阅读说明：本技术 染色体9开放阅读框72基因表达的调节物及其用途 (Regulator for chromosome 9 open reading frame 72 gene expression and its use ) 是由 J.F.纳汉 A.帕塔马塔 M.萨米 于 2020-04-23 设计创作，主要内容包括：本公开提供用于调节有需要的患者中C9orf72基因转录的组合物及方法,所述患者包括患有C9orf72相关疾病诸如肌萎缩侧索硬化(ALS)和额颞叶痴呆(FTD)的患者。(The present disclosure provides compositions and methods for modulating C9orf72 gene transcription in patients in need thereof, including patients with C9orf72 associated diseases such as Amyotrophic Lateral Sclerosis (ALS) and frontotemporal dementia (FTD).)

1. A fusion protein comprising a Zinc Finger Protein (ZFP) domain and a transcription repressor domain, wherein the ZFP domain binds to a target region in an intron segment between exon 1a and exon 1b on a mutant allele of a human C9orf72 gene, wherein the target region comprises more than 30G₄C₂(SEQ ID NO: 1).

2. The fusion protein of claim 1, wherein said fusion protein inhibits transcription of repeat-containing mRNA from said mutant allele and does not inhibit transcription of wild-type mRNA from said gene.

3. The fusion protein of claim 1 or 2, wherein the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises a tandem repeat of one to three of the following hexanucleotides: GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5) or CGGGGC (SEQ ID NO: 6).

4. The fusion protein of any one of claims 1 to 3, wherein said fusion protein inhibits sense transcription from said mutant C9orf72 allele in a human cell.

5. The fusion protein of claim 4, wherein the fusion protein inhibits sense transcription from the C9orf721a promoter and does not inhibit sense transcription from the C9orf721b promoter.

6. The fusion protein of claim 1 or 2, wherein the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises a tandem repeat of one to three of the following hexanucleotides: GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11) or CGGCCC (SEQ ID NO: 12).

7. The fusion protein of any one of the preceding claims, wherein the fusion protein inhibits antisense transcription from the mutant C9orf72 allele in a human cell.

8. The fusion protein of any one of the preceding claims, wherein the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 allele in a human cell.

9. The fusion protein of any one of the preceding claims, wherein the fusion protein inhibits sense and/or antisense transcription from the mutant C9orf72 allele by at least about 30%, 40%, 75%, 90%, or 95%, optionally wherein the fusion protein does not inhibit sense transcription from the C9orf721b promoter.

10. The fusion protein of any one of the preceding claims, wherein the ZFP domain

Comprises six zinc fingers;

binds to a target sequence shown in table 1; and/or

Six zinc finger sequences comprising ZFP transcription factors shown in table 1, optionally comprising one or more mutations to recognition helix extraregional residues as indicated in table 1.

11. The fusion protein of any one of the preceding claims, wherein the transcription repressor domain comprises a KRAB domain amino acid sequence from human KOX 1.

12. The fusion protein of any one of the preceding claims, wherein the ZFP domain is linked to the transcription repressor domain via a peptide linker.

13. A nucleic acid construct comprising a coding sequence for the fusion protein of any one of claims 1 to 12, wherein the coding sequence is operably linked to transcriptional regulatory elements.

14. The nucleic acid construct of claim 13, wherein the transcriptional regulatory element is a mammalian promoter that is constitutively active or inducible in brain cells, optionally wherein the promoter is a human synapsin I promoter.

15. The nucleic acid construct of claim 13 or 14, wherein the construct is a viral construct, optionally wherein the viral construct is a recombinant adeno-associated viral construct.

16. A host cell comprising the nucleic acid construct of any one of claims 13 to 15.

17. The host cell of claim 16, wherein the host cell is a human cell.

18. The host cell of claim 17, wherein the human cell is a neuron or a pluripotent stem cell, wherein the stem cell is optionally an embryonic stem cell or an Induced Pluripotent Stem Cell (iPSC).

19. A recombinant virus comprising the nucleic acid construct of claim 15, optionally wherein the recombinant virus is a recombinant adeno-associated virus (rAAV).

20. A pharmaceutical composition comprising the nucleic acid construct of any one of claims 13 to 15, or the recombinant virus of claim 19, and a pharmaceutically acceptable carrier.

