. Analysis of mortierella alpina metabolome data shows that accumulation of PEP is mainly caused by catalysis of PEPCK protein in a gluconeogenesis direction, and the catalytic step is a necessary path for conversion of pyruvate into sugars, so that pyruvate flows out of a lipid synthesis pathway and provides a carbon source for carbohydrate synthesis, and therefore, a key node for redistribution of carbon flux between lipid and sugars can be controlled.

The invention takes the accumulation characteristic of saccharides and lipids in the fermentation process of the mortierella alpina as a starting point, analyzes the action of the encoded gene pepck of the key enzyme phosphoenolpyruvate carboxykinase in the accumulation process of the saccharides in the carbon flux distribution and the influence on the accumulation of the saccharides and the lipids by taking the encoded gene pepck of the key enzyme phosphoenolpyruvate carboxykinase in the accumulation process of the saccharides as a research object, aims to explain the influence of the key genes for synthesizing the saccharides on the accumulation of the mortierella alpina lipids, achieves the aim of improving the accumulation of the cell lipids by redistributing the carbon flux for storing the saccharides and the lipids in cells, and provides a new thought for further improving the lipid content of the oil-producing fungi by a genetic engineering means.

The invention provides an application of phosphoenolpyruvate carboxykinase in improving lipid synthesis capacity of Mortierella alpina, wherein the phosphoenolpyruvate carboxykinase is any one of (a) or (b):

(a) 1, a protein consisting of an amino acid sequence shown in SEQ ID NO; alternatively, the first and second electrodes may be,

(b) a polypeptide having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO. 1.

In one embodiment, the expression of the phosphoenolpyruvate carboxykinase is decreased in mortierella alpina.

In one embodiment, the recombinant strain is a mortierella alpina starting strain.

In one embodiment, the mortierella alpina is mortierella alpina CCFM 501.

In one embodiment, the method for improving lipid synthesis ability of a spore comprises, but is not limited to (a) to (c):

(a) increase the accumulation of total lipids;

(b) increasing the conversion of intracellular carbohydrates to lipids;

(c) the ratio of polyunsaturated fatty acids is increased.

In one embodiment, the lipid includes, but is not limited to, phospholipids, glycerides or arachidonic acid.

The invention provides a method for improving the lipid yield of mortierella alpina, which is used for knocking down the expression of phosphoenolpyruvate carboxykinase in the mortierella alpina, wherein the phosphoenolpyruvate carboxykinase is any one of (a) or (b):

(a) 1, a protein consisting of an amino acid sequence shown in SEQ ID NO;

alternatively, the first and second electrodes may be,

(b) a polypeptide having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO. 1.

In one embodiment, the expression level of the phosphoenolpyruvate carboxykinase is reduced by RNA interference.

In one embodiment, a fragment with a nucleotide sequence shown as SEQ ID NO. 2 is selected as an interference fragment, an RNA interference plasmid is constructed, the RNA interference plasmid is transferred into Mortierella alpina to construct a recombinant strain, and the recombinant strain is utilized to produce lipid through fermentation.

In one embodiment, the recombinant strain is a mortierella alpina starting strain.

In one embodiment, the mortierella alpina is mortierella alpina CCFM 501, and is disclosed in patent document No. CN 105567579A.

In one embodiment, the starting vector is pBIG2-ura5s-ITS vector, which is described in the patent application publication No. CN103571762A, and pBIG2-ura5s-ITS vector.

The invention provides a method for producing lipid, which comprises the step of inoculating a recombinant strain with a knocked-down phosphoenolpyruvate carboxykinase into a fermentation system to produce the lipid, wherein the phosphoenolpyruvate carboxykinase is one of (a) or (b):

(a) 1, a protein consisting of an amino acid sequence shown in SEQ ID NO; alternatively, the first and second electrodes may be,

(b) a polypeptide having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO. 1.

In one embodiment, the recombinant strain is a mortierella alpina starting strain.

In one embodiment, the mortierella alpina is mortierella alpina CCFM 501, and is disclosed in patent document No. CN 105567579A.

In one embodiment, the fermentation system comprises 30-80 g/L glucose, 2.0-2.5 g/L ammonium tartrate, 1.0-2.0 g/L yeast extract, 5-10 g/L potassium dihydrogen phosphate, 1.0-3.0 g/L disodium hydrogen phosphate, 1.0-2.0 g/L magnesium sulfate heptahydrate, 0.01-0.1 g/L calcium chloride dihydrate and trace elements.

In one embodiment, the activated strain is added into a shake flask fermentation system according to the volume ratio of 1-2%, and cultured for not less than 96h at 25-30 ℃ and 180-220 rpm;

or adding the recombinant strain activated for 30-36 h into a fermentation system of a fermentation tank according to the volume ratio of 1-2%, and culturing at 25-30 ℃ and the ventilation volume of 1.0-2.0 vvm and the pH value of 6.0 +/-0.1 for not less than 72 h.

Preferably, the shake flask fermentation time is not less than 168 hours; the fermentation time of the fermentation tank is not less than 120 h.

