阅读说明：本技术 一种靶向药物及其制备方法和应用 (Targeted drug and preparation method and application thereof ) 是由 官键 吴茜茜 曾伟伟 于 2021-07-12 设计创作，主要内容包括：本发明涉及一种靶向药物,所述靶向药物包括含有COMMD10基因片段的质粒。本发明还提供该靶向药物的制备方法和应用。本发明的靶向药物,具有良好的生物相容性、高疗效、靶向性好、安全度高等效果。(The invention relates to a targeted drug, which comprises a plasmid containing a COMMD10 gene segment. The invention also provides a preparation method and application of the targeted drug. The targeted drug has the advantages of good biocompatibility, high curative effect, good targeting property, high safety and the like.)

1. A targeted drug, which is characterized by comprising a plasmid containing a COMMD10 gene fragment.

2. The targeted drug of claim 1, further comprising a targeting peptide.

3. The targeted drug of claim 1, further comprising a targeting nanocomposite for encapsulating the plasmid, the targeting nanocomposite comprising a targeting peptide.

4. The targeted drug of claim 3, wherein the targeted nanocomposite further comprises a photothermal agent.

5. The targeted drug of claim 3, wherein the targeted nanocomposite further comprises a zeolitic imidazolate framework material.

6. The targeted drug of claim 3, wherein the targeted nanocomposite is ZIF-8-PDA-SP94, wherein ZIF-8 is zeolitic imidazolate framework-8, PDA is a photothermal agent, and SP94 is a liver cancer targeting peptide.

7. A method for preparing the targeted drug according to claim 4, characterized by comprising the steps of: A. entrapping plasmids; B. connecting a photothermal reagent; C. connecting the targeting peptide.

8. The preparation method of the targeted drug according to claim 7, wherein the targeted drug is COMMD10pDNA @ ZIF-8-PDA-SP94, and the preparation method comprises the following steps:

A. encapsulating the plasmid: mixing the plasmid containing the COMMD10 gene fragment with PEI, reacting at 37 ℃, adding 2-MIM, and stirring at normal temperature; zn (NO) is added₃)₂·6H₂O, stirring at normal temperature, centrifuging, taking out precipitate, and usingWashing with distilled water to obtain COMMD10pDNA @ ZIF-8;

B. connecting a photothermal reagent: resuspending COMMD10pDNA @ ZIF-8 obtained in the step A in ethanol, then sequentially adding dopamine hydrochloride and NaOH, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain COMMD10pDNA @ ZIF-8-PDA;

C. connecting targeting peptides: and D, adding the COMMD10pDNA @ ZIF-8-PDA obtained in the step B into a Tris-HCl solution and SP94 polypeptide, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain the COMMD10pDNA @ ZIF-8-PDA-SP 94.

9. The targeted drug of claim 1, which is used in a drug for treating liver cancer.

10. The targeted drug of claim 1, for use in a radiosensitizing drug.

Technical Field

The invention relates to the field of medicines, in particular to a targeted medicine and a preparation method and application thereof.

Background

Cancer, also known as tumor, is now one of the major diseases that endanger human health. Achieving safe and effective anti-tumor therapy has become an important task for medical workers in order to better maintain the health of patients. From the clinical situation of the existing medicine, most of the medicines for treating the tumor lack specificity and have no specific target spot, except killing tumor cells, other cells can be greatly damaged, and serious side effects are brought, so that the clinical application is greatly limited. Therefore, it is important to find a new therapeutic means with high safety and strong specificity.

Disclosure of Invention

The invention aims to provide a targeted drug with high specificity, high safety and good curative effect, and also provides a preparation method and application of the targeted drug.

In order to solve the problems, the technical scheme adopted by the invention is as follows:

a targeted drug comprising a plasmid containing a COMMD10 gene fragment.

In the present invention, it is further preferred that the targeting drug further comprises a targeting peptide.

In the present invention, it is further preferred that the targeted drug further comprises a targeted nanocomposite material for encapsulating the plasmid, and the targeted nanocomposite material comprises a targeted peptide.