21. A method of inhibiting transcription of a mutant allele of the C9orf72 gene in a human cell, wherein the mutant allele comprises amplified G in an intron region between exon 1a and exon 1b₄C₂(SEQ ID NO:1) a repeat region, said method comprising introducing into said cell the fusion protein of any one of claims 1 to 12, the nucleic acid construct of any one of claims 13 to 15, the recombinant virus of claim 19 or the pharmaceutical composition of claim 20.

22. The method of claim 21, wherein the human cell is a neuron, a glial cell, an ependymal cell, or a neuroepithelial cell.

23. The method of claim 21 or 22, wherein the cell is in the brain or spinal cord of a patient having a C9orf 72-associated disorder, optionally selected from Amyotrophic Lateral Sclerosis (ALS) and C9 familial frontotemporal dementia (C9 family frontotemporal dementia; C9 FTD).

24. A method of treating a patient having a C9orf 72-associated disorder, optionally selected from Amyotrophic Lateral Sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), comprising introducing into said patient the fusion protein of any one of claims 1 to 12, the nucleic acid construct of any one of claims 13 to 15, the recombinant virus of claim 19, or the pharmaceutical composition of claim 20.

25. The method of any one of claims 21 to 24, wherein the fusion protein is introduced via a recombinant virus expressing the fusion protein.

26. The method of claim 25, wherein the recombinant virus is an adeno-associated virus (AAV) optionally having serotype 9 or pseudotyped AAV2/9 or AAV 2/6/9.

27. The method of claim 25 or 26, wherein the recombinant virus is administered to the patient via intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and/or intracisternal routes.

28. The method according to any one of claims 21 to 27, wherein two or more fusion proteins according to any one of claims 1 to 12 are introduced, optionally wherein the coding sequences of the two or more fusion proteins are on the same recombinant viral vector.

29. The fusion protein according to any one of claims 1 to 12, the nucleic acid construct according to any one of claims 13 to 15, the recombinant virus according to claim 19 or the pharmaceutical composition according to claim 20 for use in a method according to any one of claims 21 to 28.

30. Use of a nucleic acid construct according to any of claims 13 to 15 or a recombinant virus according to claim 19 for the preparation of a medicament for treating a patient in need thereof in a method according to any of claims 21 to 28.

Background

Chromosome 9 open reading frame 72(C9orf72) gene encodes a protein that is found in large numbers in neurons. The C9orf72 protein is believed to play an important role in endosomal transport. Although the function of the C9orf72 protein is not well understood, recent data suggest that it plays a role in membrane trafficking along the endolysosomal pathway by modulating the function of Rab proteins.

The C9orf72 gene contains a hexanucleotide segment (G) in intron 1₄C₂(ii) a SEQ ID NO: 1). This segment can be repeated up to 30 times in tandem without a discernible biological effect. However, more than 30 repetitions (a phenomenon known as hexanucleotide amplification) can lead to C9orf 72-related disorders (Renton et al, Neuron (2011)72: 257-68; Douglas, Non-coding RNA Res. (2018)3: 178-87). This amplification produces a somatic chromosomal dominant phenotype, and patients are often heterozygous for the amplified allele. The hexanucleotide amplification appears to cause the formation of intracellular RNA aggregation sites (foci), leading to RNA-binding protein segregation and disruption of RNA metabolism. Through AUG-independent translation, hexanucleotide amplification also appears to result in the production of unnatural proteins containing dipeptide repeats (DPR) from potentially all six frameworks in both sense and antisense orientations (Freibaum and Taylor, Front Mol Neurosci. (2017)10: 35; Douglas, supra). These proteins tend to aggregate (Gendron et al, Acta neuropathohol. (2013)126: 829). DPR has been reported as inclusion bodies in postmortem brain material in patients with C9orf 72-related disease (Riemslagh et al, Acta Neuropodhol Commun. (2019)7: 39).

C9orf 72-associated disorders include Amyotrophic Lateral Sclerosis (ALS) and C9 familial frontotemporal dementia (C9 FTD). ALS is characterized by progressive muscle weakness, loss of muscle mass, and a gradual decline in the ability to move, speak, swallow, and/or breathe. The annual incidence of ALS is 1 to 3 cases per 100,000 people and is the most common adult-onset motor neuron disorder. For most patients, the disease is fatal within three to five years of the first symptoms. Mutations in the C9orf72 gene account for approximately 30% to 40% of familial ALS in the united states and europe, and for 5% to 10% of sporadic ALS. Some C9orf 72-related ALS patients also suffer from a condition known as C9 frontotemporal dementia (FTD) or C9FTD, a neurodegenerative disease that affects personality, behavior, and language (Benussi et al, Front Aging Neurosci (2015)7: 171). A subject suffering from both conditions is diagnosed with ALS-FTD.