[ advantageous effects ]

(1) The invention discloses a synthesis way of fatty acid caused by pyruvic acid outflow during gluconeogenesis of phosphoenolpyruvate carboxykinase (Mapepck), which provides carbon flux for carbohydrate synthesis, and RNA interference on a coding gene of the phosphoenolpyruvate carboxykinase or knockout of the gene can obviously reduce the activity of the phosphoenolpyruvate carboxykinase, thereby inhibiting the gluconeogenesis; (2) in the lipid accumulation process, the interference of the Mapepck gene of the mortierella alpina causes the down-regulation of the total sugar content in cells by 17-28%, the lipid content is improved by 17-26%, and the later-stage ARA yield is improved by nearly 42%; (3) RNA interference on the Mapepck gene reduces gluconeogenesis level and causes total sugar level to be reduced, so that accumulation of lipid is promoted, and generation of fatty acid synthesis precursors and reducing power can be promoted by accelerating the circulation of pyruvic acid-citric acid; (4) the Mapepck gene interference strain is amplified and cultured in a fermentation tank, so that the yield of fatty acid is improved, the maximum accumulation time of lipid of the strain can be reached in advance, and the Mapepck gene interference strain has the advantage of lipid production compared with an original strain.

The mortierella alpina Mapepck provided by the invention can perform RNA interference by means of genetic engineering, is used for weakening the capability of carbon flux provided by gluconeogenesis of cells for carbohydrate synthesis, reducing the accumulation of total sugar in cells, promoting the up-regulation of pyruvate-citrate cycle in cells, causing the increase of the levels of metabolites such as citric acid and reducing power NADPH which are beneficial to fatty acid synthesis, and improving the total fatty acid content by 26%, wherein the yield of polyunsaturated fatty acid arachidonic acid (ARA) with biological activity is improved by 42%. And in the fermentation tank amplification culture, the interference of the Mapepck gene can improve the utilization degree of the carbon source by the mortierella alpina, further improve the lipid yield and advance the mortierella alpina to the maximum lipid accumulation period.

Drawings

FIG. 1 shows the variation of the gene transcription (a) of Mapepck gene and the expression level (b) of the corresponding protein Mapepck in fermentation process of Mortierella alpina.

FIG. 2 is a schematic diagram of the construction of an RNA interference binary plasmid.

FIG. 3 is a schematic diagram of binary plasmid construction of a recombinant Mortierella alpina M.alpina-RIpepck RNA interference strain and PCR verification of the RNA interference strain; m: marker, NC: the negative reference is Mortierella alpina CCFM 501, 1-10: mappck RNA interference strain transformant, PC: the positive reference is E.coli carrying a mappck interference vector.

Fig. 4 is a graph showing the analysis of significant differences in biomass, carbohydrate and lipid contents between the recombinant mortierella alpina m. Indicates that there was a significant difference between the interfering strain and the control strain prototrophic mortierella alpina (— indicates p <0.001, — indicates 0.001< p <0.01, — indicates 0.01< p < 0.05).

Fig. 5 shows the levels of mappeck transcription and enzyme activity at 96h in the recombinant mortierella alpina m.

Fig. 6 shows the total fatty acid content, intracellular total sugar content and ARA content changes during the fermentation process of the recombinant mortierella alpina m.

FIG. 7 shows the residual sugar content of growth and intracellular accumulation in the fermenter for the amplified culture of recombinant Mortierella alpina M.alpina-RIpepck interfering strain; (b) total biomass; (c) total sugar yield; (d) total fatty acid production.

Detailed Description

The invention will be further illustrated with reference to specific examples.

Mortierella alpina (Mortierella alpina) ATCC 32222, referred to in the following examples, was purchased from American Standard Biologicals Collection (ATCC); mortierella alpina CCFM 501 in the following examples is disclosed in patent document No. CN 105567579A; agrobacterium tumefaciens (AGL-1) referred to in the examples below was purchased from Beijing Huayue ocean organisms; coli (Escherichia coli) DH5 a referred to in the examples below was purchased from Invitrogen; the pBIG2-ura5s-ITS vector referred to in the following examples is described in the patent application publication No. CN 103571762A; the Mortierella alpina uracil auxotrophic strain referred to in the following examples is described in patent application publication No. CN 103468581A.

Mortierella alpina (Mortierella alpina) ATCC 32222, Agrobacterium tumefaciens AGL-1 (Agrobacterium tumefaciens) AGL-1, and Escherichia coli (Escherichia coli) DH 5. alpha. are all commercially available without the need for preservation for proprietary procedures.

KOD plus high-fidelity DNA polymerase referred to in the following examples was purchased from Toyobo, Japan; taq DNA polymerase was purchased from CWBIO, described in the following examples; the reverse transcription Kit (PrimeScript RT regent Kit with gDNAeraser RR047A & R6110A) referred to in the examples below was purchased from Takara; the plasmid extraction kit referred to in the following examples was purchased from Beijing Tiangen Biochemical technology Co., Ltd; fungal genomic DNA extraction kits referred to in the following examples were purchased from BioFlux; restriction enzymes, T4 ligase, Trizol, PCR product purification kit, gel recovery kit, GeneRuler DNA Ladder Mix, PageRuler Prestated Protein Ladder, referred to in the examples below, were purchased from Thermo Scientific; the n-pentadecanoic acid (C15:0), 20% (w/w) methanol hydrochloride referred to in the examples below was purchased from Sigma; DEPC water, Kanamycin (Kanamycin, Kana), Rifampicin (Rifamicin, Rif), Spectinomycin (Spe), Cefotaxime sodium (Cef), aminoless yeast nitrogen source (YNB) and various amino acids mentioned in the following examples were purchased from Shanghai bioengineering, Inc.; yeast extracts, tryptone, referred to in the examples below were purchased from Oxoid; the low adsorption type enzyme-free tips, enzyme-free centrifuge tubes, enzyme-free PCR tubes, 2mL brown gas bottles, and bottle caps referred to in the examples below were purchased from Suzhou Koloni Bio Inc.; the inducing transforming agents acetosyringone (Acetosporione, AS, CAS # [2478-38-8]), 2- (N-morpholine) ethanesulfonic acid (MES buffer, CAS # [145224-94-8]), uracil (Urail), Yeast Nitrogen source (Yeast Nitrogen Base, without amino acids CAS # [ A610507-0500] Lot: C418BA0040) and various amino acids mentioned in the following examples were purchased from Biotechnology (Shanghai) GmbH; other reagents were purchased from the national pharmaceutical group. Chromatographic grade reagent methanol was purchased from merck, germany; GC-MS derivatization reagents and internal standard heneicosanoic acid (C21:0) were purchased from Sigma, USA; the glucose determination kit is purchased from Nanjing to build a biotechnology limited company; the phosphoenolpyruvate carboxykinase (PEPCK) enzyme activity detection kit is purchased from Beijing Solaibao science and technology Limited; NADP/NADPH quantification kit (BioVision, USA) purchased from Biotech Inc., Boolpak, Beijing; a reverse transcription Kit (Thermo Scientific reverse Aid First Strand cDNA Synthesis Kit) was purchased from Thermo Scientific.

