阅读说明：本技术 一种包含氨肽酶Amp0279编码序列的重组质粒、重组谷氨酸棒状杆菌及应用 (Recombinant plasmid containing aminopeptidase Amp0279 coding sequence, recombinant corynebacterium glutamicum and application ) 是由 胡晓敏 熊海容 赵普瑛 张萌 于 2021-09-30 设计创作，主要内容包括：本发明公开了一种球形赖氨酸芽孢杆菌C3-41来源的氨肽酶Amp0279的基因及氨基酸序列,构建了包含该酶编码基因的重组质粒和重组谷氨酸棒状杆菌Corynebacterium glutamicum CGMCC1.15647(pXMJ19-5.7-amp0279)。将该酶在大肠杆菌中异源表达,利用镍柱亲和层析的方法将其纯化,并以Leu-pNA为底物检测纯化蛋白的酶学性质。本发明提供的氨肽酶Amp0279最适反应温度是50℃,最适反应pH为8.0,在40-55℃,pH6.0-9.0范围内酶活力稳定,在加入100μMCo～(2+)后,比酶活力可达35383U/mg,适用于饲料、食品、酿造和医药等工业领域。(The invention discloses a gene and an amino acid sequence of aminopeptidase Amp0279 derived from spherical lysine bacillus C3-41, and constructs a recombinant plasmid containing an enzyme coding gene and recombinant Corynebacterium glutamicum CGMCC1.15647(pXMJ19-5.7-Amp 0279). Heterologously expressing the enzyme in escherichia coli, purifying the escherichia coli by using a nickel column affinity chromatography method, and detecting the enzymology of the purified protein by using Leu-pNA as a substrateAnd (4) quality. The optimum reaction temperature of the aminopeptidase Amp0279 provided by the invention is 50 ℃, the optimum reaction pH is 8.0, the enzyme activity is stable within the range of 40-55 ℃ and pH6.0-9.0, and 100 mu MCo is added 2+ Then, the specific enzyme activity can reach 35383U/mg, and the method is suitable for industrial fields of feed, food, brewing, medicine and the like.)

1. A recombinant plasmid pXMJ19-5.7-Amp0279 comprising the aminopeptidase Amp0279 coding sequence derived from bacillus sphaericus C3-41, wherein: the nucleic acid sequence of the recombinant plasmid pXMJ19-5.7-amp0279 is shown in SEQ ID NO. 4.

2. A recombinant strain comprising the recombinant plasmid pXMJ19-5.7-amp0279 of claim 1.

3. The recombinant strain of claim 2, wherein: the recombinant strain is Corynebacterium glutamicum Glutamicum CGMCC1.15647(pXMJ19-5.7-amp0279), which is stored in China center for type culture Collection with the address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211238, taxonomic name Corynebacterium glutamicum.

4. Use of a recombinant strain according to claim 3 for expressing the product aminopeptidase Amp 0279.

5. The expression product aminopeptidase Amp0279 of claim 4 for use in feed, food, brewing, or medicine.

Technical Field

The invention belongs to the field of protein engineering and genetic engineering, and particularly relates to a recombinant plasmid containing an aminopeptidase Amp0279 coding sequence, a recombinant strain and application.

Background

During food processing processes such as fermentation and aging, proteins can be hydrolyzed into small molecular substances such as polypeptides or amino acids by protease and peptidase, or sensitization epitopes are destroyed, so that sensitization potential is reduced, and the food is more beneficial to human body to take and absorb. Protein hydrolysates are therefore widely used in the food industry. However, the protein hydrolysis process generates bitter peptides, which affect the flavor of food and hinder the popularization of protein hydrolysates. Aminopeptidases (EC 3.4.11.-) are enzymes with debittering effect on protein hydrolysate, and can specifically hydrolyze hydrophobic amino acid residues at the amino terminal of bitter peptide, release one to three amino acids at a time, destroy the structure of bitter peptide and achieve debittering effect. Aminopeptidases are widely present in fungi, animals and plants, are of a wide variety, and are often named subtypes by their localization regions (e.g., cell membrane, cytoplasm). Aminopeptidases can also be classified, like carboxypeptidases, by the active center into serine aminopeptidases, metalloaminopeptidases and cysteine aminopeptidases. More than 70% of aminopeptidases are metalloenzymes, the active center of which contains one or two divalent metal ions, the common metal ion being Zn²⁺、Co²⁺And Mn²⁺Etc., which have a stabilizing effect on the protein structure of the enzyme. Aminopeptidases can also be divided into three classes according to the substrate: one is an aminopeptidase with broad specificity, such as leucyl aminopeptidase, membrane and cytoplasmic alanyl aminopeptidase, and the like; aminopeptidases with narrow specificity, such as aminopeptidase B which prefers basic amino acid substrates, glutamyl-peptidase which prefers acidic amino acid substrates, aspartyl-amido peptidase, cysteinyl-aminopeptidase which prefers specific amino acids, methionine-amido-peptidase, prolinamido-peptidase, etc.; and thirdly, an enzyme for cutting the short peptide with 2-3 amino acids at the amino terminal. Aminopeptidase can be used as windA gustatory protease for debittering of polypeptides during food processing such as baking, brewing and cheese making; in addition, aminopeptidases can be applied to the synthesis of biological peptides and amino acids and are found to be more efficient than chemical synthesis; moreover, aminopeptidases are capable of hydrolysing organophosphorus compounds and are therefore of nutritional, biological and ecological significance. Currently, there are few commercially available aminopeptidases with a single hydrolysis site. The method for mining the new aminopeptidase has important application and popularization values.

Lysinibacillus sphaericus (Lysinibacillus sphaericus) is a spore-forming gram-positive bacterium. Some strains have specific poisoning effect on mosquitoes or capability of inhibiting pathogenic (true) bacteria and even tumor cells and the like; meanwhile, the genus bacteria has special metabolic synthesis capacity and shows wide application prospects in the fields of vector mosquito biological control, energy utilization, plant protection and the like. The spherical lysine bacillus cannot metabolize sugars. Compared with Bacillus cereus and Bacillus subtilis, the polypeptide has more abundant amino acid transport and metabolism coding genes. And the mosquito-killing toxin protein expressed in the wild strain is dominant, and the yield of other proteins is less. Therefore, it is speculated that the amino acid related protease may have higher activity and meet the metabolic demand of the protease on the amino acid. Therefore, the aminopeptidase-encoding gene of Bacillus lysinibacillus sphaericus can be utilized.

Disclosure of Invention

According to the invention, aminopeptidase coding gene amp0279 derived from Bacillus lysinibacillus sphaericus is constructed into an Escherichia coli expression vector to obtain a recombinant plasmid pET28a-amp0279, a recombinant strain BL21(pET28a-amp0279) is obtained after Escherichia coli is transformed, the enzyme expressed by secretion is purified, Leu-pNA is used as a substrate, the enzymatic property is detected by using a p-nitroaniline method, and the optimal reaction condition is determined. Considering that the Escherichia coli expression system needs complicated, time-consuming and cost-increasing purification and label removal procedures, the secretory expression system of aminopeptidase Amp0279 is further developed, and more excellent recombinant plasmids and recombinant strains are obtained, which are described in the following.

A recombinant plasmid pXMJ19-5.7-Amp0279 containing an aminopeptidase Amp0279 coding sequence derived from Bacillus sphaericus Lysinicus C3-41 is shown in SEQ ID NO. 4, and the nucleic acid sequence of the recombinant plasmid pXMJ19-5.7-Amp0279 is shown in SEQ ID NO. 4.