There is no effective treatment for C9orf72 related disorders. Therefore, there is an urgent need to develop effective therapies for these conditions.

Summary of The Invention

The present disclosure provides zinc finger protein-based human C9orf72 transcriptional modulators and the use of these modulators in the treatment of C9orf 72-related disorders. In one aspect, the present disclosure provides a fusion protein comprising a Zinc Finger Protein (ZFP) domain and a transcription repressor domain, wherein the ZFP domain binds to a target region in an intron segment (intron 1a) between exons 1a and 1b of a mutant allele of a human C9orf72 gene. The mutant allele has an amplified G4C2(SEQ ID NO:1) repeat region in intron 1a, and the fusion protein targets this amplified repeat region. Mutant alleles may contain more than 30 tandem G₄C₂A repeating sequence (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 repeating sequences). A wild-type allele can comprise no more than 30 such repeats (e.g., no more than 25, 20, 15, 10, or 5 repeats).

In some embodiments, the fusion protein inhibits transcription of an RNA transcript (e.g., mRNA) containing a repeat sequence from a mutant allele and does not inhibit transcription of a wild-type RNA transcript (e.g., mRNA) from the gene.

In some embodiments, the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises a tandem repeat of one to three hexanucleotides GGGGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5), or CGGGGC (SEQ ID NO: 6). In certain embodiments, the fusion protein inhibits sense transcription from a mutant allele in a human cell. In particular embodiments, the fusion protein inhibits sense transcription from the C9orf721a promoter and does not inhibit sense transcription from the C9orf721b promoter.

In some embodiments, the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises a tandem repeat of one to three hexanucleotides GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11), or CGGCCC (SEQ ID NO: 12). In certain embodiments, the fusion protein inhibits antisense transcription from a mutant allele in a human cell.

In some embodiments, the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 allele in a human cell. In some embodiments, the fusion protein preferentially inhibits the mutant C9orf72 allele compared to the wild-type C9orf72 allele.

In other embodiments, the fusion protein inhibits sense and/or antisense transcription from the mutant allele by at least about 30%, 40%, 75%, 90%, or 95%.

In some embodiments, the fusion protein has one or more ZFP domains, each optionally comprising six zinc fingers; binds to a target sequence shown in table 1; and/or comprises six zinc fingers (ordered F1 to F6), each zinc finger comprising a DNA-binding (recognition) helix sequence as shown in a single column of table 1, optionally comprising one or more mutations to residues outside the recognition helix region as indicated in table 1. In other embodiments, the fusion protein binds to a target sequence and comprises a zinc finger corresponding to an SBS ID as set forth in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID as set forth in the single column of table 1, wherein the SBS ID is 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, 79901, 79902, 79904, 79916, 75027, or 79921.

In some embodiments, the fusion protein has one or more transcription repressor domains, each of which optionally comprises a KRAB domain amino acid sequence from human KOX1, such as described further below. In particular embodiments, the ZFP domain is linked to the transcription repressor domain via a peptide linker.

In another aspect, the present disclosure provides a nucleic acid construct comprising a coding sequence of one or more of the fusion proteins described herein, wherein the coding sequence is optionally operably linked to transcriptional regulatory elements. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cells, and wherein the promoter is optionally a human synapsin I promoter. In some embodiments, the construct is a recombinant adeno-associated virus ("AAV" or "rAAV") construct. Also provided are raavs comprising a recombinant AAV construct and a capsid of serotypes 1 to 10 (e.g., AAV2, AAV6, or AAV9) or a pseudotype derived therefrom (e.g., AAV2/9, AAV2/6, or AAV 2/6/9).

In another aspect, the present disclosure provides a host cell comprising one or more fusion proteins and/or one or more nucleic acid constructs as described herein. The host cell can be, for example, a human cell, such as a neuron or a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

Also provided are pharmaceutical compositions comprising one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses (e.g., rAAV) comprising nucleic acid constructs, and/or one or more host cells, typically in combination with one or more pharmaceutically acceptable excipients.