The equipment referred to in the following examples is a magnetic stirrer of the type C-MAG MS7, a disperser of the type T10BS025, a vortex oscillator of the type MS3basic (IKA, Germany); BioFlo/CelliGen model 115 fermentor, Centrifuge model 5424R high speed refrigerated Centrifuge (Eppendorf, USA); IM50 ice maker (snowfield, china); SX-500/SX-700 autoclave (TOMY, Japan); a Forma 994 vertical ultra-low temperature refrigerator, an SPD131DDA type centrifugal concentrator, a Legend micro 21R microcentrifuge (Thermo, USA); XS105 DualRange analytical balance; laboconco freeze-dryer (laboconco, usa); shaking incubator ZQXY-HC (Shanghai ZhiChu, China); oven (bond, germany); AI1310 type sample injector, Trace 1310 gas chromatograph, TSQ8000_ evo type mass spectrometer (Thermo, usa); model Milli Direct-Q8 ultrapure water meter (Milli-Q, Germany).

The vector construction and the preparation of competent cells of bacteria referred to in the following examples are described in molecular cloning handbook.

The primers mentioned in the following examples were synthesized by Shanghai Sangni and the sequencing work was carried out by Shanghai Huada Gene. RNA interference fragments were synthesized by Hakken Biotechnology (Shanghai) Ltd.

The media involved in the following examples are as follows:

broth medium: 20g/L (for activation)/50 g/L (for fat production) glucose, 5g/L yeast extract, 1g/L monopotassium phosphate, 0.25g/L magnesium sulfate heptahydrate and 10g/L potassium nitrate.

Kendrick medium: 20g/L (for activation)/30 g/L (for fat production) glucose, 3.3g/L (for activation)/2.0 g/L (for fat production) ammonium tartrate, 1.5g/L yeast extract, 7g/L potassium dihydrogen phosphate, 2.0g/L disodium hydrogen phosphate, 1.5g/L magnesium sulfate heptahydrate, 0.1g/L calcium chloride dihydrate and trace elements; wherein, the concentration of the trace elements is as follows: 0.001g/L of iron chloride heptahydrate, 0.0001g/L of zinc sulfate heptahydrate, 0.0001g/L of copper sulfate pentahydrate, 0.0001g/L of cobalt nitrate and 0.0001g/L of manganese sulfate pentahydrate. In the shaking experiment, the fermentation liquor is 100mL/250mL conical flask, and shaking culture is carried out at 28 ℃ and 200 rpm; the culture system in the fermentation tank was 4.0L of fermentation broth in a 7.5L stirred tank fermentor, adjusted to pH6.0 with 1M hydrochloric acid solution/sulfuric acid solution at 28 ℃ and with a paddle rotation speed of 300rpm and aeration of 2.0 vvm.

GY medium: 20g/L glucose, 10g/L yeast extract, 2g/L potassium nitrate, 1g/L sodium dihydrogen phosphate and 3g/L magnesium sulfate heptahydrate.

MM basal medium: 1.74g/L dipotassium hydrogen phosphate, 1.37g/L potassium dihydrogen phosphate, 0.146g/L sodium chloride, 0.49g/L magnesium sulfate heptahydrate, 0.078g/L calcium chloride, 0.53g/L ammonium sulfate, 1.8g/L glucose, 10mL/L iron sulfate heptahydrate (100X), 5mL/L glycerol, and sterilizing, then adding filtered MES buffer solution to the final concentration of 7.8 g/L.

IM induction medium: slightly adjusting on the basis of an MM culture medium, additionally adding 0.1g/L uracil, changing glucose into 0.9g/L, keeping the rest unchanged, adding 100 mu g/mL Acetosyringone (AS) and 7.8g/L MES before use, adding 20g/L agar strips when the medium is used AS a solid culture medium, and storing the IM culture medium added with AS in a dark place.

SC-CS Medium: 20g/L glucose, 5g/L non-amino yeast nitrogen source, 1.7g/L ammonium sulfate, 10mL/L amino acid mother liquor (100X), 20g/L agar, adding 100 μ g/mL cefotaxime and 100 μ g/mL spectinomycin before pouring the plate; wherein, the amino acid mother liquor: 60mg/L isoleucine, 60mg/L leucine, 60mg/L phenylalanine, 50mg/L threonine, 40mg/L lysine, 30mg/L tyrosine, 20mg/L adenine, 20mg/L arginine, 20mg/L histidine, 10mg/L methionine.