In the present invention, it is further preferable that the targeted nanocomposite further comprises a photothermal agent.

In the present invention, it is further preferable that the targeted nanocomposite further includes a zeolitic imidazolate framework material.

In the invention, a further preferable scheme is that the targeted nano composite material is ZIF-8-PDA-SP94, wherein ZIF-8 is a zeolite imidazole ester framework material-8, PDA is a photothermal reagent, and SP94 is a liver cancer targeted peptide.

The invention provides a preparation method of the targeted drug, which comprises the following steps: A. entrapping plasmids; B. connecting a photothermal reagent; C. connecting the targeting peptide.

In the invention, a further preferable scheme is that the targeted drug is COMMD10pDNA @ ZIF-8-PDA-SP94, and the preparation method of the targeted drug comprises the following steps:

A. encapsulating the plasmid: mixing the plasmid containing the COMMD10 gene fragment with PEI, reacting at 37 ℃, adding 2-MIM, and stirring at normal temperature; zn (NO) is added₃)₂·6H₂O, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain COMMD10pDNA @ ZIF-8;

B. connecting a photothermal reagent: resuspending COMMD10pDNA @ ZIF-8 obtained in the step A in ethanol, then sequentially adding dopamine hydrochloride and NaOH, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain COMMD10pDNA @ ZIF-8-PDA;

C. connecting targeting peptides: and D, adding a Tris-HCl solution and SP94 polypeptide into the COMMD10pDNA @ ZIF-8-PDA obtained in the step B, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain OMMD10pDNA @ ZIF-8-PDA-SP 94.

The targeted medicine can be applied to liver cancer treatment and radiosensitization.

Compared with the prior art, the invention has the following advantages: the targeted drug has the advantages of good biocompatibility, high curative effect, good targeting property, high safety and the like.

The invention is described in detail below with reference to the drawings and the detailed description.

Drawings

FIG. 1 is a transmission electron micrograph of nanoparticles in Experimental example 1;

FIG. 2 is a Zeta potential test data chart of nanoparticles in Experimental example 1;

FIG. 3 is an electron spectrum (XPS) chart of nanoparticles in Experimental example 1;

FIG. 4 is an X-ray diffraction (XRD) pattern of nanoparticles in Experimental example 1;

FIG. 5 is a UV-Vis spectrum of nanoparticles of Experimental example 1;

FIG. 6 is a graph showing photothermal property test data of nanoparticles in Experimental example 1;

FIG. 7 is an agarose gel electrophoresis image of nanoparticles in Experimental example 1;

FIG. 8 is a graph showing data of a cell viability assay of nanoparticles in Experimental example 2;

FIG. 9 is a fluorescence chart of liver cancer cells after uptake of nanoparticles in Experimental example 2;

FIG. 10 is a graph of the data of the test in which nanoparticles increase the expression of COMMD10 gene in Experimental example 2 and an immunoblot of the expressed corresponding protein;

FIG. 11 is a graph showing the test data of the COMMD10 gene expression of the control group and the test group in Experimental example 3 and an immunoblot of the expressed proteins;

FIG. 12 is a graph of experimental cloning of cells from control and test groups under different doses of X-ray irradiation and a multi-target one-click model fitted survival curve in Experimental example 3;

FIG. 13 is a graph showing data on apoptosis in FITC-Annexin V/PI flow-type assay under 6Gy X-ray irradiation in the cells of the control group and the test group in Experimental example 3;

FIG. 14 is a schematic diagram illustrating the construction of a radiotherapy model for subcutaneous tumor in nude mice in Experimental example 3;

FIG. 15 is a graph of tumor-bearing nude mice of the control group and the test group in Experimental example 3;

FIG. 16 is a subcutaneous tumor map of the control group and the test group in Experimental example 3;

FIG. 17 is a graph showing the growth of subcutaneous tumors in control and test groups of nude mice in Experimental example 3 with respect to volume versus time.

In fig. 11-13 and 15-17, Vector is a control cell group, and shCOMMD10 is a stable low-expression COMMD10 group (or test group).