In yet another aspect, the present disclosure provides a method of inhibiting transcription of a mutant C9orf72 allele in a human cell (e.g., a neuron, a glial cell, an ependymal cell, or a neuroepithelial cell), wherein the mutant allele comprises an amplified G4C2 repeat region in intron 1a, the method comprising introducing into the cell one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more recombinant viruses, one or more host cells, and/or one or more pharmaceutical compositions as described herein. In some embodiments, the cell is in the brain or spinal cord of a patient having a C9orf 72-associated disorder (such as ALS or C9 FTD).

In a related aspect, the present disclosure provides a method of treating a patient having a C9orf 72-associated disorder optionally selected from Amyotrophic Lateral Sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), the method comprising introducing into the patient one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more host cells, and/or one or more pharmaceutical compositions as described herein.

In the therapeutic methods of the invention, the fusion protein can be introduced using a recombinant virus (e.g., an AAV vector) that expresses the fusion protein. In some embodiments, the recombinant virus is administered to the patient via an intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and/or intracisternal route. In some embodiments, two or more different fusion proteins of the invention are introduced, wherein the coding sequences of the two or more fusion proteins may be carried on the same or different recombinant viral vectors.

The present disclosure also provides one or more fusion proteins and/or one or more nucleic acid constructs, one or more recombinant viruses and one or more pharmaceutical compositions for use in the methods of treatment described herein, and the use of the fusion proteins, nucleic acid constructs and recombinant viruses for the manufacture of a medicament for the methods of treatment described herein.

Other features, objects, and advantages of the invention will be apparent from the description that follows. It should be understood, however, that the embodiments, while indicating implementations and aspects of the invention, are given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the embodiments.

Brief Description of Drawings

Fig. 1A to 1C depict schematic diagrams of the C9orf72 gene and the transcripts produced.

Fig. 1A shows the structure of both the wild-type C9orf72 allele and the amplified mutant C9orf72 allele. Amplification of G on mutant allele₄C₂The location of the amplification is indicated (in the genomic region between exons 1a and 1b, i.e., intron 1 a). Exons are shown as boxes. Adapted from Douglas, supra; see also Rizzu et al (2016) Acta neuropathology Communications 4:37。

FIG. 1B shows the mutant amplified C9orf72 allele near G₄C₂An enlarged view of the amplified region, and depicting the promoter and transcript associated with the amplified allele. The approximate positions of the promoters involved in sense strand transcription (filled arrows) and antisense transcription (open arrows) are shown. Also shown are the 5 different sense transcripts that have been previously described, as well as transcripts in the approximate location and antisense orientation. As above.

FIG. 1C shows a model of the 1a promoter and antisense promoter suppression by ZFP-TF targeting the amplification region, where the ZFP-TF binds in a position downstream of both promoters and optimal for promoter regulation. The 1b promoter in this model is not repressed because the binding of ZFP-TF is upstream of the 1b promoter.

Fig. 2A-2D show inhibition of C9orf72 expression ("total C9") in a given cell type using a given ZFP-TF. In addition, the figure shows inhibition of expression of the longer mRNA isoform containing intron 1a (amplification), which is mainly due to the amplification of the mutant allele ("isoform specificity with repeated sequences"). Amplified isoforms were predominantly expressed in the C9 patient line.

FIG. 2A shows PCR analysis for total C9 analysis and isoform-specific analysis of repeat containing sense and antisense. The top of the figure depicts the genomic structure of the wild type and amplified alleles, while the bottom of the figure shows the mRNA products made from each allele. The set of arrows on the mRNA plot depict the PCR targets used in the total C9 analysis.