SOC recovery culture medium: 20g/L tryptone, 5g/L yeast extract, 0.5g/L sodium chloride, 0.186g/L potassium chloride, 0.95g/L magnesium chloride and 3.6g/L glucose.

LB liquid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, before use 100 u g/mL kanamycin was added.

LB solid medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, 20g/L agar, before use, 100 u g/mL kanamycin was added.

YEP liquid medium: 10g/L yeast extract, 10g/L trypsin, 5g/L sodium chloride, before use, 100. mu.g/mL kanamycin and 100. mu.g/mL rifampicin were added, and the mixture was stored away from light.

YEP solid medium: 10g/L yeast extract, 10g/L trypsin, 5g/L sodium chloride, 20g/L agar, before using, adding 100 u g/mL kanamycin and 100 u g/mL rifampicin, light-shielding storage.

"Nitrogen limitation" as described in the following examples means that only a small amount of nitrogen source (20mM NH) is supplied during the fermentation culture₄ ⁺) When the biomass supply is increased and the thalli grows to a plateau (about 36h), the nitrogen source in the culture medium is exhausted, and the thalli can only convert the excessive carbon source into energy storage substances (such as storage saccharides, lipids and the like) to be stored in cells.

Example 1: function verification of phosphoenolpyruvate carboxykinase in mortierella alpina

Nitrogen limitation is one of triggering conditions for accumulation of mortierella alpina lipid, so that a gene with an expression amount changed before and after nitrogen source exhaustion possibly plays a key regulation role in the synthesis process of mortierella alpina fatty acid. The results of the Mapepck transcription levels before and after the depletion of the nitrogen source are respectively obtained by analyzing the data of the transcriptome under the nitrogen limitation of the Mortierella alpina ATCC 32222 measured earlier by the inventor and are shown in FIG. 1-a (A: 8 h; B: 18 h; E: 19.5h (the nitrogen source in the culture solution is about to be depleted at this time, and the data of the subsequent transcriptome is compared by taking the point E as a control point), K: 21h (the nitrogen source in the culture medium is completely depleted at this time), L: 32h and M: 58 h). The transcript level of the Mapepck gene was significantly up-regulated after nitrogen limitation, and the relative transcript level continued to increase 48h after nitrogen limitation. According to the analysis of the proteome data of the mortierella alpina fermentation process, the expression level of the mappck protein (the amino acid sequence is shown as SEQ ID NO: 1) in the fermentation process is obtained, and the result is shown as a figure 1-b. The detection of the Mapepck protein in the fermentation process of the mortierella alpina and the increase of the expression quantity (the log2 fold change is more than 0) can prove that the selected Mapepck gene exists in the mortierella alpina genome and realizes the transcription and translation, so that the feasibility of gene manipulation exists.

Example 2: RNA interference of Mapepck in mortierella alpina

(1) Construction of Mortierella alpina expression vector

Constructing an RNA interference binary plasmid: firstly, a 90bp base fragment (shown as SEQ ID NO: 2) is selected from a function conservative region of a mortierella alpina phosphoenolpyruvate carboxykinase gene (Mapepck) sequence, the fragment, intron fragments (ITS) and a reverse complementary sequence of the fragment are connected in series with a reverse palindromic sequence of the fragment, and the intron fragments (ITS) are inserted in the middle. The designed total sequence was sent to Hakken biosciences (Wuxi, China) to be synthesized and integrated into binary plasmid pBIG2-ura5s-ITS to replace the original ITS, and named pBIG2-ura5s-MA-RIpepck (FIG. 2).

Mapepck interference fragment SEQ ID NO:2(5 '-3'):

GGATGACGGCAGGCTCTACGCCATCAACCCTGAAGCTGGCTTCTTTGGGGTGGCACCTGGTACATCGGCCAAGACTAATCCCAACGCCAT。

(2) construction of Mortierella alpina recombinant strain

Construction of recombinant strains: firstly, an interference vector and escherichia coli are fused through electrotransformation, the constructed recombinant plasmid is transferred into the escherichia coli, the escherichia coli is cultured to proliferate and replicate the recombinant plasmid, and the recombinant plasmid in the escherichia coli is extracted; transferring the recombinant plasmid into an agrobacterium tumefaciens AGL1 competent cell by an electric shock method; the method comprises the steps of transforming mortierella alpina through agrobacterium tumefaciens mediation, co-culturing agrobacterium tumefaciens carrying recombinant plasmids and mortierella alpina CCFM 501 on an IM solid culture medium for 48h, selecting a single colony, transferring the single colony to an SC-CS screening culture medium for passage for 3 times, and taking the colony which can stably grow as a suspected transformant.