Detailed Description

The present invention will be further described with reference to the accompanying drawings and specific embodiments, and it should be noted that any combination of the embodiments or technical features described below can be arbitrarily combined into a new embodiment without conflict. Except where specifically indicated, the equipment and reagent materials in the examples and experimental examples are commercially available and the examples are exemplary only and are not to be construed as limiting the scope of the application.

A targeted drug comprising a plasmid containing a COMMD10 gene fragment. Researches show that the structural domain-10 (COMMD10 gene) of the copper metabolism gene MURR1 can promote the apoptosis of liver cancer cells and inhibit the proliferation and transfer of the liver cancer cells, and a targeted drug obtained by utilizing a plasmid containing a COMMD10 gene fragment can enter the liver cancer cells, improve the expression of the COMMD10 gene of the liver cancer cells and further can effectively treat the liver cancer; meanwhile, the targeted drug can be effectively applied to targeted gene therapy of liver cancer, has good safety and greatly reduces toxic and side effects; in addition, the COMMD10 gene can also increase radiosensitivity and can be applied as a radiosensitization drug.

In order to further improve the targeting performance and safety performance of the drug, the targeted drug also comprises the targeted peptide, and the targeted peptide can effectively identify the targeted cells through the arrangement and modification of the targeted peptide, so that adverse effects on other cells caused by the fact that the traditional drug cannot identify the targeted cells are avoided, and the curative effect of the drug can be further improved.

In the targeted drug, the plasmid containing the COMMD10 gene fragment can be encapsulated by the existing plasmid encapsulating material, in order to better enable the drug to enter cells and improve the safety performance, the plasmid can be encapsulated by the nano composite material, and the nano composite material for encapsulating the plasmid can be a zeolite imidazole ester framework material (which is nontoxic and has good biocompatibility), such as zeolite imidazole ester framework material-8 (ZIF-8); correspondingly, in order to improve the performance of identifying the target cells, the nanocomposite material can be subjected to targeted modification, namely, the plasmid is connected with a target peptide for identifying the target cells, such as the target peptide SP94 for identifying the hepatoma cells.

In order to further improve the curative effect of the drug, the targeted nanocomposite material can be modified by a photo-thermal reagent, namely the targeted nanocomposite material also comprises the photo-thermal reagent, for example, the photo-thermal reagent PDA is selected, and the photo-thermal reagent PDA is added, so that on one hand, the photo-thermal treatment of tumors can be realized, and on the other hand, the targeted peptide can be modified.

The specific types of the targeting peptide, the photothermal agent, the nanocomposite and the plasmid containing the COMMD10 gene segment are not particularly limited; in the invention, a targeted drug which is composed of targeting peptide SP94, photothermal reagent PDA and nano composite material Zeolite imidazole ester framework material-8 (ZIF-8) is exemplified: COMMD10pDNA @ ZIF-8-PDA-SP94, wherein ZIF-8 is a nontoxic and biocompatible metal-organic framework material constructed by zinc ions and 2-methylimidazole, has larger pore size, high specific surface area and good stability in a neutral environment, the drug release performance of the drug is slower after entering a human body, the drug enters targeted cells to provide time guarantee, the killing of tumor cells can be further promoted by combining photothermal therapy through the addition of a photothermal reagent, and the added SP94 can accurately identify liver cancer cells, so that the drug can effectively enter the liver cancer cells, and then the expression of a COMMD10 gene is increased in the liver cancer cells, so that the apoptosis of the liver cancer cells is promoted, the proliferation and the transfer of the liver cancer cells are inhibited, and the purpose of treating cancers is achieved; the medicine has good biocompatibility, liver cancer cell active targeting property and gene release controllability, and overcomes the defects of multiple target spots, low curative effect, high side effect and the like of the existing medicine.

The invention provides a preparation method of the targeted drug, which comprises the following steps: A. entrapping plasmids; B. connecting a photothermal reagent; C. connecting the targeting peptide.

