Application of RNA helicase DHX33 inhibitor in preparation of drugs for treating leukemia
阅读说明：本技术 Rna解旋酶dhx33抑制剂在制备用于治疗白血病的药物中的应用 (Application of RNA helicase DHX33 inhibitor in preparation of drugs for treating leukemia ) 是由 张严冬 聂光丽 李相鲁 于 2021-08-16 设计创作，主要内容包括：本发明公开了RNA解旋酶DHX33抑制剂在制备用于治疗或者辅助治疗白血病的药物中的应用。本发明确立了DHX33蛋白在白血病发展中的重要作用,提供的小分子化合物具有抑制DHX33解旋酶活力的作用,进而促进由DHX33调控的BCL-2家族蛋白介导的白血病癌细胞凋亡,该小分子化合物可以快速诱导白血病细胞的凋亡,但对正常血细胞无杀伤性,因此具有重要的医药开发价值。(The invention discloses application of an RNA helicase DHX33 inhibitor in preparation of a medicament for treating or adjunctively treating leukemia. The invention establishes the important function of DHX33 protein in leukemia development, the provided small molecular compound has the function of inhibiting DHX33 helicase activity, and further promotes the apoptosis of leukemia cancer cells mediated by BCL-2 family protein regulated and controlled by DHX33, and the small molecular compound can rapidly induce the apoptosis of leukemia cells, but has no killing property on normal blood cells, thereby having important medicine development value.)
Use of RNA helicase DHX33 as a novel target for the treatment of leukemia.
2. DHX33 inhibitor for use in therapy or co-therapy of leukemia, wherein the inhibitor is selected from compound A, B, C, D or at least one of its pharmaceutically acceptable salts or prodrugs,
use of an inhibitor of RNA helicase DHX33 for the manufacture of a medicament or pharmaceutical composition for the treatment or co-treatment of leukemia, wherein the inhibitor is according to claim 2.
4. Use according to claim 3, characterized in that the leukemia is a lymphocytic leukemia or a myeloid leukemia.
5. Use according to claim 4, characterized in that the lymphocytic leukemia is a T lymphocytic leukemia or a B lymphocytic leukemia, such as acute T lymphocytic leukemia, acute B lymphocytic leukemia, chronic lymphocytic leukemia.
6. Use according to claim 4, characterized in that said myeloid leukaemia is acute myeloid leukaemia or chronic myeloid leukaemia.
Use of an inhibitor of RNA helicase DHX33 as inducer of apoptosis in cancer cells in the treatment of leukemia, wherein said cancer cell apoptosis is DHX33 helicase dependent and said inhibitor of RNA helicase DHX33 is as defined in claim 2.
8. A method for synthesizing compound a according to claim 2, comprising the steps of:
1) compound 3(2- (2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) was synthesized by the following route:
2) compound 4(2- (3-formyl-2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) was synthesized by the following route:
and
3) the compound a (AB21697) was synthesized by the following route:
Technical Field
The invention belongs to the field of biological medicines, and particularly relates to application of an RNA helicase DHX33 inhibitor in preparation of a medicine for treating leukemia.
Background
Leukemia is a kind of malignant blood tumor with abnormal proliferation of hematopoietic stem cells, and in China, the incidence of leukemia is ranked sixth to the incidence of various tumor diseases, usually caused by the change of important genes regulating the biological processes of cell growth, apoptosis and the like. According to the characteristics of leukemia pathogenesis, cancer cell sources and the like, specific treatment can be carried out on different types of leukemia. Among leukemias, those with more desirable therapeutic effects include Hairy Cell Leukemia (HCL), Acute Promyelocytic Leukemia (APL), core binding factor leukemia (CBF), and Chronic Myelogenous Leukemia (CML). In recent years, due to the development of chimeric antigen receptor T cell technology (CAR-T) and antibody therapy technology, the treatment of Acute Lymphoblastic Leukemia (ALL) and Chronic Lymphoblastic Leukemia (CLL) has also made a breakthrough, especially in B-cell leukemia positive for surface antigens such as CD19, CD20, CD22, etc. However, there is a lack of effective drug therapy for acute T cell leukemia, Acute Myeloid Leukemia (AML) and related myelodysplastic syndrome (MDS), which are negative for the above antigens. These types of leukemia are not well controlled at present, and have the problems of few types of treatment medicines, poor targeting, incapability of completely achieving the expected treatment effect and the like.
Hairy Cell Leukemia (HCL) is broadly a particular type of chronic lymphocytic leukemia. The current therapeutic drugs include Pentostatin (pentastatin), Cladribine (Cladribine), Rituximab (Rituximab), and the like. Pentostatin is an Adenosine Deaminase (ADA) inhibitor that inhibits the mRNA synthesis of ADA in leukemia cells. The effective rate of the cladribine is 80 to 100 percent, and the 10-year survival rate is 70 percent. Rituximab is a chimeric murine/human monoclonal antibody that specifically binds to the transmembrane protein CD20 antigen.
Acute Promyelocytic Leukemia (APL) is a special type of Acute Myeloid Leukemia (AML). APL accounts for 5% -10% of AML. Anthracycline and ATRA combination therapy is the first line treatment of APL. Arsenic Trioxide (ATO) is also approved for APL rescue therapy as part of ATRA plus chemotherapy regimen into first line consolidation therapy.
Chronic Myelogenous Leukemia (CML) is a unique leukemia. Since each CML patient had the same abnormal BCRABL1 protein encoded by BCRABL1, it was a tyrosine kinaseThe activity leads to CML, inhibition of kinase activity reverses most of the CML phenotype and delays conversion of CML to the acute phase. Imatinib (Imatinib) is an inhibitor of tyrosine kinases, IC for PDGF receptors, c-Kit and Abl50The values were 0.1, 0.1 and 0.025. mu.M, respectively. Imatinib treatment reduced the annual mortality rate from 10% to 20% to ≤ 2% in chronic myeloid leukemia. The 10-year survival rate is estimated to be above 80%.