Transferring the obtained recombinant plasmid pBIG2-ura5s-MA-RIpepck into Agrobacterium tumefaciens AGL-1 by an electric shock transformation method to obtain Agrobacterium tumefaciens carrying the recombinant plasmid pBIG2-ura5s-MA-RIpepck respectively; make itScraping spores of the mortierella alpina uracil auxotrophic strain by using normal saline, and placing the spores in an incubator at 28 ℃ for 6-24 hours to obtain germinated spore liquid; activating Agrobacterium tumefaciens respectively carrying recombinant plasmids pBIG2-ura5s-MA-RIpepck in YEP culture medium, culturing in MM culture medium and inducing in IM culture medium, and measuring OD of Agrobacterium tumefaciens cultured by inducing in IM culture medium₆₆₀Gradient dilution to OD with IM medium₆₆₀Obtaining agrobacterium tumefaciens bacterial liquids carrying recombinant plasmids pBIG2-ura5s-MA-RIpepck respectively, wherein the bacterial liquids are 0.2-1.2; respectively taking 100-200 mu L of agrobacterium tumefaciens bacterial liquid carrying recombinant plasmid pBIG2-ura5s-MA-RIpepck and spore liquid, turning the bacterial liquid and the spore liquid upside down and uniformly mixing the bacterial liquid and the spore liquid in a sterile EP tube, coating the mixture in an IM solid culture medium attached with glass paper, and carrying out light-proof co-culture for 12-48 h at the temperature of 16-28 ℃; after the co-culture is finished, transferring the cellophane with the co-culture system to an SC-CS culture medium containing spectinomycin (Spe) and cefotaxime (Cef), and culturing at 16-28 ℃ until colonies grow out; after bacterial colonies grow out, selecting newly grown hyphae at the edges of the bacterial colonies, and continuously culturing on a new SC-CS culture medium at the temperature of 28 ℃ for 12-48 h for subculture; after subculture, selecting a colony which can stably grow, and selecting the colony to a Broth liquid activation medium to culture for 2d at 28 ℃ to obtain a bacterial liquid; extracting fungus genome DNA from the bacterial liquid for PCR verification, and considering that the transformant of the target band obtained by amplification is a correct positive transformant (the PCR result is shown in figure 3); PCR verification obtains 10 positive transformants of the Mapepck interference strain, and the positive transformants are sequenced. The result shows that in the interference vector, because a hairpin structure is formed, the fragment cannot be amplified, so that a band of a screening marker ura5s can be seen only in the vicinity of 800bp, which indicates that the hairpin structure can be correctly formed in the mortierella alpina body, and confirms that the verification of the selected 7 positive transformants is correct at the genome level, and the recombinant mortierella alpina m.

Wherein, PCR was performed using Taq enzyme system, and the primers used were universal primers for plasmid vector pBIG2-ura5s-ITS (Table 1).

TABLE 1 Universal primer sequences

As can be seen from FIG. 3, by using the universal primers for PCR verification, uracil complementation marker ura5s of T-DNA region of Agrobacterium tumefaciens carrying recombinant plasmid pBIG2-ura5s-MA-RIpepck can be successfully amplified, and in the interfering strain, the fragment cannot be amplified due to the formation of hairpin structure, which indicates that the hairpin structure can be correctly formed in Mortierella alpina, RNA interference can be theoretically performed on the target gene, and the transformant which is verified to be correct by PCR is selected and stored in solid GY slant culture medium for subsequent experimental operation.

Example 3: screening of recombinant mortierella alpina M

M.alpina-RIpepck is subjected to activation culture in a Broth culture medium, then inoculated in a Kendrick culture medium and fermented for 168 hours to collect fermentation liquor and thallus, the growth of the thallus of mortierella alpina and the accumulation of intracellular carbohydrate and fatty acid are primarily analyzed by taking a prototrophic strain as a control, and the results are shown in figure 3, and all the mappck RNAi strains have significant reduction of carbohydrate content (p <0.05) and significant increase of fatty acid content (p <0.05) compared with the control group. Therefore, the competitive relationship between the accumulation of saccharides and the accumulation of fatty acids in mortierella alpina can be judged, the mappck gene has a positive regulation and control effect on the synthesis of saccharides, the final biomass is not negatively influenced by the interference of the mappck gene, and 2 transformants which have good growth stability and have obvious influence on both the accumulation of lipids and the accumulation of saccharides (p is less than 0.05) are selected for preservation and subsequent experimental analysis.

Example 4: interference on influence of Mapepck gene on transcription level and enzyme activity of strain

The 2 primarily screened Mapepck RNAi strains are named as M.alpina MA-RIpepck-1 and M.alpina MA-RIpepck-2, the strains are cultured under the condition of nitrogen limitation, samples are taken for 96 hours, the transcription level and the enzyme activity are analyzed, and prototrophic mortierella alpina is used as a control strain. RNA interference can only partially down-regulate gene expression but cannot completely eliminate gene function, so the degree of inhibition of gene function by RNA interference can be judged from transcription level, protein level, enzyme activity and product level. The mappck protein catalyzes oxaloacetate to be converted into PEP, which is the rate-limiting step of gluconeogenesis, and the PEP is complex in source and difficult to determine, so that the enzyme activity of the mappck protein needs to be determined, and the regulation and control of the mappck gene and the inhibition level of gluconeogenesis by RNA interference are analyzed in combination with the transcription level.

(1) Mapepck Gene transcript level analysis

Extracting total RNA in mortierella alpina by using Trizol, measuring the concentration and purity of the RNA, verifying the integrity of the RNA, taking 1 mu g of the total RNA as a template, carrying out reverse transcription to obtain cDNA, and carrying out concentration measurement by using Nano Drop. cDNA is taken as a template, a reaction system is prepared according to SYBR Green Super Mix instructions for RT-qPCR reaction, and the expression level of the target gene is determined.

When the transcription level is measured, prototrophic mortierella alpina is used as a control group, and the internal reference gene is 18S rDNA of the mortierella alpina. The relative transcription level of the target gene is analyzed by using a 2-delta Ct method. 3 biological replicates were set for each strain during culture, 3 technical replicates were performed for each sample when transcription levels were determined, and the primers used for qPCR are shown in Table 2.