The preparation method of the targeting drug COMMD10pDNA @ ZIF-8-PDA-SP94 comprises the following steps:

A. encapsulating the plasmid: mixing the plasmid containing the COMMD10 gene fragment with PEI, reacting at 37 ℃, adding 2-MIM, and stirring at normal temperature; zn (NO) is added₃)₂·6H₂O, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain COMMD10pDNA @ ZIF-8;

B. connecting a photothermal reagent: resuspending COMMD10pDNA @ ZIF-8 obtained in the step A in ethanol, then sequentially adding dopamine hydrochloride and NaOH, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain COMMD10pDNA @ ZIF-8-PDA;

C. connecting targeting peptides: and D, adding the COMMD10pDNA @ ZIF-8-PDA obtained in the step B into a Tris-HCl solution and SP94 polypeptide, stirring at normal temperature, centrifuging, taking a precipitate, and washing with distilled water to obtain the COMMD10pDNA @ ZIF-8-PDA-SP 94.

Example 1

A targeted drug is COMMD10pDNA @ ZIF-8-PDA-SP94, wherein the COMMD10pDNA is a plasmid containing a COMMD10 gene fragment, ZIF-8 is a zeolite imidazole ester framework material-8, PDA is a photothermal reagent, and SP94 is a liver cancer targeted peptide; the preparation method comprises the following steps:

A. encapsulating the plasmid: adding 300 μ L plasmid (1.56 μ g/. mu.L) containing COMMD10 gene fragment into PEI (50 μ g), mixing, reacting at 37 deg.C for 30min, adding 0.4g 2-MIM (dissolved in 1.6mL water in advance), and stirring at room temperature for 10 min; 0.04g Zn (NO) was added₃)₂·6H₂O (pre-dissolved in 0.16mL of water), stirring for 10min at normal temperature, centrifuging (10000r/min) for 5min, taking out a precipitate, and washing with distilled water for 2 times to obtain COMMD10pDNA @ ZIF-8;

B. connecting a photothermal reagent: b, resuspending the COMMD10pDNA @ ZIF-8(20mg) obtained in the step A in 20mL of ethanol, then sequentially adding 66.7 mu L of dopamine hydrochloride (150mg/mL) and 166.7 mu L of NaOH (20mg/mL), stirring for 2h at normal temperature, centrifuging (10000r/min) for 5min, taking out a precipitate, and washing with distilled water for 2 times to obtain the COMMD10pDNA @ ZIF-8-PDA;

C. connecting targeting peptides: adding 3ml of Tris-HCl solution (pH8.5 and 10mM) and 10mg of SP94 polypeptide into COMMD10pDNA @ ZIF-8-PDA (10mg) obtained in the step B, stirring at normal temperature for 12h, centrifuging (10000r/min) for 5min, taking out the precipitate, and washing with distilled water for 2 times to obtain COMMD10pDNA @ ZIF-8-PDA-SP 94;

the plasmid containing the COMMD10 gene fragment was purchased from Guangzhou multifunctional Gene Co., Ltd and is commercially available, and the nucleotide sequence of the plasmid is ATGGCGGTCCCCGCGGCGCTGATCCTACGGGAGAGCCCCAGCATGAAGAAAGCAGTGTCACTGATAAATGCAATAGATACAGGAAGATTTCCACGGTTGCTCACTCGGATTCTTCAAAAACTTCACCTGAAGGCTGAGAGCAGTTTCAGTGAAGAAGAGGAAGAAAAACTTCAAGCGGCATTTTCTCTAGAGAAACAAGATCTTCACCTAGTTCTTGAAACAATATCATTTATTTTAGAACAGGCAGTGTATCACAATGTGAAGCCAGCAGCTTTGCAGCAGCAATTAGAGAACATTCATCTTAGACAAGACAAAGCTGAAGCATTTGTCAATACGTGGTCTTCTATGGGTCAAGAAACAGTTGAAAAGTTCCGGCAGAGAATTCTGGCTCCCTGTAAGCTAGAGACCGTTGGATGGCAGCTTAACCTTCAGATGGCTCACTCTGCTCAAGCAAAACTAAAATCTCCTCAAGCTGTGTTACAACTCGGAGTGAACAATGAAGATTCAAAGAGCCTGGAGAAAGTTCTTGTGGAATTCAGTCACAAGGAGTTGTTTGATTTCTATAACAAGCTAGAGACTATACAAGCACAGCTGGATTCCCTTACATAG.