And a recombinant strain comprising the recombinant plasmid pXMJ19-5.7-amp0279 of claim 1.

The recombinant strain is Corynebacterium glutamicum Glutamicum CGMCC1.15647(pXMJ19-5.7-amp0279), which is stored in China center for type culture Collection with the address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211238, taxonomic name Corynebacterium glutamicum.

And the application of the recombinant strain in expressing the product aminopeptidase Amp 0279.

And the application of the expression product aminopeptidase Amp0279 in feed, food, brewing or medicine.

The beneficial effect of this scheme lies in: 1. through means such as bioinformatics prediction, vector construction by genetic engineering technology, biochemical analysis and the like, the aminopeptidase Amp0279 gene sequence derived from the spherical lysine bacillus C3-41 is obtained;

2. constructing an aminopeptidase encoding gene amp0279 derived from the lysinibacillus sphaericus into an escherichia coli expression vector to obtain a recombinant plasmid pET28a-amp0279, and transforming escherichia coli to obtain a recombinant strain BL21(pET28a-amp 0279);

3. after purifying the enzyme expressed by secretion, Leu-pNA is used as a substrate, and the enzymatic property is detected by using a p-nitroaniline method to determine the optimal reaction condition. Finally, the aminopeptidase Amp0279 provided by the invention is determined to belong to a novel Co family of M29²⁺The dependent aminopeptidase has optimum reaction temperature of 50 deg.C, optimum reaction pH of 8.0, stable enzyme activity at 40-55 deg.C and pH of 6.0-9.0, and is added with 100 μ MCo²⁺Then, the specific enzyme activity can reach 35383U/mg, and the method is suitable for the industrial fields of feed, food, brewing, medicine and the like;

4. meanwhile, in consideration of the complicated, time-consuming and cost-increasing purification and label removal process required by an Escherichia coli expression system, the invention further develops a secretion expression system of aminopeptidase Amp0279 to obtain a more excellent recombinant plasmid pXMJ19-5.7-Amp0279 and a recombinant strain Corynebacterium glutamicum CGMCC1.15647(pXMJ19-5.7-Amp 0279).

Drawings

FIG. 1 Amp0279 amino acid sequence alignment

FIG. 2 Amp0279 three-dimensional Structure drawing (SWISS MODEL)

FIG. 3 detection of Amp0279 after purification

FIG. 4 Amp0279 optimum temperature analysis

FIG. 5 Amp0279 optimum pH analysis

FIG. 6 Amp0279 thermal stability analysis

FIG. 7 Amp0279 pH stability assay

FIG. 8 Effect of different Metal ions and EDTA on Amp0279 Activity

FIG. 9 different concentrations of Co²⁺Effect on Amp0279 Activity

FIG. 10 Western blot for detecting Amp0279 secretion expression in genetically engineered strain CGMCC1.15647(pXMJ19-5.7-Amp0279)

FIG. 11 detection of secreted Amp0279 crude enzyme activity.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings and examples, and the present invention is not limited to the examples.

The gene encoding aminopeptidase Amp0279 was predicted in the genome of Bacillus lysinibacillus globiformis C3-41: the nucleic acid sequence is shown as SEQ ID NO. 1.

The corresponding amino acid sequence is shown in SEQ ID NO. 2.

Passing amp0279 full gene through primer pair

P6-F:CGCGGATCCATGACGTTTGAAGAAAAATTAC

P6-R:CGCGAGCTCTTAGAAAGCCCAGCTACCT

Amplified from the C3-41 genome, and the amp0279 gene is inserted into an expression vector pET28a through double digestion and connection to construct a recombinant expression plasmid pET28a-amp 0279.

The nucleic acid sequence of the recombinant plasmid pET28a-amp0279 is shown in SEQ ID NO 3. (the sequence of bold letters is the sequence of amp0279 inserted in pET28 a).

The recombinant plasmid is transformed into escherichia coli BL21 competent cells, a positive clone bacterial strain is screened out by a PCR verification method, and the plasmid is extracted for further sequencing verification. This procedure yielded the recombinant strain E.coli BL21(pET28a-amp 0279).

The aminopeptidase Amp0279 producing genetic engineering strain BL21(pET28a-Amp0279) provided by the invention is used for purifying the expressed aminopeptidase by a nickel column affinity chromatography and detecting the enzymological property.

The specific aminopeptidase Amp0279 gene sequence obtaining method, the recombinant plasmid and recombinant strain construction method, the product aminopeptidase Amp0279 property analysis method and the application condition analysis method are as follows:

experimental materials:

1) strains and plasmids: bacillus sphaericus C3-41, Escherichia coli JM109 and BL21, Corynebacterium glutamicum CGMCC 1.15647; pET28a and pXMJ 19-5.7.

2) Enzymes and kits: restriction enzymes (NEB), Golden Mix (Scirpus), Rapid Tag Master Mix (Vazyme), T4 DNA ligase (NEB); DNA purification Kit (Omega), FastPerure Plasmid Mini Kit (Vazyme), PAGE gel Rapid preparation Kit (10%) (Shanghai Yazyme biomedical science and technology Co., Ltd.), BCA Kit (Takara), protein dye (Biosharp), and protein affinity chromatography Nickel column (Ni-Sepharose TM 6Fast Flow, GE healthcare, US); a tool enzyme (TaKaRa) such as in-fusion ligase; Cycle-Pure Kit and Gel Extraction Kit (Omega Bio-Tek); prestained Protein Ladder 26616 (seimer feishel technologies (china) ltd);Western(Millipore，USA)。

3) biochemical reagents: isoproyl-beta-D-thiogalactoside (IPTG); kanamycin; chloromycetin

50mM disodium phosphate-citric acid buffer: after preparing 50mM disodium hydrogen phosphate solution, adjusting pH (3.0-5.0) with 0.1M citric acid solution; the 10 XTSST buffer was purchased from Beijing Solaibao Tech Co., Ltd; tryptone (Tryptone), yeast extract was purchased from seimer feishell scientific; SDS, Tris purchased from Beijing Byeldi Biotechnology, Inc.; glycerol, acetic acid, hydrochloric acid, sodium chloride, magnesium chloride and calcium chloride are purchased from national medicine group limited company; Leu-pNA was purchased from SIGMA-ALDRICH; the skimmed milk powder is purchased from Beijing Lei Gen Biotechnology Co.

Solution required by a p-nitroaniline method:

substrate 200mM Leu-pNA: prepared by DMSO, 0.063g Leu-pNA is dissolved in 1250 mu L DMSO, and 50 mu L is subpackaged.

Reaction termination solution: 40% (v/v) glacial acetic acid, 160mL acetic acid, and 400mL of ultra pure water.

Reaction buffer: Tris-HCl pH 8.050 mM, 1.2114g was dissolved in 200mL of ultrapure water.

50mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution: respectively preparing 0.1M disodium hydrogen phosphate solution and sodium dihydrogen phosphate solution, mixing at a certain proportion, adjusting pH to 6.0 and 7.0, adding equal volume of ultrapure water to adjust to concentration of 50mM

50mM Tris-HCl buffer: preparing 50mM Tris solution, adding concentrated hydrochloric acid to adjust pH (8.0-9.0)

50mM glycine-sodium hydroxide buffer: with 50mM glycine solution, adjusting the pH (10.0-11.0) with 5M sodium hydroxide solution

Metal ion solution mother liquor: 10mL of ultrapure water was used for preparation

1M K⁺Solution: 0.7455g of KCl;

100mM Na⁺solution: 0.0584g NaCl;

100mM Mg²⁺solution: 0.2033g MgCl₂·6H₂O；

100mM Ca²⁺Solution: 0.1010g CaCl₂；

100mM Mn²⁺Solution: 0.1258g MnCl₂；

100mM Cu²⁺Solution: 0.1705g CuCl₂·2H₂O；

100mM Zn²⁺Solution: 0.288g of ZnSO₄·7H₂O；

100mM Fe²⁺Solution: 0.278g FeSO₄·7H₂O；

100mM Co²⁺Solution: 0.2379gCoCl₂·6H₂O。

100mM EDTA：0.3722g EDTA。

The experimental procedures in the following examples are conventional unless otherwise specified.