The standard treatment for Chronic Lymphocytic Leukemia (CLL) is mainly an alkylating drug (chloroprene, cyclophosphamide) in combination with steroids and vincristine, but does not improve survival. On the basis of understanding physiological pathways of cellular receptors, tyrosine kinases, phosphoinositide 3 kinase delta and the like, several small molecule inhibitors have been developed, including ibrutinib (a BTK inhibitor), idelalisib (a phosphoinositide delta inhibitor) and vetecalla (a BCL2 inhibitor). The ibrutinib gaveletta (with or without the CD20 monoclonal antibody) regimen resulted in 80% of the universal cr (complete review) and bone marrow mrd (minor residual disease) negative rates after 1 year or more of treatment.
In conclusion, the treatment of various acute leukemias is not obviously improved, and the problems of poor targeting of the treatment medicament, incapability of completely achieving the expected treatment effect and the like exist. Therefore, searching and developing more effective leukemia treatment drugs, reducing the toxic and side effects of the drugs and improving the cure rate are all the scientific problems to be solved urgently in the field of leukemia research. Finding and developing new targets and ideas are also particularly critical for treating acute lymphoblastic leukemia.
Disclosure of Invention
The invention aims to provide application of an RNA helicase DHX33 inhibitor in preparation of a medicine or a composition for treating or assisting in treating leukemia.
To achieve the object of the present invention, in a first aspect, the present invention provides an RNA helicase DHX33 inhibitor for use in the treatment or co-treatment of leukemia. In the present invention, the RNA helicase DHX33 inhibitor (i.e. DHX33 protein inhibitor) is selected from at least one of compound A, B, C, D or a pharmaceutically acceptable salt or prodrug thereof:
the invention discloses that the DHX33 protein can be used as a target spot for leukemia treatment for the first time, so in a second aspect, the invention provides application of the RNA helicase DHX33 inhibitor as a novel leukemia treatment target spot.
In a third aspect, the present invention provides the use of an inhibitor of RNA helicase DHX33 as an inducer of apoptosis in cells regulated by DHX33(DHX33 gene), i.e. DHX33 inhibitors can rapidly induce apoptosis in leukemia cells without killing normal cells.
The reference sequence number of the DHX33 gene at NCBI is: NM _ 020162.4.
The apoptosis pathway is an important pathway in normal metabolic activity of cells, and in abnormally proliferated cancer cells, the pathway is in an abnormal inhibition state, escapes apoptosis of the cells, is further infinitely amplified, and plays a key role in the occurrence and development of the cancer. The experimental result in the application shows that the DHX33 protein is one of the important regulatory factors for regulating the apoptosis of leukemia cells, influences the apoptosis of lymphocyte or myeloid leukemia, and the process depends on the activity of RNA helicase of DHX 33. The enzyme activity inhibitor of DHX33 can rapidly induce cancer cell apoptosis in lymphocyte or myeloid leukemia without obvious killing effect on normal cells. The invention shows that DHX33 is a target site for treating the lymphocytic leukemia for the first time. The small molecular compound provided by the invention can effectively inhibit the helicase activity of DHX33, and further remarkably inhibit the development of lymphocyte or myeloid leukemia by inducing cancer cell apoptosis.
In a fourth aspect, the invention provides a targeted drug for treating or assisting in treating leukemia, wherein the target of the drug is RNA helicase DHX33, and the targeted drug can inhibit the activity of DHX33 helicase, so as to influence the apoptosis process of cancer cells regulated by DHX33 protein. The active ingredient of the targeted drug is compound A, B, C, D or pharmaceutically acceptable salts or prodrugs thereof.
In a fifth aspect, the invention provides the use of the RNA helicase DHX33 inhibitor in the treatment or co-treatment of leukemia.
In a sixth aspect, the present invention provides the use of an inhibitor of RNA helicase DHX33 selected from compound A, B, C or a pharmaceutically acceptable salt or prodrug thereof in the manufacture of a medicament or pharmaceutical composition for the treatment or co-treatment of leukemia.
In an embodiment of the invention, the leukemia is a lymphocytic leukemia, such as a B lymphocytic leukemia, a T lymphocytic leukemia, an acute lymphocytic leukemia such as acute T lymphocytic leukemia, acute B lymphocytic leukemia, or a chronic lymphocytic leukemia, or a myeloid leukemia, such as acute myeloid leukemia, chronic myeloid leukemia.
In a seventh aspect, the present invention provides a method of synthesizing compound a, comprising the steps of:
1) compound 3(2- (2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) was synthesized by the following route:
2) compound 4(2- (3-formyl-2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) was synthesized by the following route:
and
3) the compound a (AB21697) was synthesized by the following route:
by the technical scheme, the invention at least has the following advantages and beneficial effects:
the invention establishes the important function of the DHX33 protein in the occurrence and development of leukemia, and the provided small molecular compound has the function of inhibiting the activity of DHX33 helicase so as to inhibit the apoptosis of cells regulated and controlled by DHX 33. The small molecular compound can obviously inhibit the growth of leukemia cells in vitro and in vivo, particularly the growth of lymphocyte leukemia or myeloid leukemia cells, thereby achieving the purpose of treating leukemia and having important medical development value.
Drawings
FIG. 1 is a cell morphology analysis of Jurkat T cells after inhibition of DHX33 protein (inhibitor A) relative to a control group in an example of the present invention.
FIG. 2 is an apoptosis assay of Jurkat T cells after inhibition of DHX33 protein (inhibitor A) relative to a control in an example of the invention.
FIG. 3 is a cellular morphology analysis of K562 cells relative to control after DHX33 protein inhibition (inhibitor A) in accordance with an embodiment of the present invention.
FIG. 4 is an apoptosis assay of K562 cells after inhibition of DHX33 protein (inhibitor A) relative to controls in accordance with an embodiment of the invention.
FIG. 5 is a graph showing the change in apoptotic morphology of RAJI cells and Daudi cells after inhibition of DHX33 protein (inhibitor A) relative to a control group in examples of the present invention.
FIG. 6 shows the cell morphology change of Jurkat T and K562 cells after DHX33 protein inhibition (inhibitor A) for 16 hours in the examples of the present invention.