Experimental example 1

The physicochemical properties of the nanoparticle composite material involved in COMMD10pDNA @ ZIF-8-PDA-SP94 prepared in example 1 were examined:

1) physical morphology and Zeta potential measurement

With reference to fig. 1, the ZIF-8 nanoparticles and ZIF-8-PDA-SP94 nanoparticles were observed under a transmission electron microscope, respectively, and it was found that the particles of the two nanoparticles were uniform in size and good in dispersibility, and it was found that the drug could be well absorbed and entered into hepatoma cells by the inclusion of the particles;

with reference to fig. 2, the zeta potential of the nanoparticles is detected by a dynamic light scattering instrument (laboratory instruments, brueck hei country) as ZIF-8 nanoparticles and ZIF-8-PDA-SP94 nanoparticles, and the material is in a negative charge, so that the blood half-cycle time of the drug material in vivo can be prolonged.

2) X-ray photoelectron spectroscopy (XPS) and X-ray diffraction (XRD)

With reference to fig. 3, an x-ray photoelectron spectroscopy (ESCALAB 250Xi, japan) is used to analyze the chemical compositions of the ZIF-8 nanoparticles and the ZIF-8-PDA-SP94 nanoparticles, and fig. 3 can confirm that the PDA in the ZIF-8-PDA-SP94 nanoparticles is successfully modified by PDA and the material structure is stable;

referring to FIG. 4, the crystal structure of the nanoparticles was analyzed using an x-ray diffractometer (Bruker D8, Germany), and FIG. 4 can demonstrate that the ZIF-8 crystal morphology was stable during the preparation process.

3) Optical and photothermal properties

With reference to fig. 5, a spectrophotometer (Infinite M200 PRO multifunctional microplate reader) is used to detect ultraviolet spectrograms of the ZIF-8-PDA-SP94 nanoparticles with different concentrations, and fig. 5 shows that the nanoparticles have strong light absorption capacity and exhibit concentration dependence;

with reference to fig. 6, a thermal infrared imager (FLK-TI 1009 HZ) is used to detect the photothermal properties (excited by a 808nm laser light source) of nanoparticles with different concentrations, and fig. 6 shows that the nanoparticles have excellent photothermal conversion efficiency, can reach the tumor firing temperature of photothermal therapy, and exhibit concentration dependence.

4) Agarose gel electrophoresis

To demonstrate the plasmid protective effect of the nanoparticles, pGFP @ ZIF-8 nanoparticles containing GFP pDNA and free GFP pDNA were dispersed into PBS solution. DNase I was added and incubated at 37 ℃ for 30min, followed by inactivation of DNase I by addition of 1. mu.L EDTA. Centrifuging at 6000rpm for 5min, and re-suspending the collected nanostructure solid in water solution for agarose gel electrophoresis.

To evaluate GFP pDNA protected by pGFP @ ZIF-8 nanoparticles, the collected solid after DNase I treatment was resuspended in PBS solution. The ZIF-8 vector was completely dissolved by adding 10. mu.L of EDTA, and then the released GFP pDNA was completely extracted from the nanoparticles with heparin solution. Agarose gel electrophoresis analysis calculated the protected GFP pDNA.

Referring to FIG. 7, FIG. 7 shows that the nanoparticles can protect plasmids contained in drugs from degradation by DNase. Wherein lane 1 is DNA Marker, lanes 2 and 3 are free GFP pDNA untreated/treated by DNase I, lanes 4 and 5 are pGFP @ ZIF-8 nanoparticles untreated/treated by DNase I, and lane 6 is pGFP @ ZIF-8 nanoparticles treated by DNase I, and the released GFP pDNA.