TABLE 2 qPCR primers

(2) PEPCK protease activity assay

The enzyme activity of Mapepck is determined according to the specification of the phosphoenolpyruvate carboxykinase (PEPCK protein) activity detection kit. Collecting fermented Mortierella alpina, repeatedly washing with normal saline, vacuum filtering to obtain mycelia, quick freezing with liquid nitrogen, and grinding into powder. Adding enzyme extract and steel ball, performing cell disruption, centrifuging at 10000g for 10min, collecting supernatant, and repeating for 2 times to obtain crude enzyme solution. The protein concentration in the crude enzyme sample was determined by the Bradford method, the enzyme reaction system was formulated according to the instructions, and the NADH consumption rate at OD340 nm was determined to reflect the activity of the Mapepck enzyme (U/mg protein).

As shown in FIG. 5, the transcription level of the mappck gene of the mappck RNAi strain is reduced by nearly 41.1% compared with that of a control group, and the enzyme activity level of the mappck protease is reduced by 45.4% on average, so that the overall expression of the mappck gene in the Mortierella alpina interference strain is remarkably reduced (p is less than 0.05) compared with that of the control strain, certain correlation exists between the enzyme activity level and the transcription level, and the difference between different transformants is not remarkable, which indicates that the constructed mappck RNAi is stable.

Example 5: interference with the influence of Mapepck on the growth of the strain and the accumulation of intracellular carbohydrates and lipids

Growth analysis: taking the original culture strain of the mortierella alpina as a negative control, inoculating the recombinant mortierella alpina M.alpina-RIpepck screened in the example 4 and the single spore of the original culture strain of the mortierella alpina into a Broth seed culture medium, and culturing for 2d at the temperature of 28 ℃ for activation; continuously activating for three generations, and collecting activated thalli; crushing the thalli into uniform flocculent bacteria; inoculating the crushed thallus into a Kendrick fermentation culture medium in an inoculation amount of 1% (v/v), carrying out shake culture at 28 ℃ and 200rpm, collecting fermentation liquor and hypha samples every 24h, and measuring the physiological and biochemical index changes inside and outside cells in the growth process environment of the Mortierella alpina, wherein the physiological and biochemical index changes comprise residual sugar and residual nitrogen content of the fermentation liquor, biomass of the thallus, total sugar content, non-structural sugar content and total fatty acid content. The thalli are collected at 168h, filtered and washed, and then freeze-dried to constant weight in vacuum, the weight of the thalli is weighed, the biomass is calculated, and the calculation result is shown in figure 6.

And (3) fat production analysis: grinding the thalli into powder, weighing 30mg, accurately adding 100 mu L of 2mg/mL C15:0 serving as an internal standard, adding 2mL of 4mol/L hydrochloric acid, and fully and uniformly mixing; water bath at 80 deg.C for 1h, standing at-80 deg.C for 15 min; repeating for 3 times, cooling to room temperature, adding 1mL of methanol and 1mL of chloroform, mixing, and shaking for 2 min; centrifuging at 3000g for 10 min; collecting the chloroform layer in a new lipid extracting bottle; this step was repeated twice; combining the chloroform layers, blowing nitrogen to dry, adding 1mL of 10% hydrochloric acid-methanol, and carrying out methyl esterification treatment in water bath at 60 ℃ for 3 h; then adding 1mL of saturated sodium chloride and 1mL of normal hexane into the methyl esterification treatment system, uniformly mixing, centrifuging for 10min at 3000g, and repeating the step twice; collecting the n-hexane layer in a new bottle, continuously adding 1mL of n-hexane into the residual liquid, shaking and uniformly mixing for 1min, and centrifuging at 3000g for 10 min; combining the n-hexane layers, blowing nitrogen for drying, and adding 1mL of n-hexane for redissolving to obtain fatty acid methyl ester; detecting the composition and content of fatty acid in thallus by GC-MS, wherein the detection result is shown in figure 4; wherein, the analysis of fatty acid methyl ester adopts GC2010(Shimadzu Co., Japan) and the chromatographic column is DB-Waxetr (30m multiplied by 0.32m, 0.22 μm); detecting by a hydrogen flame ion detector, wherein the temperatures of a vaporization chamber and the detector are 240 ℃ and 260 ℃, the sample injection is carried out in a split-flow mode by 1uL, the split-flow ratio is 10:1, and the carrier gas is nitrogen; temperature programming: maintaining the initial temperature at 120 deg.C for 3min, increasing to 190 deg.C at 5 deg.C/min, increasing to 220 deg.C at 4 deg.C/min, and maintaining for 20 min; the fatty acid components in the samples were qualitatively and quantitatively analyzed by mass comparison with a commercial fatty acid methyl ester standard (37 fatty acid methyl ester mixed standard, Supelco, USA) and the addition of an internal standard C15:0, the total fatty acid content being expressed as the mass of total fatty acids per cell.

And (4) properly diluting the fermentation supernatant, and measuring the content of residual glucose in the fermentation liquor by using a glucose measurement kit. 50mg of fungal powder was weighed and subjected to a publicly known phenol-sulfuric acid method [ Biotechnol Lett,2021,43: 1289-]Quantifying total sugar in the extract, preparing standard curve with glucose, the concentration range is 0.01-0.10 g/L, diluting the sample by 20 times during measurement, and measuring OD by spectrophotometry₄₉₀And (5) carrying out color comparison at nm, and calculating the total sugar content according to the light absorption value.