FIG. 7 is a table showing the analysis of the change of apoptosis-related genes of Jurkat T cells and K562 cells after the DHX33 protein is inhibited (inhibitor A) by RNA sequencing in the example of the present invention, and the change of other genes regulated by DHX33 protein is also comparatively analyzed.
FIG. 8 shows the transcript changes of apoptosis-related genes analyzed by quantitative PCR of RNA extracted from Jurkat T cells after DHX33 protein inhibition (inhibitor C) in the present example. And represent P values less than 0.005 and 0.001, respectively, with statistically significant differences.
FIG. 9 shows DHX33 inhibition in an example of the inventionHalf-inhibitory concentration IC of agent B, C, D in T-lymphocyte leukemia cells50。
FIG. 10 is a cell scatter plot in flow assays of lymphocytic leukemia cells with increasing compound concentration after analysis of DHX33 inhibitor (inhibitor C) treatment in an example of the invention.
FIG. 11 is an apoptotic staining assay of leukemia cells with increasing compound concentration after treatment with DHX33 inhibitor C in an example of the invention.
FIG. 12 is an apoptosis index analysis of leukemia cells treated with DHX33 inhibitor C with increasing compound concentration in an example of the invention.
FIG. 13 is a cell scatter plot of flow assays of DHX33 inhibitor C treated leukemia cells with increasing compound treatment time in an example of the invention.
FIG. 14 is an apoptotic staining assay of DHX33 inhibitor C treated leukemia cells with increasing compound treatment time in an example of the invention.
FIG. 15 is an apoptosis index analysis of DHX33 inhibitor C treated leukemia cells with increasing compound treatment time in an example of the invention.
FIG. 16 is a graph showing the cell activity analysis of normal human peripheral blood mononuclear cells treated with DHX33 inhibitor A in accordance with the present invention.
FIG. 17 is the IC of DHX33 inhibitor in normal bone marrow mesenchymal cells in an example of the invention50。
FIG. 18 is a graph of the drug metabolism analysis in rats after intravenous injection and gavage of the compounds of the present invention (inhibitor B and inhibitor C).
FIG. 19 is a graph of plasma stability analysis of compounds of the present invention (inhibitor B and inhibitor C).
FIG. 20 is a plan view showing the experimental implementation of the drug effect of DHX33 inhibitor D on human cancer cell Jurkat T in the xenogeneic tumor-bearing model in the present example. The time of cancer cell inoculation and the time point of drug treatment are indicated.
FIG. 21 is a graph of the pharmacodynamic effect of DHX33 inhibitor D on Jurkat T cell growth in immunodeficient mice in an example of the invention, graphically depicting tumor growth in control and drug groups at the end point harvest.
FIG. 22 is a graph of end-point tumor gravimetric analysis of DHX33 inhibitor D on tumor growth in examples of the invention. Indicates significant differences.
FIG. 23 is a graph showing the body weight monitoring curves of the control and drug groups in the example of the present invention. There was no significant difference between the two groups.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.
1. Cell culture
Cell lines Jurkat-T, Raji, Daudi, K562, Nalm6, etc. were purchased from the cell bank of the Chinese academy. These cell lines were maintained in RPMI medium containing 10% Fetal Bovine Serum (FBS), 2mM L-glutamine, added non-essential amino acids and streptomycin, penicillin. CD8 cells were drawn from healthy volunteer applications. The separation is shown in a ROSEETTE CD 8T Cell separation kit (Stem Cell Technologies). Human peripheral blood mononuclear cells were isolated by diluting fresh blood (collected in an anticoagulation tube) from 5mL healthy volunteer donors 1:1 with sterile PBS and adding the diluted blood slowly to an equal volume of lymphocyte separation medium without mixing. The samples were then centrifuged at 2000rpm for 20 minutes with slow deceleration. After centrifugation, the leukocytes fell into the middle layer, and the middle layer containing leukocytes was carefully extracted with a pipette and washed twice with PBS. The extraction of mouse bone marrow mesenchymal cells was performed as follows: healthy 2-month-old mice were sacrificed by neck-breaking, leg bones were removed from the mice, placed in a sterile PBS solution, and then tissues such as muscles and tendons were removed, and both front and rear ends of the bones were cut off with sterile scissors, and bone marrow portions were leaked out. 1mL of the PBS solution was aspirated with a sterile 1mL syringe, and then the needle was gently inserted into the bone marrow, followed by blowing out the bone marrow. The bone marrow was pelleted by slow centrifugation (2000rpm,2 min) and then resuspended in erythrocyte lysate (150mM NH)4 Cl,10mM KHCO30.1mM EDTA (pH 7.4), placed on ice for 5 minutes. The supernatant was then removed by low speed centrifugation (2000rpm,2 minutes). The precipitated leukocytes were resuspended in RPMI medium containing 10% Fetal Bovine Serum (FBS), 2mM L-glutamine, optional amino acids, streptomycin, and penicillin, and bone marrow mesenchymal cells were allowed to grow adherently for the following 1-3 days, and other cells were removed by a medium exchange method.
RNA sequencing
RNA sequencing is detailed in DHX33 interactions with AP-2beta To Regulation Bcl-2 Gene Expression and promoter Cancer Cell Survival.Wang J, Feng W, Yuan Z, Weber JD, Zhang Y.mol Cell biol.2019Aug 12; 39(17).
The cells after drug treatment were subjected to NUCLEOSPIN RNAII kit (Clonetech) to extract total RNA from the cells. The RNA samples were then further purified after denaturation with magnetic bead oligo-dT beads (Gene Bio (Crystal energy Biotechnology (Shanghai) Co., Ltd.). the purified mRNA samples were reverse transcribed into first strand cDNA and further synthesized into second strand complementary DNA. the fragmented DNA samples were blunt-ended and adenylated at the 3' end. ligation with aptamers, then a library was constructed. DNA was quantified by qubit (Invitrogen.) after creation of the cBot cluster, then the DNA samples were sequenced by IlluminaHiSeq2500 SBS from Gene Bio (Crystal energy Biotechnology (Shanghai) Co., Ltd. the raw data was converted into Fastq format. the amount of transcript in each sample was calculated based on FPKM-fragments per million fragments of kilobase transcript, the FPKM value for each sample was calculated using cuffnorm software and 2 values were applied for calculating the differential gene transcript between different samples for KElog GG pathway analysis, p values were calculated using the whole transcript as the background list and the differential transcript as the candidate list. Important genes are classified based on their function.