The percentages in the following examples are by mass unless otherwise specified.

Example 1: aminopeptidase Amp0279 Structure and function prediction and Gene sequence acquisition

According to the genome sequence (CP000817) of the Bacillus lysinibacillus globiformis C3-41, the protein Amp0279 encoded by the Amp0279 gene (300199..301428) is predicted to be possibly aminopeptidase. Sequence alignment found the amino acid sequence of Amp0279 to have the highest similarity (51%) to AmpS encoded by bacillus subtilis (see fig. 1). 3D modeling analysis found it to be a dimeric structure with four cobalt ion binding sites, probably belonging to the M29 family (see FIG. 2). FIG. 2 is an Amp 02793D structural MODEL (SWISS-MODEL). Amp0279 is a homodimer. The left side in the figure is chain A, the right side is chain B, 4Co²⁺The active center is marked as a dot. The predicted 6 active sites (GLU 249, GLU 315, HIS 344, TYR 351, HIS 377 and ASP 379) surround two Co on chain A²⁺. Designing primers with enzyme cutting sites BamHI and SacI according to the gene sequence, amplifying the gene from the genome, and purifying.

Example 2: construction of recombinant expression plasmid pET28a-Amp0279 and recombinant bacterium BL21(pET28a-Amp0279) containing aminopeptidase Amp0279 gene

Restriction enzyme BamHI and SacI sites are respectively introduced into the 5 'end and the 3' end of the aminopeptidase Amp0279 gene, the restriction enzymes BamHI and SacI are used for completing double enzyme digestion of the aminopeptidase Amp0279 gene and an Escherichia coli inducible expression vector pET28a, and then the two are connected by using ligase to construct a recombinant expression plasmid pET28a-Amp 0279. The recombinant expression plasmid is transformed into escherichia coli BL21 competent cells, a positive clone strain BL21(pET28a-amp0279) is screened out by a PCR verification method, and plasmid sequencing verification is extracted.

Example 3: purification of aminopeptidase Amp0279 by Nickel column affinity chromatography

The recombinant strain was inoculated into 5mL LB (50. mu.g/mL kanamycin) and cultured overnight at 37 ℃ and 220rpm to obtain a seed solution. Adding the seed solution into fresh LB culture medium (50. mu.g/mL kanamycin) according to the ratio of 1:100, and culturing for about 3h to OD₆₀₀When the concentration is 0.6 to 0.8, IPTG (final concentration of 1mM) is added to the mixture, and the mixture is slowly induced at a low temperature (25 ℃ C., 160rpm) for about 5 hours. The strain was collected by centrifugation (5000g, 10min) and the supernatant was discarded. The thalli is broken by ultrasonic, at 4 ℃, 12000g, the supernatant is kept for protein nickel column affinity chromatography after 30min of centrifugation. After dialysis, protein concentration was measured with BCA kit. A single band of about 55kD was detected by SDS-PAGE to obtain a known concentration of pure aminopeptidase Amp0279 (see FIG. 3 for Amp0279 after purification).

Example 4: property analysis of aminopeptidase Amp0279

The enzyme activity of the aminopeptidase is detected by a p-nitroaniline method, and a substrate used in the method is Leu-pNA. Preparing 800 mu L reaction liquid from 1mM substrate Leu-pNA, 10 ng/mu L Amp0279 and reaction buffer solution, reacting for 1h, adding 200 mu L of 40% (v/v) glacial acetic acid to terminate the reaction, detecting the absorbance at 405nm, and judging the substrate hydrolysis condition and the substrate hydrolysis capacity of the enzyme. The aminopeptidase activity was measured in 50mM Tris-HCl buffer (pH 8.0) at 30-80 ℃ to examine the optimum temperature for the reaction (FIG. 4). Amp0279 aminopeptidase activity was tested under reaction buffer conditions of varying pH (FIG. 5). Through the above detection, the conditions of 50 ℃ and pH8.0 are determined as the optimal conditions. U is defined as the amount of enzyme that hydrolyzes the substrate Leu-pNA at 50 ℃ and pH8.0 to yield 1. mu. mol pNA per minute. The purified enzyme was incubated at different temperatures (40-80 ℃) for 2h and then cooled to room temperature. Residual activity was measured at 50 ℃, ph8.0 and Amp0279 thermal stability was evaluated (fig. 6). The enzyme was incubated with different buffers (pH 5.0-10.0 as described above) at 4 ℃ for 2h, and the residual activity was measured at pH8.0, 50 ℃ to assess its pH stability (FIG. 7). Detecting the effect of metal ions and metal ion chelating agent EDTA on Amp0279 enzyme activity (FIG. 8), adding 1mM K to the reaction system under optimum temperature and pH conditions⁺、Na⁺、Mg²⁺、Cu²⁺、Zn²⁺、Fe²⁺、Mn²⁺、Co²⁺Or EDTA, and the absorbance is detected after 1 h.Then, different concentrations of Co were investigated²⁺Influence on the enzyme activity (FIG. 9), Co was added to the reaction system at various concentrations²⁺And measuring the enzyme activity.

Through the above analysis, it was found that Amp0279 is optimally stable in enzyme activity at 50 ℃ and pH8.0, at 40-55 ℃ and pH6.0-9.0, and is optimally stabilized by adding 100. mu.M Co²⁺Then, the specific enzyme activity can reach 35383U/mg.

Example 5: comparison of enzyme Activity of aminopeptidase Amp0279 with commercial flavor enzymes

Adding flavor enzyme (A), (B), (C)Shanghai-derived leaf Biotechnology Co., Ltd., LOT: P29F11B109057) powder was dissolved in a buffer (20mM Tris, 200mM NaCl, pH 8.0) as a stock solution (400. mu.g/mL), and then the protein content was measured using a BCA protein assay kit (TaKaRa Biotech, Japan). The enzyme activity was determined as in example 4, under the conditions including general conditions (usually at 30 ℃ C., pH7.5) and optimized conditions for Amp0279 (50 ℃ C., pH8.0, 100. mu.M Co)²⁺). The results show that Co is not added²⁺Under the optimized condition, Amp0279 has specific enzyme activity of about1/40(1024Vs.42249U/mg), and 100. mu.M Co was added²⁺Under the condition, the activity of Amp0279 is obviously increased and can reach 35383U/mg which is slightly higher than(33663U/mg) (see Table 1).

TABLE 1 Amp0279 and commercial flavor enzymesComparing enzyme activity of (1).