As shown in FIG. 6, during the lipid accumulation process, interference with the Mapepck gene of Mortierella alpina resulted in an increase in intracellular lipid content from 26.1% to 32.9% (lipid content on a dry basis) and 26% (FIG. 6-a), a decrease in total carbohydrate content from 24.1% to 17.5% (total carbohydrate content on a dry basis), a down-regulation of 27.5% (FIG. 6-b), and an increase in late-stage ARA yield of nearly 42% (FIG. 6-c), indicating that interference with the Mapepck gene reduced gluconeogenesis and resulted in a decrease in total carbohydrate level, thereby promoting lipid accumulation.

Example 6: fermentation tank amplification culture of Mortierella alpina Mapepck RNA interference strain

The Mapepck RNA interference strain is subjected to amplification culture in a 7.5L fermentation tank, prototrophic strains are used as controls, fermentation liquor and thallus samples of 0-216 h are collected to measure physiological and biochemical parameters in the fermentation process, and the contents of intracellular total sugar and total fatty acid are shown in figure 7.

Fermentation in a fermentation tank:

after the Mortierella alpina transformants selected in example 4 were liquid-grown and activated, the last generation of strains were activated in a kendrick seed medium (36 hours), 400mL of the seed solution was inoculated into a fermentor (7.5L stirred fermentor containing 3.6L of medium), and a total of 4.0L of culture system was obtained. At 28 ℃ 300rpm, an aeration rate of 2.0vvm, using a 1M NaOH solution and 1M H₂SO₄The pH was adjusted and maintained at 6.0 by means of a peristaltic pump. Samples were taken 1 time every 24h (100 mL each) through the sampling valve for a total of 216h of incubation.

Firstly, comparing the fermentation result of the fermentation tank with the result of the shake flask fermentation in example 5, it was found that since the pH of the fermentation process can be precisely controlled by the fermentation tank, and Mortierella alpina is more favorable for growth and lipid production at a suitable pH, the fatty acid content of both the prototrophic strain and the interferent strain exceeds that of the shake flask during fermentation in the later stage of fermentation, and the saccharide content is correspondingly reduced, and the biomass is integrally increased. The absolute amount of intracellular material in the fermentor culture was counted and there was no significant difference in biomass between the interfering strain and the control strain, indicating that the mappck RNAi strain can grow normally in the fermentor environment. The nitrogen sources of the fermentation liquids of different strains are completely exhausted within 36 hours, so that on one hand, the conditions of the fermentation tank are favorable for the rapid growth of the strains, the nitrogen limitation is advanced due to the increase of the consumption speed of the nitrogen source, and on the other hand, the interference of the Mapepck gene is proved not to influence the utilization of the nitrogen source of the strains. Since the activity of the mappck protein increased in advance of nitrogen limitation in the fermentor and the diversion of the control carbon flux started early, as shown in fig. 7-a, the glucose consumption rate was almost identical between the different strains at the early stage of fermentation, but the difference between intracellular carbohydrate and fatty acid levels had begun to appear at 48h, leading to a decrease in intracellular total sugar levels, while the fatty acid levels were opposite after interfering with the mappck gene. As shown in fig. 7-c, the total sugar production of Mapepck RNAi strain after nitrogen limitation did not change substantially after 72h and was significantly less in total than the control strain, which did not stop accumulating completely at 96 h; in contrast, the fat production of the interfering strain was consistently higher than that of the prototrophic strain, and the total fatty acid production (3.29g/L) at day 5 was already greater than the maximum fatty acid production (3.22g/L) of the prototrophic strain at day 8, as shown in FIG. 7-d. The specific change of the fatty acid yield in the fermentation process is shown in Table 2, the ARA yield in the strain can reach 1.23g/L at most after the Mapepck gene is interfered, and the ARA yield is improved by 39.9 percent compared with the ARA yield (0.88g/L) obtained by the fermentation of the synchronously prototrophic mortierella alpina. The results show that the interference of the mappck gene not only improves the yield of fatty acid, but also enables the strain to reach the maximum accumulation time of lipid in advance, and has the advantage of lipid production compared with the original strain.

TABLE 3 influence of fermentation tank amplification culture on the accumulation of fatty acids in Mortierella alpina

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> phosphoenolpyruvate carboxykinase and application thereof