3. Real-time quantitative PCR
Primers were designed by IDT (http:// sg. idttna. com/site) online "realtime PCRtools", purchased from BGI (Shenzhen). Total RNA was extracted by Highpure RNA isolation kit (Roche) and then transcribed into cDNA using PrimeScript mix kit (Takara). Quantitative PCR reactions were performed using SYBR green supermix (Bio-Rad) and transcript content was calculated from Ct values after normalization with GAPDH values. Melting curves of the amplification products were used to confirm the amplification of a single product for a particular gene in the reaction.
The primer sequences for genes involved in apoptosis in human cells were as follows (all primers from 5 'to 3'):
primer name
Sequence of
NOXA1-Forward
CCAAGCCGTGACCAAGGAC
NOXA1-Reverse
CGCCACATTGTGTAGCACCT
BCL2L13-Forward
TCAGCCCTGCCAATCCAGA
BCL2L13-Reverse
CCGAAATGCCTGATATGTCACT
BCL2L11-Forward
TAAGTTCTGAGTGTGACCGAGA
BCL2L11-Reverse
GCTCTGTCTGTAGGGAGGTAGG
TMBIM1-Forward
GAGAGAGCGGTGAGTGATAGC
TMBIM1-Reverse
ACCTTTCGGATAAAAGTGTGTCG
BCL6-Forward
GGAGTCGAGACATCTTGACTGA
BCL6-Reverse
ATGAGGACCGTTTTATGGGCT
MCL-Forward
CCAAGGACACAAAGCCAATG
MCL-Reverse
TGATGTCCAGTTTCCGAAGC
BCL2-Forward
ACTGGAGAGTGCTGAAGATTG
BCL2-Reverse
AGTCTACTTCCTCTGTGATGTTG
BMF-Forward
ACCCCAGCGACTCTTTTATG
BMF-Reverse
TTTCGGGCAATCTGTACCTC
4. Apoptosis assay
Apoptosis assays were performed with Vybrant apoptosis kit #2(Molecular Probes) according to the manufacturer's protocol. Cells were digested with trypsin (solibao biotechnology limited) and resuspended in cell culture medium to produce a single cell suspension, and cell counting was performed. 100 ten thousand cells were counted per sample, pelleted and washed 2 times with phosphate buffer, then resuspended with the binding solution in the kit, then resuspended in working solution containing annexin V (annexin V), incubated for 15 minutes in the absence of light, then centrifuged for 5 minutes at low speed (1000rpm) and washed once with phosphate buffer. The cells were filtered through a 35 μm filter membrane (Becton Dickinson) and then analyzed by a flow cytometer (FACS, Becton Dickinson), at which time the apoptotic cell index was analyzed by green fluorescence intensity.
5. Semi-inhibitory concentration of cell IC50Value determination
Mixing the cancer cell strain Jurkatt cells with 1X104Individual cells/100. mu.L/well were plated onto 96-well plates, and after completion of cell adhesion, compounds were added to the cell culture medium at concentrations of 10nM, 25nM, 50nM, 100nM, 250nM, 500nM, 1. mu.M, 2.5. mu.M, 5. mu.M, 10. mu.M, and 20. mu.M, and mixed well using a multichannel gun. After incubation time of compound and cells reached 48h, the cells were added to the medium in a 96-well plate using CCK-8 reagent (Shanghai assist san Biotech Co., Ltd.) according to the standard protocol, incubated for 2h, and read using an microplate reader (OD)450nm) The experiment was repeated 3 times, and inhibition curves of the compounds at different concentrations were plotted to calculate the semi-Inhibitory Concentration (IC) of the compounds50)。
6. Statistical analysis
Data are expressed as mean + SD. Statistical significance was determined using Student's test, with P values <0.05 indicating significant differences.
The synthesis method of the compound A of the invention is as follows:
synthesis and identification of Compound A of the present application (AB21697)
1. Synthesis of Compound 3(2- (2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile)
Compound 1 (2-amino-4, 5-dimethylfuran-3-carbonitrile) (2.5g,18.36mmol,1.0eq) was dissolved in tetrahydrofuran (50mL), and compound 2(2, 5-hexanedione) (3.3g,29.38mmol,1.6eq), 3A molecular sieve (50g), and p-toluenesulfonic acid (1.4g,7.44mmol,0.4eq) were added. The mixture was heated to reflux and stirred overnight. The solid was concentrated by filtration, and the residue was purified by flash column chromatography (petroleum ether/ethyl acetate-100/1) to obtain compound 3(2- (2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) as a white solid (2.8g, yield: 71.2%).
MS(ESI)m/z:215.3[M+H]+.
TLC: petroleum ether/ethyl acetate (10: 1);
Rf0.1 for (compound 1);
Rf0.7 as (compound 3);
HNMR(CDCl3,400Hz):δ5.87(s,2H),2.24(s,3H),2.11(s,6H),2.08(s,3H)。
2. synthesis of Compound 4(2- (3-formyl-2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile)
Phosphorus oxychloride (1.9mL,20.8mmol,1.0eq) was added dropwise to dimethylformamide DMF (30mL) at zero degrees in the presence of nitrogen. The mixture was stirred at zero degrees for 30 minutes and then warmed to room temperature. Compound 3(2- (2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) (4.46g,20.8mmol,1.0eq) dissolved in dimethylformamide (4mL) was added to the above mixture. The mixture was heated to 100 ℃ and stirred in the presence of nitrogen for 2 hours. After cooling, the reaction was poured into ice water and the pH of the reaction was adjusted to 10 with 30% aqueous sodium hydroxide solution. The reaction was extracted with ethyl hexanoate and washed with brine. The organic layer was dried over sodium sulfate and concentrated. The solid was purified by flash column chromatography (petroleum ether/ethyl acetate ═ 100/1) to obtain compound 4(2- (3-formyl-2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) as a yellow solid (4.5g, yield: 89.4%).