Wherein, a, the conversion of specific enzyme activity is carried out according to the protein content measured after the flavor enzyme powder is dissolved

General conditions

Optimization condition of Amp0279

On the basis of the verification of Escherichia coli BL21, the invention further develops a secretory expression system of aminopeptidase Amp0279 in consideration of the fact that an Escherichia coli expression system requires a complicated, time-consuming and cost-increasing purification and label-removal process. Corynebacterium glutamicum (Corynebacterium glutamicum) is a potential foreign protein expression host, and the expression system has several advantages: (1) the foreign protein can be secreted to the extracellular part and exists in the supernatant of the culture medium as the most main protein component, so that the downstream protein purification process can be simplified; (2) the oxidative environment of the extracellular medium is suitable for the formation of disulfide bonds, thereby further promoting protein folding and expression of active protein forms; (3) the extracellular protease content is low, so that the stability and the yield of the secreted protein are improved; (4) no endotoxin was produced. Corynebacterium glutamicum is also a GRAS strain, and can be used for producing microbial enzymes in addition to producing strains of amino acids and organic acids. Therefore, the method is favorable for further obtaining more excellent recombinant plasmids and recombinant strains.

Corynebacterium glutamicum Glutamicum CGMCC1.15647(pXMJ19-5.7-amp0279), which is deposited in the China center for type culture Collection with the address: china, wuhan university; the zip code 430072 has a preservation date of 2021, 9 months and 29 days, and has a preservation number of: CCTCC NO: m20211238, taxonomic name Corynebacterium glutamicum.

The construction of recombinant plasmid and recombinant corynebacterium glutamicum, the secretion expression of Amp0279 and the crude enzyme biopsy of the expression product aminopeptidase Amp0279 are as follows:

construction of pXMJ19-5.7-amp0279 constitutive recombinant plasmid:

using C.glutamicum CGMCC1.15647 genome as template and primer pair

cspB2F(TCCCACTACCGAGATATCCTTGAATAATAATTGCACCGCACAGGTGATACATG)/cspR_A-6(TTCTTCAAACGTCATAGTGGTTTCCTGAGCGAATGCTG)

Amplifying the promoter and signal peptide sequence of cspB2 gene using primer set

Cg-6-F (GCTCAGGAAACCATATGACGTTTGAAGAAAATTAC)/Cg-6-R (AAAACAGCCAAGCTGAATTCTTAGAAAGCCCAGCTACT) amplifications of amp0279 gene sequence from C3-41 genome, and after endogenous expression original cspB2 and aminopeptidase gene amp0279 are connected by in-fusion and overlap methods, the target gene is inserted into EcoRI/EcoR V linearized vector of pXMJ 19. The ligation product was transformed into E.coli JM 109. Positive clones were screened by PCR and plasmids were extracted for further sequencing validation. The recombinant expression plasmid obtained was pXMJ19-5.7-amp 0279. The nucleic acid sequence is shown as SEQ ID NO. 4.

The recombinant expression plasmid pXMJ19-5.7-amp0279 is transformed into corynebacterium glutamicum CGMCC1.15647 competent cells, and a positive clone strain is screened out by a PCR verification method. The aminopeptidase secreted and expressed by the obtained genetic engineering strain CGMCC1.15647(pXMJ19-5.7-Amp0279) for producing the aminopeptidase Amp0279 directly detects the enzyme activity.

The specific embodiment is as follows:

example 6: construction of recombinant expression plasmid pXMJ19-5.7-amp0279 containing amp0279 Gene

Designing a primer with an overlap joint according to an amp0279(300199..301428) gene sequence predicted by a genome sequence (CP000817) of the Bacillus lysinibacillus globiformis C3-41, amplifying the fragment from a genome, and purifying to obtain an aminopeptidase coding gene amp0279 fragment; and (3) amplifying a promoter and a signal peptide sequence of the cspB2 gene containing the overlap joint by using the C.glutamcum CGMCC1.15647 genome as a template. Double digestion of the secretory expression vector pXMJ19 was accomplished using the restriction enzymes EcoRI and EcoRV. The constitutive expression plasmid pXMJ19-5.7-amp0279 was constructed with in-fusion ligase. Escherichia coli JM109 competent cells were transformed with the recombinant expression plasmid, and a positive clone strain JM109(pXMJ19-5.7-amp0279) was selected by PCR. The cultivation temperature of E.coli was 37 ℃ and the chloramphenicol concentration was 25. mu.g/mL.

Example 7: construction of recombinant expression strain CGMCC1.15647(pXMJ19-5.7-Amp0279) containing aminopeptidase Amp0279 gene

Strain JM109(pXMJ19-5.7-amp0279) of example 6 was cultured in LB liquid medium for activation, and recombinant plasmid pXMJ19-5.7-amp0279 was extracted. The preparation method of the corynebacterium glutamicum competence is the prior method. Melting Corynebacterium glutamicum competent cells on ice, adding about 1 μ g of plasmid into the competent cells, mixing, performing ice bath, regulating voltage of an electrotransformation apparatus to 2.5KV for 4.5-5ms, and performing electric shock for 1 time; adding 1mL of LBHIS liquid culture medium preheated at 46 ℃ into an electric rotating cup, uniformly mixing, transferring the mixture into an EP (ethylene propylene glycol) tube, and accurately incubating for 6min at 46 ℃; incubating for 1.5h at 30 ℃ and 110 rpm; centrifuging at 7000g for 2 min; the precipitated cells were blown out with 100. mu.L of 150. mu.L of a raffinate and spread on a solid LBHIS medium containing chloramphenicol, and the transformants were grown by culturing at 30 ℃ for about 36 hours. The culture temperature of Corynebacterium glutamicum was 30 ℃ and the chloramphenicol concentration was 10. mu.g/mL.

Example 8: detecting the secretory expression condition of Amp0279 in recombinant strain CGMCC1.15647(pXMJ19-5.7-Amp0279)

The Corynebacterium glutamicum strain is inoculated into LB liquid culture medium, cultured overnight, transferred into fresh 50mL culture medium according to the proportion of 1:10, and cultured for 32 h. Taking 1mL of bacterial liquid, centrifuging for 10min at 12000g/min, and respectively collecting supernatant of fermentation liquor and thalli. And washing the thalli for 2 times by Tris-HCL, and then carrying out ultrasonic wave crushing on ice. The supernatant after disruption, the precipitate and the supernatant of the fermentation broth were all examined by SDS-PAGE. The expression of Amp0279 was analyzed by Western Blot using antiserum raised from mice immunized with Amp0279 protein expressed and purified from BL21(pET28-Amp0279-BL 21). The results showed that significant expression hybridization signals were detected in the supernatant of CGMCC1.15647(pXMJ19-5.7-amp0279) medium (FIG. 10). In the figure, M: prestained Protein Ladder 26616; +: amp0279 protein expressed from BL21(pET28-Amp0279-BL21) and purified; 1 and 2 are CGMCC1.15647(pXMJ19-5.7) and CGMCC1.15647(pXMJ19-5.7-amp0279) culture medium supernatant; 3 and 4 are CGMCC1.15647(pXMJ19-5.7) and CGMCC1.15647(pXMJ19-5.7-amp0279), and the supernatant is obtained after ultrasonic disruption and centrifugation; 5 and 6 are cell debris after ultrasonication and centrifugation of CGMCC1.15647(pXMJ19-5.7) and CGMCC1.15647(pXMJ19-5.7-amp0279), respectively.