<130> BAA211154A

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 725

<212> PRT

<213> Mortierella alpina

<400> 1

Met Leu Leu Leu Arg Pro Ser Val Ser Ala Arg Leu Val His Ala Thr

1 5 10 15

Ala Leu Pro Pro Ser Ser Leu Trp Val Pro Gly Leu Val Thr Ser Ala

20 25 30

Lys Gly His Pro Leu His His Pro Ala Arg Leu Leu His Ser Ala Ser

35 40 45

Leu Leu Ala Arg Arg Gly His Ala Pro Ala Leu Arg Ser Leu Ser Pro

50 55 60

Leu Phe Ala Ser Gln Val Arg Leu Leu Gly Ala Ile Ser Lys Pro Val

65 70 75 80

Ala Arg Gln Thr Leu Phe Ala Ser His Ser Ser Pro Leu Ser Ala Ser

85 90 95

Ala Thr Phe Gln Gln His Ser Gln Ala Glu Glu Pro Ser Val Leu Asp

100 105 110

Asn Ala Pro Thr Ala His Ala Lys Leu Val Asp Trp Val Arg Ala Gln

115 120 125

Gln Ser Leu Leu Glu Pro Asp Asn Val His Trp Cys Asp Gly Ser Gln

130 135 140

Glu Glu His Asp Ser Leu Val Ala Ala Met Val Glu Arg Gly Val Met

145 150 155 160

Leu Pro Leu Asn Glu Thr Leu Arg Pro Gly Ser Tyr Leu Thr Arg Thr

165 170 175

Asp Pro Ala Asp Val Ala Arg Ser Glu Ser Ser Thr Phe Ile Cys Ser

180 185 190

Arg Leu Lys Glu Asp Ala Gly Pro Thr Asn Asn Trp Ile Asp Pro Asn

195 200 205

Glu Met Arg Thr Asp Leu Glu Lys Cys Phe Gln Gly Ala Met Arg Gly

210 215 220

Arg Thr Met Tyr Val Ile Pro Phe Ser Met Gly Pro Val Gly Ser Pro

225 230 235 240

His Ser Arg Ile Gly Met Gln Val Thr Asp Ser Pro Phe Val Val Val

245 250 255

Asn Met Arg Ile Met Thr Arg Ile Gly Gln Pro Val Leu Asp Val Leu

260 265 270

Gly Arg Asp Lys Glu Phe Val Pro Cys Val His Ser Val Gly Lys Pro

275 280 285

Leu Glu Pro Gly Asp Lys Asp Val Leu Trp Pro Cys Asn Ile Ala Gln

290 295 300

Arg Lys Val Val His Phe Pro Glu Ser Arg Glu Ile Trp Ser Phe Gly

305 310 315 320

Ser Gly Tyr Gly Gly Asn Ser Leu Leu Gly Lys Lys Cys Leu Ala Leu

325 330 335

Arg Ile Ala Ser Val Met Ala Arg Asp Glu Gly Ser Leu Ala Glu His

340 345 350

Met Leu Ile Leu Gly Leu Thr Ser Pro Ala Gly Lys Lys Tyr Tyr Val

355 360 365

Ala Ala Ala Phe Pro Ser Ala Cys Gly Lys Thr Asn Leu Ala Met Met

370 375 380

Gln Pro Thr Leu Pro Gly Trp Lys Val Gln Val Val Gly Asp Asp Ile

385 390 395 400

Asn Trp Met Lys Phe Ser Lys Asp Asp Gly Arg Leu Tyr Ala Ile Asn

405 410 415

Pro Glu Ala Gly Phe Phe Gly Val Ala Pro Gly Thr Ser Ala Lys Thr

420 425 430

Asn Pro Asn Ala Met Glu Thr Ile Arg Lys Asn Thr Val Phe Thr Asn

435 440 445

Val Ala Leu Thr Asp Lys Gly Asp Val Trp Trp Glu Gly Met Thr Lys

450 455 460

Ala Arg Pro Glu Gly Lys Val Val Asn Trp Lys Gly Glu Val Trp Glu

465 470 475 480

Pro Ser Met Gly Asp Lys Gly Thr Pro Leu Ala His Pro Asn Ser Arg

485 490 495

Phe Thr Val Ser Val Asp Gln Cys Pro Ala Lys Asp Pro Ala Trp Asp

500 505 510

Asp Pro Asn Gly Val Pro Ile Ser Ala Ile Ile Phe Gly Gly Arg Arg

515 520 525

Glu Thr Thr Val Pro Leu Val Phe Gln Thr Lys Asp Trp Asn His Gly

530 535 540

Val Leu Val Gly Ala Thr Val Ala Ser Glu Lys Thr Ala Ala Ala Glu

545 550 555 560

Gly Ser Asp Val Gly Gln Leu Arg Phe Asp Pro Phe Ala Met Leu Pro

565 570 575

Phe Val Gly Tyr Asn Met Gly Asp Tyr Phe Asn His Trp Leu Ser Met

580 585 590

Pro Asp Arg Val Lys Asp Thr Ser Arg Leu Pro Lys Ile Phe His Val

595 600 605

Asn Trp Phe Arg Lys Asp Ala Lys Gly Ser Phe Met Trp Pro Gly Phe

610 615 620

Gly Glu Asn Ser Arg Val Leu Lys Trp Val Val Asp Arg Leu Glu His

625 630 635 640

Pro Glu Asp Thr Ser Leu Tyr Lys Ser Thr Pro Ile Gly Tyr Val Pro

645 650 655

Lys Pro Glu Ser Leu Asp Leu Ser Gly Ile Glu Gln Asp Leu Gln Gly

660 665 670

Gly Val Met Glu Lys Leu Leu Ala Val Asp Ser Lys Ala Tyr Leu Ser

675 680 685

Glu Val Ser Lys Ala Arg Asp Tyr Phe Lys Met Phe Gly Asp Arg Phe

690 695 700

Pro Ala Lys Leu Thr Lys Glu Leu Asp Gly Leu Glu Asp Arg Leu Lys

705 710 715 720

Lys Asn Gln Gly Val

725

<210> 2

<211> 90

<212> DNA

<213> Artificial sequence

<400> 2

ggatgacggc aggctctacg ccatcaaccc tgaagctggc ttctttgggg tggcacctgg 60

tacatcggcc aagactaatc ccaacgccat 90

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

cacacacaaa cctctctccc act 23

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence

<400> 4

caaatgaacg tatcttatcg agatcc 26

<210> 5

<211> 17

<212> DNA

<213> Artificial sequence

<400> 5

atatcaactg gatgaag 17

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

attggtaaag actgtgtt 18

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<400> 7

cgtactaccg attgaatggc ttag 24

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<400> 8

cctacggaaa ccttgttacg act 23