MS(ESI)m/z:243[M+H]+.
TLC: petroleum ether/ethyl acetate (20: 1);
Rf0.7 as (compound 3);
Rf0.5 as (compound 4);
HNMR(CDCl3,400Hz):δ9.86(s,1H),6.35(s,1H),2.38(s,3H),2.27(s,3H),2.10(s,6H)。
3. synthesis of Compound A (i.e., AB21697) ((E) -2- (3- (2- (1- (1-H-benzo [ d ] imidazol-2-yl ] -2-cyanovinyl)) -2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile)
Compound 4(2- (3-formyl-2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile) (455mg,2.89mmol,1.0eq) was dissolved in ethanol (8mL), compound 8 (2-cyanomethylbenzimidazole) (700mg,2.89mmol,1.0eq) and piperidine (246mg,2.89mmol,1.0eq) were added. The mixture was heated under reflux and stirred for 1 hour. After completion of the reaction, the mixture was cooled to room temperature and filtered. The solid was collected and dried to obtain compound a, AB21697((E) -2- (3- (2- (1- (1-H-benzo [ d ] imidazol-2-yl ] -2-cyanovinyl ]) -2, 5-dimethyl-1H-pyrrol-1-yl) -4, 5-dimethylfuran-3-carbonitrile), as a yellow powder (1.0g, yield: 90.1%).
MS(ESI)m/z:382[M+H]+.
HNMR 1H NMR(400MHz,cdcl3)δ9.71(s,1H),8.33(s,1H),7.72(d,J＝6.7Hz,1H),
7.45(d,J＝5.4Hz,1H),7.26(d,J＝9.1Hz,2H),7.01(s,1H),2.28(s,6H),2.13(d,J＝18.8Hz,6H)。
For the synthesis and identification of compound B and compound C, see CN 112661754A.
Synthesis and characterization of (III) Compound D (AB24386) is as follows:
1. the synthetic route is as follows:
2. the synthesis method comprises the following steps:
1) preparation method of compound 3 (2-acetyl-4-ethyl pentanoate)
Compound 1 (ethyl acetoacetate) (5g,38.42mmol,1.0eq) was dissolved in triethylamine (75mL), and compound 2 (chloroacetone) (3.5g,38.42mmol,1.0eq) was added. The reactants were reacted at 110 ℃ for 2 hours under nitrogen protection. After concentration, the residue was dissolved in water (100mL) and then extracted twice with dichloromethane (50mL each). The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by flash chromatography (petroleum ether/ethyl acetate ═ 20:1) to obtain compound 3 (ethyl 2-acetyl-4-pentanoate) as a colorless oil (1.3g, yield: 18.3%).
MS(ESI)m/z:187[M+H+].
TLC:PE/EA(2/1)
Rf: (compound 1) ═ 0.6;
Rf: (compound 2) ═ 0.4;
2) preparation method of compound 5(1- (3-cyano-5-methylthiophene-2-yl) -2, 5-dimethyl-1H-pyrrole-3-carboxylic acid ethyl ester)
Compound 3 (ethyl 2-acetyl-4-pentanoate) (1g,7.23mmol,1.0eq) was dissolved in toluene (20mL), and compound 4 (2-amino-3-cyano-5-methylthiophene) (1.6g,8.68mmol,1.2eq) and p-toluenesulfonic acid (249mg,1.45mmol,0.2eq) were added. The reaction was stirred at 110 ℃ for 16 h. The solid was filtered and concentrated. The residue was purified by flash chromatography (petroleum ether/ethyl acetate 50/1 to 30/1) to give compound 5(1- (3-cyano-5-methylthiophen-2-yl) -2, 5-dimethyl-1H-pyrrole-3-carboxylic acid ethyl ester) as a yellow oil (860mg, yield: 41%).
MS(ESI)m/z:289[M+H+].
TLC: petroleum ether/acetic ether (10/1)
Rf0.2 for (compound 3);
Rf0.4 as (compound 4);
3) process for the preparation of compound D (AB24386) (1- (3-cyano-5-methylthiophen-2-yl) -N- (6-methoxy-1H-benzo [ D ] imidazol-2-yl) -2, 5-dimethyl-1H-pyrrole-3-carboxamide)
Compound 5(1- (3-cyano-5-methylthiophen-2-yl) -2, 5-dimethyl-1H-pyrrole-3-carboxylic acid ethyl ester) (50mg,0.306mmol,1.0eq) was added to compound 7 (5-methoxy-1H-benzimidazol-2-amine) (88mg,0.306mmol,1.0eq) dissolved in 1mL toluene, and trimethylaluminum (0.15mL,0.306mmol,1.0eq,2M in toluene) was added. The reaction was stirred at 100 ℃ for 16 hours. The mixture was cooled to room temperature, quenched with methanol (10mL), and then adjusted to pH 3 with 3M hydrochloric acid. The mixture was diluted with water (30mL) and then extracted three times with 20mL of ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated. The residue was purified by preparative high pressure liquid chromatography Prep-HPLC (acetonitrile/water, containing 0.1% formic acid) to give compound D (AB24386) (1- (3-cyano-5-methylthiophen-2-yl) -N- (6-methoxy-1H-benzo [ D ] imidazol-2-yl) -2, 5-dimethyl-1H-pyrrole-3-carboxamide) (5mg, yield: 4%) as a white solid.
MS(ESI)m/z:406[M+H+].
1H NMR(400MHz,DMSO-d6):δ12.04(s,1H),11.20(s,1H),7.32(s,1H),7.29(s,1H),6.98(s,1H),6.89(s,1H),6.69(d,J＝7.2Hz,1H),3.73(s,3H),2.47(s,3H)，2.38(s,3H)，2.04(s,3H)。
Inhibition assay of compounds against target
In vitro DHX33 protein helicase activity assays were performed using a range of concentrations of compound (concentrations set at 1nM, 5nM, 10nM, 20nM, 50nM, 100nM, 250nM, 500nM, 1000 nM). The specific methods for extracting DHX33 protein and analyzing helicase activity are disclosed in CN 112661754A. Compounds were further analyzed for inhibition of DHX33 helicase activity using the methods described above.