Example 9: detecting the activity of the supernatant enzyme of a bacterial culture medium of the recombinant bacteria CGMCC1.15647(pXMJ19-5.7-amp0279)

The enzyme activity of the aminopeptidase is detected by a p-nitroaniline method, and the used substrate is Leu-pNA. And (4) centrifuging the bacterial culture solution, measuring the wet weight of the bacterial precipitate, collecting the supernatant, and performing enzyme activity detection. 1mM substrate Leu-pNA, 100. mu.M Co²⁺200 mul of supernatant and reaction buffer are prepared into 800 mul of reaction liquid, the reaction liquid is placed at 50 ℃ and pH8.0 for 1h, 200 mul of 40% (v/v) glacial acetic acid is added to stop the reaction, and the absorbance at the wavelength of 405nm is detected to indicate the hydrolysis condition of the substrate and the capability of enzyme to hydrolyze the substrate. The unit μ M/g is defined as the μ M value of Leu-pNA hydrolyzed by wet weight per gram of bacteria. The results showed that, without concentration and purification, the activity of the enzyme (pNA amount released per g wet weight of the culture broth of the reaction system was 20-40. mu.M) could be detected from the culture supernatant of the recombinant bacteria (FIG. 11), in which the white column is the detection of Amp0279 crude enzyme secreted and expressed by Corynebacterium glutamicum Glutaminum CGMCC1.15647(pXMJ19-5.7-Amp 0279).

It is also noted that in the sequence SEQ ID NO:4 of pXMJ19-5.7-amp0279, the first italicized part is the signal peptide and promoter sequence, the middle capital part is the amp0279 sequence, and the latter lower case part is the pXMJ19-5.7 vector sequence.

atAatCgcaccgcacaggtgatacatacttacctcctcaagtagtccgaggttaagtgtgttttaggtgaacaaatttcagtttcaggtagaaaactttcgacccgcttcagagtttctattagtaaatctgacaccacttgattaaatggtctacccccgaattgggggatgggttattttttgctatgaacgtagttttggtgcatatgacctgcgtttataaagaaatataaacgtgatcagatcgatataaaagaaacagtttgtactcaggtttgaagctttttcttcgattcgcctggcaagaatctcaattgtcgcttacagtttttctcaacgacaggctgctaagctgctagttcggtggcctagtgagtggcgtttacttgaatgaaaagtaatcccatgtcgtgatcagccaatttgggttgtgtcaaagcaattcaaaggtttcatctttcgatatcctattcaaggagaccctcgcctctatgtttaacaatcgtatccgcactgcagctctcgctggtgcaatcgcaatctccaccgcagcttccggacttgttgttccagcattcgctcaggaaaccactATGACGTTTGAAGAAAAATTACAGGCATACGCGGAACTTGCAGTAAAAGTTGGGGTAAACATTCAACCAGGTCAATATTTGTTAGTCAACACATCAGTTGAGGCTTTAGATTTTGCTCGTTTAGTCGTTAAAGAGGCGTATAAGGCTGGGGCAGGGCGTGTCCATGTTAATTTTTCTGACGATGAAATGGATCGTGCCTATTTTGAACATGCCTCTGATGAAGAATTTAACCGTTTCCCCGAATGGGTCGTACAAATGCGTGATGAACTCATTGAACGTAAAGGGGCATTATTATGGATAGATGCCGCAGATCCTGATAAATTAACAGGAATCTCGGCTGATCGATTAGCTACTCATCAAAAGGTATCAGGAGCTGCGTTGAAAAACTATCGTAATGCAGTTATGAAGGATTTGATTGCGTGGTCCATTATTGCAGTACCTTCGCCAAAGTGGGCGGCAAAGGTATTCCCTCAATTGACAGCAGACGAGCAAGTACCTGCTTTATGGGAAGCTATCTTTAAAACAGTTCATATCGGAGAAGGTAACGCAGTTGAAAATTGGCATCAGCATGTAACGAATTTAGAATCTCGGGCAGAACTTTTAAATAATAAAAAGTATGCGAAGCTACACTATACTGCACCTGGAACAGATTTAACGATTGCTTTAGCTCCACAGCATAAATGGGTAACTGGTGGCAGTAAAACGCCTGAAGGCCATGTTTTTATCGCCAATATGCCAACAGAAGAAGTCTATACACTTCCTATGAAGCAAGGTGTAGACGGTTATGTTAGTAATTCAAAGCCTTTAGTATATCAGGGCAATATCATTGATGGCTTTAAATTAACATTTAAAGAAGGAAAAATCATTAAAGCAGAAGCTGAAGTAGGTCAAGATTTACTACAGGAGCTTATTCAAGTAGATGAGGGTTCTAGTTATTTAGGTGAAGTAGCACTTGTCCCGCATGAGTCACCAATTTCAGCATCAGGGATTTTATACTTTAATACACTATTCGATGAGAATGCTTCGAACCATTTAGCGATTGGAGAAGCATACCCGACATGCTTAGAGGGTGGTAGAGACTTGGAAAACGGTCAACTAGAAGCATTAGGTGCGAATATTTCTGTAACCCATGAAGACTTTATGGTTGGTAACGGTGAAATGGACATTGATGGTATATTACCAGATGGAACTATAGAGCCTATATTCCGTAAAGGTAGCTGGGCTTTCTAAaattcagcttggctgttttggcggatgagagaagattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggggtgggcgaagaactccagcatgagatccccgcgctggaggatcatccagccattcggggtcgttcactggttcccctttctgatttctggcatagaagaacccccgtgaactgtgtggttccgggggttgctgatttttgcgagacttctcgcgcaattccctagcttaggtgaaaacaccatgaaacactagggaaacacccatgaaacacccattagggcagtagggcggcttcttcgtctagggcttgcatttgggcggtgatctggtctttagcgtgtgaaagtgtgtcgtaggtggcgtgctcaatgcactcgaacgtcacgtcatttaccgggtcacggtgggcaaagagaactagtgggttagacattgttttcctcgttgtcggtggtggtgagcttttctagccgctcggtaaacgcggcgatcatgaactcttggaggttttcaccgttctgcatgcctgcgcgcttcatgtcctcacgtagtgccaaaggaacgcgtgcggtgaccacgacgggcttagcctttgcctgcgcttctagtgcttcgatggtggcttgtgcctgcgcttgctgcgcctgtagtgcctgttgagcttcttgtagttgctgttctagctgtgccttggttgccatgctttaagactctagtagctttcctgcgatatgtcatgcgcatgcgtagcaaacattgtcctgcaactcattcattatgtgcagtgctcctgttactagtcgtacatactcatatttacctagtctgcatgcagtgcatgcacatgcagtcatgtcgtgctaatgtgtaaaacatgtacatgcagattgctgggggtgcagggggcggagccaccctgtccatgcggggtgtggggcttgccccgccggtacagacagtgagcaccggggcacctagtcgcggataccccccctaggtatcggacacgtaaccctcccatgtcgatgcaaatctttaacattgagtacgggtaagctggcacgcatagccaagctaggcggccaccaaacaccactaaaaattaatagtccctagacaagacaaacccccgtgcgagctaccaactcatatgcacgggggccacataacccgaaggggtttcaattgacaaccatagcactagctaagacaacgggcacaacacccgcacaaactcgcactgcgcaaccccgcacaacatcgggtctaggtaacactgagtaacactgaaatagaagtgaacacctctaaggaaccgcaggtcaatgagggttctaaggtcactcgcgctagggcgtggcgtaggcaaaacgtcatgtacaagatcaccaatagtaaggctctggcggggtgccataggtggcgcagggacgaagctgttgcggtgtcctggtcgtctaacggtgcttcgcagtttgagggtctgcaaaactctcactctcgctgggggtcacctctggctgaattggaagtcatgggcgaacgccgcattgagctggctattgctactaagaatcacttggcggcgggtggcgcgctcatgatgtttgtgggcactgttcgacacaaccgctcacagtcatttgcgcaggttgaagcgggtattaagactgcgtactcttcgatggtgaaaacatctcagtggaagaaagaacgtgcacggtacggggtggagcacacctatagtgactatgaggtcacagactcttgggcgaacggttggcacttgcaccgcaacatgctgttgttcttggatcgtccactgtctgacgatgaactcaaggcgtttgaggattccatgttttcccgctggtctgctggtgtggttaaggccggtatggacgcgccactgcgtgagcacggggtcaaacttgatcaggtgtctacctggggtggagacgctgcgaaaatggcaacctacctcgctaagggcatgtctcaggaactgactggctccgctactaaaaccgcgtctaaggggtcgtacacgccgtttcagatgttggatatgttggccgatcaaagcgacgccggcgaggatatggacgctgttttggtggctcggtggcgtgagtatgaggttggttctaaaaacctgcgttcgtcctggtcacgtggggctaagcgtgctttgggcattgattacatagacgctgatgtacgtcgtgaaatggaagaagaactgtacaagctcgccggtctggaagcaccggaacgggtcgaatcaacccgcgttgctgttgctttggtgaagcccgatgattggaaactgattcagtctgatttcgcggttaggcagtacgttctcgattgcgtggataaggctaaggacgtggccgctgcgcaacgtgtcgctaatgaggtgctggcaagtctgggtgtggattccaccccgtgcatgatcgttatggatgatgtggacttggacgcggttctgcctactcatggggacgctactaagcgtgatctgaatgcggcggtgttcgcgggtaatgagcagactattcttcgcacccactaaaagcggcataaaccccgttcgatattttgtgcgatgaatttatggtcaatgtcgcgggggcaaactatgatgggtcttgttgttggcgtcccggaaaacgattccgaagcccaacctttcatagaaggcggcggtggaatcgaaatctcgtgatggcaggttgggcgtcgcttggtcggtcatttcgaagggcaccaataactgccttaaaaaaattacgccccgccctgccactcatcgcagtactgttgtaattcattaagcattctgccgacatggaagccatcacagacggcatgatgaacctgaatcgccagcggcatcagcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaatcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccaggttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcgatgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttcattgccatacggaactccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatttttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatgcctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttccttagctcctgaaaatctcgtcgaagctcggcggatttgtcctactcaagctgatccgacaaaatccacacattatcccaggtgtccggatcggtcaaatacgctgccagctcatagaccgtatccaaagcatccggggctgatccccggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgtggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagat

Sequence listing

<110> university of the south China nationality

<120> recombinant plasmid containing aminopeptidase Amp0279 coding sequence, recombinant corynebacterium glutamicum and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1230

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgacgtttg aagaaaaatt acaggcatac gcggaacttg cagtaaaagt tggggtaaac 60

attcaaccag gtcaatattt gttagtcaac acatcagttg aggctttaga ttttgctcgt 120

ttagtcgtta aagaggcgta taaggctggg gcagggcgtg tccatgttaa tttttctgac 180

gatgaaatgg atcgtgccta ttttgaacat gcctctgatg aagaatttaa ccgtttcccc 240

gaatgggtcg tacaaatgcg tgatgaactc attgaacgta aaggggcatt attatggata 300

gatgccgcag atcctgataa attaacagga atctcggctg atcgattagc tactcatcaa 360

aaggtatcag gagctgcgtt gaaaaactat cgtaatgcag ttatgaagga tttgattgcg 420

tggtccatta ttgcagtacc ttcgccaaag tgggcggcaa aggtattccc tcaattgaca 480

gcagacgagc aagtacctgc tttatgggaa gctatcttta aaacagttca tatcggagaa 540

ggtaacgcag ttgaaaattg gcatcagcat gtaacgaatt tagaatctcg ggcagaactt 600

ttaaataata aaaagtatgc gaagctacac tatactgcac ctggaacaga tttaacgatt 660

gctttagctc cacagcataa atgggtaact ggtggcagta aaacgcctga aggccatgtt 720

tttatcgcca atatgccaac agaagaagtc tatacacttc ctatgaagca aggtgtagac 780

ggttatgtta gtaattcaaa gcctttagta tatcagggca atatcattga tggctttaaa 840

ttaacattta aagaaggaaa aatcattaaa gcagaagctg aagtaggtca agatttacta 900

caggagctta ttcaagtaga tgagggttct agttatttag gtgaagtagc acttgtcccg 960

catgagtcac caatttcagc atcagggatt ttatacttta atacactatt cgatgagaat 1020

gcttcgaacc atttagcgat tggagaagca tacccgacat gcttagaggg tggtagagac 1080

ttggaaaacg gtcaactaga agcattaggt gcgaatattt ctgtaaccca tgaagacttt 1140

atggttggta acggtgaaat ggacattgat ggtatattac cagatggaac tatagagcct 1200

atattccgta aaggtagctg ggctttctaa 1230

<210> 2

<211> 409

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Thr Phe Glu Glu Lys Leu Gln Ala Tyr Ala Glu Leu Ala Val Lys