Fig. 2B to 2D are graphs showing the results of analysis of C9orf72 expression of different exemplary ZFP-TFs in a wild type cell line derived from healthy subjects and an ALS patient-derived fibroblast cell line "C9". The C9 cell line is characterized by "5/850", which refers to G₄C₂The number of repeats on the wild-type allele (5) and on the amplified allele (850). Left-most graph: total C9orf72 expression in wild type cells in round 3 of screening ("round 3") ("total C9"). Second graph from left: total C9 in C9 cells in round 3. Second panel from right: round 2 screening ("round 2") Total C9 in medium C9 cells. The right-most graph: expression of the self-amplifying C9orf72 allele as determined by an isoform-specific C9orf72 assay. Round 2 screens were performed in C9 cells to assess isoform (or disease) specific C9orf72 transcript levels relative to total C9 transcript levels after ZFP-TF treatment. In round 3, total C9 was determined in C9 cells and wild type cells in order to evaluate the effect of ZFP-TF on the Wild Type (WT) allele of C9 cells. For each ZFP-TF, 1, 3, 10, 30, 100 and 300ng mRNA concentrations are shown from left to right. Fig. 2B shows the results for ZFP-TF74949, 74951, 74954, 74955 and 74964 in the top diagram and 74969, 74971, 74973, 74978 and 74979 in the bottom diagram. FIG. 2B reveals SEQ ID NOs 1, 1 and 3, respectively, in order of appearance. Fig. 2C shows the results for ZFP-TF 74983, 74984, 74986, 74987, and 74988 in the top panel, and 74997, 74998, 75001, and 75003 in the bottom panel. FIG. 2C reveals SEQ ID NOS: 4 and 5, respectively, in order of appearance. Fig. 2D shows the results for ZFP-TF 75023, 75027, 75031, 75032, 75055, and 75078 in the top panel and 75090, 75105, 75109, 75114, and 75115 in the bottom panel. FIG. 2D reveals SEQ ID NOS: 8-11, respectively, in order of appearance. The sequence at the bottom of the figure represents the DNA binding motif of the ZFP-TF. Each ZFP-TF binds to three hexanucleotide repeats containing this motif. Transcript levels were normalized to the level of Green Fluorescent Protein (GFP) expressed from GFP mRNA transfected with ZFP-TF mRNA. The horizontal dotted lines in the figure show 50% or 70% inhibition as indicated. For example, for ZFP-TF 75115, there was approximately 50% inhibition of total isoform transcripts in line C9 and approximately 70% inhibition of repeat-containing isoform-specific transcripts, while inhibition of total isoforms was minimal in the WT line. The graph indicates that 30% of the transcript continues to be present, which indicates 70% inhibition.

FIG. 3 shows a diagram of the promoter regions of sense and antisense transcripts in C9orf72 amplified alleles. Primer pairs for specific detection of sense, total and antisense transcripts are indicated. AS: antisense. ddPCR: droplet digital PCR. The figures reveal SEQ ID NO 1, 1 and 7, respectively, in the order of appearance.

FIG. 4A and FIG. 4B show targetingPrimer-specific detection of intron 1b antisense precursor mRNA (pre-mRNA). Strand-specific PCR was used to generate sense (S) or Antisense (AS) cDNA templates from healthy control (Con) or C9 cells (C9). For example, C9-AS indicates ddPCR results obtained with antisense cDNA templates generated from RNA isolated from C9 cells. FIG. 4A shows that only cDNA template C9-AS produced PCR products, indicating the specificity of the primer pair for detection of antisense precursor mRNA. FIG. 4B extends the experiment in FIG. 4A to have a different G₄C₂7 different C9orf72 patient-derived cell lines of repeat length and 6 different healthy control lines.

Fig. 5A to 5C are graphs showing the inhibition of transcripts in C9 cells obtained using an isoform-specific assay containing repeated sequences. Fig. 5A shows three experiments in which ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960 and 74967 were given at three different doses (30, 100 or 300ng) and the amount of disease sense transcript was subsequently measured. Figure 5B shows three experiments measuring disease antisense transcripts. Figure 5C shows three runs to measure total C9orf72 transcripts.

FIG. 6 shows results from each containing a different G on its amplified allele₄C₂Inhibition of total C9 transcript and amplification of sense and antisense transcripts (disease isoforms) in three different fibroblast cell lines from ALS patients with repeat numbers (approximately 600, 800 and 850 repeats, respectively). After exposing the cells to 100ng of ZFP-TF75109, 75114 and 75115, an isoform selective assay was used to assess the amount of inhibition. All three ZFP-TFs maintained selective inhibition in all three cell lines.

FIG. 7 shows the results from having more than canonical G on the allele₄C₂Inhibition of total C9 transcript in two cell lines of healthy subjects with repeated sequence numbers. Healthy subjects typically have 2 to 5G on each of their C9orf72 alleles₄C₂The sequence is repeated. However, some healthy subjects contain more repetitive sequences. To ensure that sufficient ZFP-TF binding sites are provided, cell lines containing more than the typical number of repeats (5/8 and 5/20 repeats) are used. In these cell lines, total C9 transcriptionThe object is minimally affected.