The half inhibitory concentrations of the compounds of the present invention on DHX33 helicase activity are shown in table 1. As can be seen from table 1, the compounds of the present invention have significant inhibitory effect on the activity of DHX33 protein helicase.
Table 1: analysis of inhibition of DHX33 protease activity by Compound A, Compound B, Compound C and Compound D
Represents a half inhibitory concentration of more than or equal to 400 nM;
represents 100nM or less than half inhibitory concentration < 400 nM;
represents 20nM or less than the half inhibitory concentration < 100 nM;
semi-inhibitory concentration < 20 nM.
Example 1DHX33 protein inhibitor plays an important role in lymphocytic leukemia, and inhibition of DHX33 protein significantly inhibits the growth of lymphocytic leukemia cells
In vitro cell activity experiments were performed by culturing a variety of human leukemia model cell lines including Jurkat T cell line, Raji cell line, Daudi cell line, K562 cell line and Nalm6 cell line. Jurkat cell, a suspension cell, is a model cell for the study of human acute T-cell leukemia. Raji is a human B-lymphoma cell model, of B-cell origin. The Daudi cell line is a human Burkkit lymphoma cell, which carries EB virus, is a typical B lymphoblastoid cell line, and is used for the study of leukemia pathogenesis. The K562 cell line is a human chronic myeloid leukemia cell. The Nalm6 cell line is a human acute B-lymphocytic leukemia cell.
Experiments as shown in figure 1, Jurkat T cells treated with DHX33 inhibitor compound a showed significant death in morphological appearance, number, and activity relative to DMSO control. After 2 generations of Jurkat T cells, the cells were analyzed for apoptosis using a flow cytometer after being treated with DHX33 inhibitor (Compound A) or DMSO vehicle for 72 h. As shown in FIG. 2, the apoptosis rate of Jurkat T cells was increased with increasing concentration in the case of the series of concentration treatments for 72 hours. The concentration of the compound A is 4-5 mu M, and the apoptosis rate of cancer cells reaches about 50% after 72 hours of treatment.
The K562 cells were cultured for a certain period of time, treated with DHX33 protein inhibitor (compound A) or DMSO for 72h, and then observed under an inverted microscope. The results are shown in FIG. 3, K562 cells treated with DMSO grew vigorously, had dense cell numbers, and had normal morphology; while the K562 cell line treated with 2 μ M DHX33 inhibitor compound a showed a relative decrease in cell number and a change in morphology, the K562 cell line treated with 4 μ M DHX33 protein inhibitor compound a showed a significant decrease in cell number, a sudden decrease in cell number, a change in morphology and a poor cell status. As can be seen in fig. 4, flow cytometry analysis showed that the K562 cell line treated with 4 μ M of compound a was apoptotic.
Fig. 5 shows that both cells morphologically have similar results after treatment with compound a in Raji and Daudi cell lines, showing significant apoptosis.
All of the above results are the results of compound a treating cancer cells for 72 hours. If the treatment time of compound A is shortened to 16 hours, it can be seen that cancer cells rapidly show growth inhibition and abnormal cell division under the treatment of compound A, which is shown in FIG. 6.
The results of this example show that DHX33 protein inhibitors have a killing effect on a variety of leukemia cells.
Example 2 induction of apoptosis by DHX33 inhibitors is the leading cause of leukemia cell death
The B cell lymphoma-2 gene is called Bcl-2(B-cell lymphoma-2) for short, namely the B cell lymphoma/leukemia-2 gene, is one of the most important oncogenes in the apoptosis research, has the function of obviously inhibiting the apoptosis, and is frequently highly expressed in leukemia cells. BCL2 gene was down-regulated in Jurkat T cells treated with DHX33 protein inhibitor a.
BMF (Bcl-2-modifying factor) is a Bcl-2 family member with a pro-apoptotic effect, and in a normal physiological state, endogenous BMF is continuously anchored on a cytoskeleton in cytoplasm to sense changes in cells at any moment, and once damage stimulation acts on the cells, the BMF is transferred from the cytoplasm to mitochondria to trigger a mitochondrial apoptosis pathway and induce apoptosis. BMF genes of Jurkat T cells treated by DHX33 inhibitor compound A are up-regulated, thus leukemia cell apoptosis is promoted.
The Mcl-1 (myoloid cell leukemia-1) gene, one of the Bcl-2 family members, plays an important role in the regulation of cell survival, apoptosis, cycle and differentiation. The Mcl-1 gene is closely related to the occurrence and development of malignant tumor in blood system. Research shows that the inhibition of the expression of the Mcl-1 gene can promote apoptosis and improve the sensitivity of tumor cells to radiotherapy and chemotherapy, and in the embodiment, the down regulation of the Mcl gene shows that the coordination promotes the apoptosis of leukemia cells.
To analyze the molecular mechanism by which cancer cells caused significant apoptosis following DHX33 inhibitor treatment, Jurkat T cells and K562 cells were treated with DHX33 inhibitor compound a for only 16 hours, then the cells were harvested for total RNA extraction, followed by RNA-seq sequencing analysis according to standard protocols. The results in FIG. 7 show that Compound A can effectively regulate the transcription of various genes involved in apoptosis in both cancer cells. These genes include BMF, Mcl, Bcl2L11, Bcl2L13, Noxa1, and the like. The table also provides changes in expression of other genes that have been shown to be regulated by DHX33 under inhibitor treatment, such as genes involved in the cell cycle and genes involved in cellular glycolysis. These results further confirm that DHX33 has been effectively inhibited in cells. To verify the correctness of the RNA sequencing results, Jurkat T cells were further analyzed for the expression of the above genes in Jurkat T cells treated with Compound C, and the results are shown in FIG. 8. As can be seen from fig. 8, in Jurkat T cells treated with DHX33 inhibitor C, up-regulation occurred in a number of apoptosis promoting genes, such as Noxa, BMF, etc.; and genes involved in the inhibition of apoptosis, such as Mcl.