1 5 10 15

Val Gly Val Asn Ile Gln Pro Gly Gln Tyr Leu Leu Val Asn Thr Ser

20 25 30

Val Glu Ala Leu Asp Phe Ala Arg Leu Val Val Lys Glu Ala Tyr Lys

35 40 45

Ala Gly Ala Gly Arg Val His Val Asn Phe Ser Asp Asp Glu Met Asp

50 55 60

Arg Ala Tyr Phe Glu His Ala Ser Asp Glu Glu Phe Asn Arg Phe Pro

65 70 75 80

Glu Trp Val Val Gln Met Arg Asp Glu Leu Ile Glu Arg Lys Gly Ala

85 90 95

Leu Leu Trp Ile Asp Ala Ala Asp Pro Asp Lys Leu Thr Gly Ile Ser

100 105 110

Ala Asp Arg Leu Ala Thr His Gln Lys Val Ser Gly Ala Ala Leu Lys

115 120 125

Asn Tyr Arg Asn Ala Val Met Lys Asp Leu Ile Ala Trp Ser Ile Ile

130 135 140

Ala Val Pro Ser Pro Lys Trp Ala Ala Lys Val Phe Pro Gln Leu Thr

145 150 155 160

Ala Asp Glu Gln Val Pro Ala Leu Trp Glu Ala Ile Phe Lys Thr Val

165 170 175

His Ile Gly Glu Gly Asn Ala Val Glu Asn Trp His Gln His Val Thr

180 185 190

Asn Leu Glu Ser Arg Ala Glu Leu Leu Asn Asn Lys Lys Tyr Ala Lys

195 200 205

Leu His Tyr Thr Ala Pro Gly Thr Asp Leu Thr Ile Ala Leu Ala Pro

210 215 220

Gln His Lys Trp Val Thr Gly Gly Ser Lys Thr Pro Glu Gly His Val

225 230 235 240

Phe Ile Ala Asn Met Pro Thr Glu Glu Val Tyr Thr Leu Pro Met Lys

245 250 255

Gln Gly Val Asp Gly Tyr Val Ser Asn Ser Lys Pro Leu Val Tyr Gln

260 265 270

Gly Asn Ile Ile Asp Gly Phe Lys Leu Thr Phe Lys Glu Gly Lys Ile

275 280 285

Ile Lys Ala Glu Ala Glu Val Gly Gln Asp Leu Leu Gln Glu Leu Ile

290 295 300

Gln Val Asp Glu Gly Ser Ser Tyr Leu Gly Glu Val Ala Leu Val Pro

305 310 315 320

His Glu Ser Pro Ile Ser Ala Ser Gly Ile Leu Tyr Phe Asn Thr Leu

325 330 335

Phe Asp Glu Asn Ala Ser Asn His Leu Ala Ile Gly Glu Ala Tyr Pro

340 345 350

Thr Cys Leu Glu Gly Gly Arg Asp Leu Glu Asn Gly Gln Leu Glu Ala

355 360 365

Leu Gly Ala Asn Ile Ser Val Thr His Glu Asp Phe Met Val Gly Asn

370 375 380

Gly Glu Met Asp Ile Asp Gly Ile Leu Pro Asp Gly Thr Ile Glu Pro

385 390 395 400

Ile Phe Arg Lys Gly Ser Trp Ala Phe

405

<210> 3

<211> 6593

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac 5100

agcagcggcc tggtgccgcg cggcagccat atggctagca tgactggtgg acagcaaatg 5160

ggtcgcggat ccatgacgtt tgaagaaaaa ttacaggcat acgcggaact tgcagtaaaa 5220

gttggggtaa acattcaacc aggtcaatat ttgttagtca acacatcagt tgaggcttta 5280

gattttgctc gtttagtcgt taaagaggcg tataaggctg gggcagggcg tgtccatgtt 5340

aatttttctg acgatgaaat ggatcgtgcc tattttgaac atgcctctga tgaagaattt 5400

aaccgtttcc ccgaatgggt cgtacaaatg cgtgatgaac tcattgaacg taaaggggca 5460

ttattatgga tagatgccgc agatcctgat aaattaacag gaatctcggc tgatcgatta 5520

gctactcatc aaaaggtatc aggagctgcg ttgaaaaact atcgtaatgc agttatgaag 5580

gatttgattg cgtggtccat tattgcagta ccttcgccaa agtgggcggc aaaggtattc 5640

cctcaattga cagcagacga gcaagtacct gctttatggg aagctatctt taaaacagtt 5700

catatcggag aaggtaacgc agttgaaaat tggcatcagc atgtaacgaa tttagaatct 5760

cgggcagaac ttttaaataa taaaaagtat gcgaagctac actatactgc acctggaaca 5820

gatttaacga ttgctttagc tccacagcat aaatgggtaa ctggtggcag taaaacgcct 5880

gaaggccatg tttttatcgc caatatgcca acagaagaag tctatacact tcctatgaag 5940

caaggtgtag acggttatgt tagtaattca aagcctttag tatatcaggg caatatcatt 6000

gatggcttta aattaacatt taaagaagga aaaatcatta aagcagaagc tgaagtaggt 6060

caagatttac tacaggagct tattcaagta gatgagggtt ctagttattt aggtgaagta 6120

gcacttgtcc cgcatgagtc accaatttca gcatcaggga ttttatactt taatacacta 6180

ttcgatgaga atgcttcgaa ccatttagcg attggagaag catacccgac atgcttagag 6240

ggtggtagag acttggaaaa cggtcaacta gaagcattag gtgcgaatat ttctgtaacc 6300

catgaagact ttatggttgg taacggtgaa atggacattg atggtatatt accagatgga 6360

actatagagc ctatattccg taaaggtagc tgggctttct aagagctccg tcgacaagct 6420

tgcggccgca ctcgagcacc accaccacca ccactgagat ccggctgcta acaaagcccg 6480

aaaggaagct gagttggctg ctgccaccgc tgagcaataa ctagcataac cccttggggc 6540

ctctaaacgg gtcttgaggg gttttttgct gaaaggagga actatatccg gat 6593

<210> 4

<211> 7188

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ataatcgcac cgcacaggtg atacatactt acctcctcaa gtagtccgag gttaagtgtg 60

ttttaggtga acaaatttca gtttcaggta gaaaactttc gacccgcttc agagtttcta 120

ttagtaaatc tgacaccact tgattaaatg gtctaccccc gaattggggg atgggttatt 180

ttttgctatg aacgtagttt tggtgcatat gacctgcgtt tataaagaaa tataaacgtg 240

atcagatcga tataaaagaa acagtttgta ctcaggtttg aagctttttc ttcgattcgc 300

ctggcaagaa tctcaattgt cgcttacagt ttttctcaac gacaggctgc taagctgcta 360

gttcggtggc ctagtgagtg gcgtttactt gaatgaaaag taatcccatg tcgtgatcag 420

ccaatttggg ttgtgtcaaa gcaattcaaa ggtttcatct ttcgatatcc tattcaagga 480

gaccctcgcc tctatgttta acaatcgtat ccgcactgca gctctcgctg gtgcaatcgc 540

aatctccacc gcagcttccg gacttgttgt tccagcattc gctcaggaaa ccactatgac 600

gtttgaagaa aaattacagg catacgcgga acttgcagta aaagttgggg taaacattca 660

accaggtcaa tatttgttag tcaacacatc agttgaggct ttagattttg ctcgtttagt 720

cgttaaagag gcgtataagg ctggggcagg gcgtgtccat gttaattttt ctgacgatga 780

aatggatcgt gcctattttg aacatgcctc tgatgaagaa tttaaccgtt tccccgaatg 840

ggtcgtacaa atgcgtgatg aactcattga acgtaaaggg gcattattat ggatagatgc 900

cgcagatcct gataaattaa caggaatctc ggctgatcga ttagctactc atcaaaaggt 960

atcaggagct gcgttgaaaa actatcgtaa tgcagttatg aaggatttga ttgcgtggtc 1020

cattattgca gtaccttcgc caaagtgggc ggcaaaggta ttccctcaat tgacagcaga 1080

cgagcaagta cctgctttat gggaagctat ctttaaaaca gttcatatcg gagaaggtaa 1140

cgcagttgaa aattggcatc agcatgtaac gaatttagaa tctcgggcag aacttttaaa 1200

taataaaaag tatgcgaagc tacactatac tgcacctgga acagatttaa cgattgcttt 1260

agctccacag cataaatggg taactggtgg cagtaaaacg cctgaaggcc atgtttttat 1320

cgccaatatg ccaacagaag aagtctatac acttcctatg aagcaaggtg tagacggtta 1380

tgttagtaat tcaaagcctt tagtatatca gggcaatatc attgatggct ttaaattaac 1440

atttaaagaa ggaaaaatca ttaaagcaga agctgaagta ggtcaagatt tactacagga 1500

gcttattcaa gtagatgagg gttctagtta tttaggtgaa gtagcacttg tcccgcatga 1560

gtcaccaatt tcagcatcag ggattttata ctttaataca ctattcgatg agaatgcttc 1620

gaaccattta gcgattggag aagcataccc gacatgctta gagggtggta gagacttgga 1680

aaacggtcaa ctagaagcat taggtgcgaa tatttctgta acccatgaag actttatggt 1740

tggtaacggt gaaatggaca ttgatggtat attaccagat ggaactatag agcctatatt 1800

ccgtaaaggt agctgggctt tctaaaattc agcttggctg ttttggcgga tgagagaaga 1860

ttttcagcct gatacagatt aaatcagaac gcagaagcgg tctgataaaa cagaatttgc 1920

ctggcggcag tagcgcggtg gtcccacctg accccatgcc gaactcagaa gtgaaacgcc 1980

gtagcgccga tggtagtgtg gggtctcccc atgcgagagt agggaactgc caggcatcaa 2040

ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt ttatctgttg tttgtcggtg 2100