Experimental example 2

The biomolecular properties of nanoparticles of COMMD10pDNA @ ZIF-8-PDA-SP94 prepared in example 1 were examined:

1) CCK-8 method for detecting material safety

With reference to fig. 8, the CCK-8 method was used to test the effect of cell survival rate of nanoparticles with different concentrations, as shown in fig. 8, the nanoparticles have negligible effect on cell survival, demonstrating that the nanoparticles are a safe and non-toxic material (targeting drug).

2) Immunofluorescence assay detection of material cellular uptake

The liver cancer cells are inoculated on a 12-hole plate, and after overnight culture, the liver cancer cells and the nanoparticles carrying ICG dye (free ICG, group carrying ICG without SP94 nanoparticles, group carrying ICG with SP94 nanoparticles) are respectively cultured for 1, 3, 6 and 12 hours. After one PBS wash, 4% paraformaldehyde was fixed; after three times of PBS washing, Triton breaks membranes; after PBS washing, DAPI nuclear staining was performed and observed under a fluorescent microscope. In this case, DAPI nuclear staining was blue fluorescence and ICG red fluorescence.

With the combination of fig. 9, the nanoparticle can be effectively taken up by liver cancer cells, and the taking amount of the nanoparticle after SP94 modification is higher than that of the nanoparticle without modification, and the taking amount of the nanoparticle is the highest in 6 h.

3) Quantitative RT-PCR method and immunoblotting detection nanoparticle transfection efficiency

The liver cancer cells are inoculated in a six-hole plate, cultured overnight, and cultured with nanoparticles carrying control plasmid pGFP/COMMD10 plasmid for 72h, total RNA is collected through Trizol reagent to carry out qRT-PCR experiment, and total protein is extracted through a whole protein extraction kit to carry out immunoblotting experiment.

qRT-PCR experiments: according toPremix Ex Taq II (Takara) protocol requires the preparation of PCR reaction solution, and after adding the sample to the real-time PCR tube, the PCR reaction conditions of ABI7500(Perkin Elmer/applied Biosystems) were set as follows: 95 ℃ for 5s, 60 ℃ for 34s, 40 cycles. Data is according to 2^-ΔΔCtThe relative expression of the gene is calculated by the formula. The COMMD10 and internal control GAPDH reverse transcription primers were purchased from Rui Boxing Corp. COMMD10 primer: forward direction: 5'-CTCCTCAAGCTGTGTTACAACTC-3', respectively; and (3) reversing: 5'-GGAATCCAGCTGTGCTTGTATAG-3' are provided. GAPDH primer: forward direction: 5'-CCATCAATGACCCCTTCATTGACC-3', respectively; and (3) reversing: 5'-GAAGGCCATGCCAGTGAGCTTCC-3' are provided.

Immunoblotting experiments: protein quantification was performed using BCA Protein Assay reagent Kit from Bio-Rad, boiling for denaturation, followed by SDS-PAGE until the desired Protein (COMMD10 molecular weight 25KD and GAPDH 37KD) was eluted, 200mA was applied to membrane for 1h, 5% skim milk was incubated at room temperature, and COMMD10 antibody (Abcam) and GAPDH antibody (Proteitech) were incubated at 4 ℃ overnight. After incubating HRP-labeled anti-rabbit and anti-mouse secondary antibodies (Hangzhou Friedel Biotechnology Co., Ltd.) for 1h at room temperature, ECL (Nanjing Kai base Biotechnology development Co., Ltd.) hypersensitive chemiluminescence reagent (Biotechnology development Co., Ltd.) was used for detecting the strip.

With the combination of fig. 10, the nanoparticle can effectively transfect liver cancer cells and improve the expression level of COMMD10 gene and corresponding protein in the liver cancer cells.

Experimental example 3

Test of the effect of COMMD10 gene expression on hepatoma cells:

1) construction of HepG2 hepatoma cell line stably expressing COMMD10 at low level

HepG2 cells (from Shanghai institute of cell Bank, China academy of sciences) were grown at densities of 70-80% at 2X 10⁴One well was inoculated in 24-well plates and grown overnight in antibiotic-free medium. 10 of each of the COMMD10 low-expression and control lentiviruses⁸TU/ml, diluted with 0.5ml ENi.S. solution, added with 8mg/ml Polybrene solution, and transfected for 12 h. After 48h of culture in 10% serum DMEM, 0.5mg/ml Puromycin was added for 10 days of continuous selection.