Example 3 highly active Compound C obtained after optimization more efficiently induces apoptosis in cancer cells
Because compound A has a high cytostatic concentration, i.e., relatively low activity, compound B (IC) is selected after molecular optimization of compound A5010-20nM) and compound C (IC)500.15 μ M) (see CN112661754A) to further analyze the apoptosis-inducing effect of DHX33 inhibitors on leukemia cells. FIG. 9 shows analysis of the half inhibitory concentrations of Jurkat T cells treated with Compounds B, C and D, indicating that the inhibitor concentrations of these several compounds in Jurkat T cells, i.e., IC50Between 0.025 and 0.18. mu.M, the activity is significantly improved compared to Compound A.
The apoptosis index was first analyzed on the basis of increasing compound C dose. Cancer cells were treated with 0, 0.1, 0.25, 0.5, and 1 μ M for 24 hours, respectively, and after harvesting the cells, the apoptosis rate of the cells was analyzed using an apoptosis staining kit. As shown in fig. 10-12, experimental data show that, after inhibition of DHX33 protein, JurkatT cells undergo significant apoptosis. Data are presented as scatter plots of cells, apoptotic cell population ratio (cells from different samples are indicated on the plot for different concentrations or treatment times, where #351 refers to compound C), respectively. The highest dose of compound C resulted in approximately 90% of the cells undergoing apoptosis 24 hours after treatment of cancer cells with inhibitor C. The apoptosis ratio is indicated by a table in which the total cell number and apoptotic cell number analyzed, as well as the ratio of apoptotic cells to total cells, are recorded. Similarly, as shown in FIGS. 13-15, the apoptosis of Jurkat T cells was analyzed with Compound C under different treatment time conditions, and the apoptosis rate of Jurkat T cells was already over 90% after 96 hours of treatment.
The experimental results prove that the compound C with lower concentration has high-efficiency apoptosis induction effect on the lymphocyte leukemia cells.
Example 4DHX33 inhibitors have no apparent killing of normal cells
To further analyze the inhibitory effect of DHX33 inhibitors on normal blood cells. Normal human peripheral blood mononuclear cells were extracted and treated with DHX33 inhibitor compound a. The results are shown in fig. 16, the mononuclear peripheral blood cells in human blood have no obvious growth inhibition, which indicates that the compound a has no obvious killing or inhibiting effect on normal cells.
Compound C was further analyzed for its inhibitory effect on mesenchymal cells extracted from mouse bone marrow. As shown in FIG. 17, the half-inhibitory concentration of Compound C in normal cells was 2.2. mu.M, which is more than 10 times higher than that of leukemia cells. Moreover, the overall activity of normal cells after treatment with compound C is higher than that of cancer cells. The above experimental results confirmed that compound C is at least 10 times more sensitive to cancer cells than to normal cells.
Example 5 in vivo pharmacokinetic analysis of DHX33 protein inhibitors in animals
Although the small molecule compound can obviously inhibit the growth of cancer cells in vitro, the in vivo drug effect is influenced by in vivo pharmacokinetics, so that the compound B and the compound C are respectively selected for carrying out pharmacokinetic analysis.
Preparation of compound samples for intravenous injection: an average weight of 300g per rat was dissolved with 100. mu.L of DMSO and 0.3mg of Compound C was added, 400. mu.L of polyethylene glycol 400 was added, and 1mL of sterile phosphate buffer was added to make a clear solution for rat tail intravenous injection.
Sample preparation of gavage compounds: for 300g rats, 2.4mg of Compound B (KEYE-2020-3) or Compound C (KEYE-2021-21 (Compound B was used only for gavage) was dissolved in 100. mu.L of DMSO and 1.4ml of phorsal 50PG (from Shanghai Xinri Biotech Co., Ltd.) was added for gavage of the rats, the rats were fasted for 10h before gavage and were disarmed for 4h after gavage.
Rat source: zhongying SIPPR/BK laboratory animals, Shanghai, China.
The number of rats was 6 in total, 3 were used for intravenous injection and 3 were used for oral gavage.
Plasma sample collection:
intravenous injection: 0.083h, 0.25h, 0.5h, 1h, 2h, 4h, 8h and 24h after injection.
And (3) oral administration and gastric perfusion: 0.25h, 0.5h, 1h, 2h, 4h, 6h, 8h and 24h after oral administration.
Plasma sample collection and handling steps: rats were bled intravenously after dosing, 0.2mL per time point. Blood samples were placed in small tubes containing EDTA on ice until centrifugation. The blood sample was centrifuged at 6800g for 6 minutes in a centrifuge within 1h after blood collection, and then immediately placed in a refrigerator at-80 ℃ with the remaining blood disposed.
Sample analysis and data processing:
the analysis results were determined by quality inspection. The accuracy of mass-checked samples greater than 66.7% should remain in the range of 80-120% of known data.
Standard parameters, including area under the curve (AUC (0-T) and AUC (0- ∞)), half-life of clearance (T1/2), maximum plasma concentration (Cmax), time to peak (Tmax), were analyzed by the FDA-certified pharmaceutical program Phoenix WinNonlin 7.0(Pharsight, USA). As can be seen in fig. 18, various pharmacokinetic parameters of compound B and compound C following administration in rats. As can be seen from the data in the figure, Compound C has better bioavailability and better absorption, whether administered intravenously or orally. In particular, compound C has a better oral bioavailability, with an average bioavailability of about 43%.
In addition to analyzing the pharmacokinetic parameters of the drug, this example also performed a plasma stability experiment. The plasma stability test method is as follows:
1. 100mM KCl buffer (containing 5mM MgCl)2pH 7.41) was preheated to 37 ℃.
2. Human plasma was rapidly thawed to 37 ℃.
3. Preparation of test compounds and internal reference:
1) compound B (KEYE-2021-9) and compound C (KEYE-10-6) were dissolved in DMSO to prepare a 10mM stock solution. Then 0.5mM solution a: adding 10 mu L of 10mM mother liquor into 190 mu L of acetonitrile to obtain solution A;
2)0.01mM solution B: mu.L of solution A was added to 980. mu.L of 100mM KCl buffer to obtain solution B.