aacgctctcc tgagtaggac aaatccgccg ggagcggatt tgaacgttgc gaagcaacgg 2160

cccggagggt ggcgggcagg acgcccgcca taaactgcca ggcatcaaat taagcagaag 2220

gccatcctga cggatggcct ttttgcgttt ctacaaactc ttttgtttat ttttctaaat 2280

acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg 2340

aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc 2400

attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga 2460

tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga 2520

gagttttcgc cccgaagaac gttttccaat gatgagcact tttgcttcct cgctcactga 2580

ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 2640

acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 2700

aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 2760

tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 2820

aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 2880

gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcaatgctc 2940

acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 3000

accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 3060

ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 3120

gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 3180

gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 3240

ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 3300

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 3360

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 3420

cttcacctag atccttttgg ggtgggcgaa gaactccagc atgagatccc cgcgctggag 3480

gatcatccag ccattcgggg tcgttcactg gttccccttt ctgatttctg gcatagaaga 3540

acccccgtga actgtgtggt tccgggggtt gctgattttt gcgagacttc tcgcgcaatt 3600

ccctagctta ggtgaaaaca ccatgaaaca ctagggaaac acccatgaaa cacccattag 3660

ggcagtaggg cggcttcttc gtctagggct tgcatttggg cggtgatctg gtctttagcg 3720

tgtgaaagtg tgtcgtaggt ggcgtgctca atgcactcga acgtcacgtc atttaccggg 3780

tcacggtggg caaagagaac tagtgggtta gacattgttt tcctcgttgt cggtggtggt 3840

gagcttttct agccgctcgg taaacgcggc gatcatgaac tcttggaggt tttcaccgtt 3900

ctgcatgcct gcgcgcttca tgtcctcacg tagtgccaaa ggaacgcgtg cggtgaccac 3960

gacgggctta gcctttgcct gcgcttctag tgcttcgatg gtggcttgtg cctgcgcttg 4020

ctgcgcctgt agtgcctgtt gagcttcttg tagttgctgt tctagctgtg ccttggttgc 4080

catgctttaa gactctagta gctttcctgc gatatgtcat gcgcatgcgt agcaaacatt 4140

gtcctgcaac tcattcatta tgtgcagtgc tcctgttact agtcgtacat actcatattt 4200

acctagtctg catgcagtgc atgcacatgc agtcatgtcg tgctaatgtg taaaacatgt 4260

acatgcagat tgctgggggt gcagggggcg gagccaccct gtccatgcgg ggtgtggggc 4320

ttgccccgcc ggtacagaca gtgagcaccg gggcacctag tcgcggatac cccccctagg 4380

tatcggacac gtaaccctcc catgtcgatg caaatcttta acattgagta cgggtaagct 4440

ggcacgcata gccaagctag gcggccacca aacaccacta aaaattaata gtccctagac 4500

aagacaaacc cccgtgcgag ctaccaactc atatgcacgg gggccacata acccgaaggg 4560

gtttcaattg acaaccatag cactagctaa gacaacgggc acaacacccg cacaaactcg 4620

cactgcgcaa ccccgcacaa catcgggtct aggtaacact gagtaacact gaaatagaag 4680

tgaacacctc taaggaaccg caggtcaatg agggttctaa ggtcactcgc gctagggcgt 4740

ggcgtaggca aaacgtcatg tacaagatca ccaatagtaa ggctctggcg gggtgccata 4800

ggtggcgcag ggacgaagct gttgcggtgt cctggtcgtc taacggtgct tcgcagtttg 4860

agggtctgca aaactctcac tctcgctggg ggtcacctct ggctgaattg gaagtcatgg 4920

gcgaacgccg cattgagctg gctattgcta ctaagaatca cttggcggcg ggtggcgcgc 4980

tcatgatgtt tgtgggcact gttcgacaca accgctcaca gtcatttgcg caggttgaag 5040

cgggtattaa gactgcgtac tcttcgatgg tgaaaacatc tcagtggaag aaagaacgtg 5100

cacggtacgg ggtggagcac acctatagtg actatgaggt cacagactct tgggcgaacg 5160

gttggcactt gcaccgcaac atgctgttgt tcttggatcg tccactgtct gacgatgaac 5220

tcaaggcgtt tgaggattcc atgttttccc gctggtctgc tggtgtggtt aaggccggta 5280

tggacgcgcc actgcgtgag cacggggtca aacttgatca ggtgtctacc tggggtggag 5340

acgctgcgaa aatggcaacc tacctcgcta agggcatgtc tcaggaactg actggctccg 5400

ctactaaaac cgcgtctaag gggtcgtaca cgccgtttca gatgttggat atgttggccg 5460

atcaaagcga cgccggcgag gatatggacg ctgttttggt ggctcggtgg cgtgagtatg 5520

aggttggttc taaaaacctg cgttcgtcct ggtcacgtgg ggctaagcgt gctttgggca 5580

ttgattacat agacgctgat gtacgtcgtg aaatggaaga agaactgtac aagctcgccg 5640

gtctggaagc accggaacgg gtcgaatcaa cccgcgttgc tgttgctttg gtgaagcccg 5700

atgattggaa actgattcag tctgatttcg cggttaggca gtacgttctc gattgcgtgg 5760

ataaggctaa ggacgtggcc gctgcgcaac gtgtcgctaa tgaggtgctg gcaagtctgg 5820

gtgtggattc caccccgtgc atgatcgtta tggatgatgt ggacttggac gcggttctgc 5880

ctactcatgg ggacgctact aagcgtgatc tgaatgcggc ggtgttcgcg ggtaatgagc 5940

agactattct tcgcacccac taaaagcggc ataaaccccg ttcgatattt tgtgcgatga 6000

atttatggtc aatgtcgcgg gggcaaacta tgatgggtct tgttgttggc gtcccggaaa 6060

acgattccga agcccaacct ttcatagaag gcggcggtgg aatcgaaatc tcgtgatggc 6120

aggttgggcg tcgcttggtc ggtcatttcg aagggcacca ataactgcct taaaaaaatt 6180

acgccccgcc ctgccactca tcgcagtact gttgtaattc attaagcatt ctgccgacat 6240

ggaagccatc acagacggca tgatgaacct gaatcgccag cggcatcagc accttgtcgc 6300

cttgcgtata atatttgccc atggtgaaaa cgggggcgaa gaagttgtcc atattggcca 6360

cgtttaaatc aaaactggtg aaactcaccc agggattggc tgagacgaaa aacatattct 6420

caataaaccc tttagggaaa taggccaggt tttcaccgta acacgccaca tcttgcgaat 6480

atatgtgtag aaactgccgg aaatcgtcgt ggtattcact ccagagcgat gaaaacgttt 6540

cagtttgctc atggaaaacg gtgtaacaag ggtgaacact atcccatatc accagctcac 6600

cgtctttcat tgccatacgg aactccggat gagcattcat caggcgggca agaatgtgaa 6660

taaaggccgg ataaaacttg tgcttatttt tctttacggt ctttaaaaag gccgtaatat 6720

ccagctgaac ggtctggtta taggtacatt gagcaactga ctgaaatgcc tcaaaatgtt 6780

ctttacgatg ccattgggat atatcaacgg tggtatatcc agtgattttt ttctccattt 6840

tagcttcctt agctcctgaa aatctcgtcg aagctcggcg gatttgtcct actcaagctg 6900

atccgacaaa atccacacat tatcccaggt gtccggatcg gtcaaatacg ctgccagctc 6960

atagaccgta tccaaagcat ccggggctga tccccggcgc cagggtggtt tttcttttca 7020

ccagtgagac gggcaacagc tgattgccct tcaccgcctg gccctgagag agttgcagca 7080

agcggtccac gtggtttgcc ccagcaggcg aaaatcctgt ttgatggtgg ttaacggcgg 7140

gatataacat gagctgtctt cggtatcgtc gtatcccact accgagat 7188