2) Efficiency verification of HepG2 liver cancer cell line stably expressing COMMD10 at low level

With the combination of FIG. 11, the results show that the expression levels of the COMMD10 gene and the corresponding protein of the constructed stable low-expression COMMD10 HepG2 liver cancer cell line (shCOMMD10) are obviously lower than those of the control group (Vector), and the corresponding stable strain is successfully constructed.

3) Low expression of COMMD10 for inducing liver cancer HepG2 cell to resist radiotherapy

After single cell suspension was prepared by digestion of HepG2 cells stably infected with Vector and shCOMMD10 virus, the single cell suspension was inoculated in a six-well plate in predetermined number, and 3 duplicate wells were set for 0, 2, 4, 6, 8Gy dose groups per dose group. After irradiation, the cells were placed at 37 ℃ in 5% CO₂Culturing in the incubator for 10-14 days. When macroscopic colonies appeared in the plates, the culture was terminated. PBS wash 2 times, methanol fixation, hematoxylin staining. The number of clones containing more than 50 cells was counted under a microscope. Colony formation and survival scores were calculated and curves were fitted using a multi-target single-click model.

The results combined with figure 12 show that the survival fraction of COMMD10 low-expression HepG2 liver cancer cells is obviously increased, and radiation therapy resistance is induced.

4) Effect of COMMD10 on apoptosis of hepatoma cells

Cells were spread evenly in six-well plates, control and knockdown of COMMD10 by lipo2000 transfection, and 6h after transfection the cell culture medium was changed to fresh medium. After 48h of transfection, the collected cells were stained with FITC-Annexin V/PI apoptosis kit (Nanjing Kaikyi Biometrics, Inc.). Detecting the apoptosis of the liver cancer cells by using a flow cytometer.

In conjunction with FIG. 13, the results show that liver cancer cell apoptosis is significantly reduced after interfering with COMMD10 expression.

5) Construction of radiotherapy model of subcutaneous tumor of nude mouse

The constructed HepG2 tumor cells stably infected with Vector and shCOMMD10 virus were injected to the back of nude mice. Observing the growth of the tumor until the tumor volume grows to 150mm³The sizes were randomly divided into two major groups, the irradiated group (IR) and the non-irradiated group (No IR), each of which contained two minor groups, Vector, shCOMMD 10. Nude mice in the irradiated group (IR) were irradiated with 6Gy X-ray at the same time on day 14 and day 21, and the tumor size was measured every 3 days during the experiment.

The results, taken together with FIGS. 14-17, show that by the experimental end point of 41 days, the tumor volume of the shCOMMD10 group (1351.72 + -100.13) was significantly increased in comparison with the Vector group (325.11 + -63.68) in the non-irradiated group (No IR), and the shCOMMD10/Vector ratio was 4.16. In the irradiated group (IR), the ratio of the tumor volume in the shCOMMD10 (927.33. + -. 91.47) to that in the Vector (129.87. + -. 45.47) was further increased than that in the non-irradiated group (No IR) (shCOMMD10/Vector ratio was 7.14). The low expression of COMMD10 is proved to be capable of promoting the growth of subcutaneous tumor after nude mice radiotherapy and inducing liver cancer cell HepG2 radiotherapy resistance.

In conclusion, the expression of the COMMD10 gene is in negative correlation with the growth and proliferation of the liver cancer cells, and the COMMD10 gene is low in expression, so that the activity of the liver cancer cells can be improved, and the radiotherapy resistance of the liver cancer cells can be induced; the COMMD10 gene has high expression, and can reduce the activity of liver cancer cells and inhibit the proliferation thereof.

The above embodiments are only preferred embodiments of the present invention, and the protection scope of the present invention is not limited thereby, and any insubstantial changes and substitutions made by those skilled in the art based on the present invention are within the protection scope of the present invention.