4. Plasma and solution B were pre-warmed and incubated at 37 ℃ for 5 minutes.
5. To the wells 90 μ L of pre-warmed plasma samples were added at the following time points: 0.5, 15, 30, 60, 120 minutes.
6. At the 0 minute time point, 400 μ L acetonitrile containing internal reference procaine was added to the 0-minute well, followed by 10 μ L of solution B.
7. For other time points, 10 μ L of pre-warmed solution B was added to the set wells at the following time points: 5. 15, 30, 60, 120 minutes, and then timed.
8. Several time points below: 5. for 15, 30, 60, 120 minutes, 400. mu.L of acetonitrile containing internal paramethylprocaine was added to each well to terminate the reaction.
9. After quenching, plates were shaken for 5 min (600rpm) and stored at-20 ℃ (if necessary) until analyzed by LC/MS.
10. The samples were thawed to room temperature and then centrifuged at 6000rpm for 20 minutes before analysis by LC/MS/MS on a liquid mass online.
11. 100 μ L of the supernatant was transferred to wells of a 96-well plate, to each of which 100 μ L of water had been previously added, and subjected to LC/MS test.
The results of the experiment are shown in fig. 19, and compound B and compound C are very stable and are not easily modified in plasma.
The in vivo and in vitro drug metabolism data show that the small molecule inhibitor of DHX33 can reach effective concentration in vivo and has better metabolic stability. The data support that the DHX33 small-molecule inhibitor has the value of being developed into an effective medicament for inducing the apoptosis of the leukemia cells.
Example 6 in vivo pharmacological analysis of DHX33 protein inhibitors
A specific experimental plan is shown in fig. 20, and mice were randomly grouped after tumors were palpable. The administration mode was selected from tail vein injection of small animals, and of the four compounds of the present application, compound D had better water solubility, so compound D was selected for intravenous administration in this experiment. The experimental details are as follows:
1. animal information
Species and strains: NOD-SCID Severe immunodeficiency mouse strain.
Sex and week age: female, 6 weeks old.
Weight: 20-22g, with a deviation of about + -20% of the body weight mean.
Number of animals inoculated: 8 are provided.
Animal sources: beijing Wittiulihua laboratory animal technology Co.
2. Animal feeding
The living conditions are as follows: SPF environment, IVC mouse cages, 4 per cage.
Temperature: 20-26 ℃.
Humidity: 40-70 percent.
Illumination: 12h alternate day and night.
Feed: the irradiated mouse feed is purchased from Jiangsu cooperative pharmaceutical and bioengineering Co., Ltd and is freely eaten.
Drinking water: city tap water is filtered and autoclaved for drinking.
Padding: corncobs, purchased from Jiangsu cooperative pharmaceutical and bioengineering, Inc., were autoclaved and used, and replaced twice a week.
Adaptive feeding: mice were given an adaptive feeding period of no less than 7 days prior to the experiment.
Animal identification: each squirrel cage is hung with an experiment information marking card which comprises mouse information, cell inoculation information, animal experiment information, experimenter information and the like, and the mouse is marked by an ear mark method.
The operation and management of all experimental animals strictly comply with the guiding principles of the use and management of the experimental animals.
3. Solvent formulation and storage conditions for the administration solution
(1) The test substance: compound D
The preparation of the medicine comprises the following steps: according to the calculation of 20g mouse weight, 0.2mg or 0.5mg of compound D in powder state is weighed, firstly 2.5 mul of NMP is used for dissolving at normal temperature, then the cosolvent is added in sequence at normal temperature according to the volume ratio of NMP to PEG400 to Tween 80 being 1 to 2 to 1, and then 90 mul of sterile water is added, so that the final NMP content is 2.5%, the PEG400 is 5%, the Tween 80 is 2.5% and the water is 90%.
(2) Cell line
Human T lymphoma cell line Jurkat T was purchased from the cell bank of the chinese academy of sciences.
(3) Culture medium
RPMI medium and Fetal Bovine Serum (FBS) were purchased from GIBCO (Grand Island, NY, USA).
4. Design of experiments
The experimental design is shown in table 2.
TABLE 2 study protocol for the inhibition of xenograft tumor growth in human T lymphoma cells Jurkat T-NOD-SCID Severe immunodeficient mice
Note: NA means not applicable, IV means intravenous injection, QOD means once every two days, and Vehicle means control group.
5. Experimental methods
(1) Model building
Culturing human T lymph cancer cell Jurkat T in RPMI-1640 medium containing 10% FBS, and maintaining in 5% CO2At 37 ℃ in a saturated humidity incubator.
Jurkat T cells were collected in the logarithmic growth phase and the cell concentration was adjusted to 5X 10 cells/ml7And (4) cells. Under sterile conditions, 0.1mL of the cell suspension was inoculated subcutaneously into the right dorsal side of the mouse at a concentration of 5X 106Cells/0.1 mL/mouse.
(2) Grouping and drug administration Observation
When the tumor grows to touch and the average volume reaches nearly 50mm3At time, animals were grouped by tumor volume and randomized. If the tumor volume is more or less than 25% of the mean volume, no enrollment experiments are performed. There were 6 mice meeting this criteria, three per group. Day of the group was Day 1 and dosing was started according to animal body weight. During the administration, tumor volume was measured 2-3 times per week (according to standard methods)And animal body weight, and observing and recording animal clinical symptoms every day.
Description of experimental end-points:
end point of experiment: after the final weighing, use CO2The remaining animals were euthanized.
As can be seen from FIGS. 21-22, there was significant inhibition of tumors in mice treated with DHX33 inhibitor (Compound D) as compared to the control group. After 16 days of drug treatment, the tumors in the control mice grew to an average weight of about 0.81 g, whereas the tumors in the drug mice were not visible. Represents significant difference between two groups, and P value is less than 0.001
DHX33 inhibitor (compound D) the body weight of each group of mice was also followed during the treatment of mice by i.v. injection for 16 days. The detection results are shown in fig. 23, and the results show that the mice in the drug group have no obvious weight loss phenomenon, and compared with the control group, the mice in the drug group have normal behaviors and weights.
The experimental data show that the DHX33 small-molecule inhibitor has no obvious toxic or side effect on mice.