Fig. 8A to 8C show the results of microarray analysis in ALS patient-derived primary fibroblasts (C921, also referred to as C9021), mouse primary neurons, and human primary neurons, showing the specificity of the indicated inhibitors (75027, 75109, 75114, and 75115). ZFP-TF 75027 targets the repetitive GCCCCG (SEQ ID NO:8) motif, while ZFP-TF75109, 75114 and 75115 target the CCGGCC (SEQ ID NO:11) motif in the antisense strand of the C9orf72 gene.

FIG. 8A shows the use of Thermo Fisher Clariom in patient-derived primary fibroblasts (C9021)^TMResults of microarray analysis of S analysis, Thermo Fisher Clariom^TMS analysis contained 21,000 well-annotated genes in its database. The analysis was performed 24 hours after administration of 300ng of inhibitor in the form of mRNA to C9021 cells. The figure shows genes that are up-regulated or down-regulated in response to a given ZFP-TF.

FIG. 8B shows the use of Thermo Fisher Clariom in mouse primary neurons^TMResults of microarray analysis of D analysis, Thermo Fisher Clariom^TMD analysis contained 140,000 tagged and untagged coding and non-coding transcripts in its database. Analysis was performed 7 days after AAV transduction. All cells were transduced at an MOI of 3,000. The figure shows genes that are up-regulated or down-regulated in response to a given ZFP-TF.

FIG. 8C shows the use of Thermo Fisher Clariom in human primary neurons^TMD results of microarray analysis of analysis. The analysis was performed 19 days after AAV transduced cells at an MOI of 3,000. The figure shows genes that are up-regulated or down-regulated in response to a given ZFP-TF.

Fig. 9 shows in vivo target engagement of ZFPs in C9orf72 BAC gene transgenic mice. Panel A shows AAV constructs for injection. The construct contains a synapsin promoter, a ZFP-KRAB coding sequence and a Venus tag. Panels B and C show the study design according to which neonatal mice were injected Intracerebroventricularly (ICV) with AAV containing the ZFP-KRAB expression construct and dissected one month post injection for downstream analysis. Panel D shows the amount of sense, antisense and total C9RNA in hippocampus and cortex in animals injected with ZFP-KRAB (75027). Panel E shows representative images of the foci of sense and antisense RNA in ZFP-KRAB (75027) injected animals and quantification from the region of the horns of Mongolian (cornu amonis; CA) and Dentate Gyrus (DG).

Detailed Description

The present disclosure provides zinc finger protein-based transcription factors (ZFP-TF) that are preferentially targeted with amplified G₄C₂Human C9orf72 gene alleles in the repeat region and inhibit transcription of these mutant alleles into RNA. Such an amplification region may have more than 30G' s₄C₂The sequence is repeated. The ZFP-TF of the invention are fusion proteins comprising (i) at least one Zinc Finger Protein (ZFP) domain that specifically binds to a DNA motif within a repeat on the sense or antisense strand of a mutant allele, and (ii) at least one transcriptional repressor domain that reduces transcription of the allele in either or both of the sense and antisense orientations D. It is expected that by introducing ZFP-TF into the nervous system (e.g., brain and spinal cord), reducing the level of the mutant C9orf72 transcript in neurons, the formation of intracellular pathogenic cytotoxic agents is inhibited (e.g., reduced or halted). The ZFP-TF of the invention can be used to treat (including prevent and alleviate) C9orf 72-related disorders, such as ALS and C9 FTD.

Disclosed herein are methods and compositions for diagnosing, preventing and/or treating ALS and FTD. In particular, provided herein are methods and compositions for modifying (e.g., modulating the expression of) particular genes in order to treat these diseases, including the use of engineered transcription factor inhibitors and nucleases. In some embodiments, modulating expression comprises modulating both sense expression and/or antisense expression.

Thus, described herein are methods (in vivo, ex vivo, and/or in vitro) of inhibiting repeat sequences of the C9orf72 gene in a cell (e.g., a neuron) to amplify sense and/or antisense transcription of a mutant allele. The method comprises treating the cell with one or more inhibitors of the mutant C9orf72 gene allele, the one or more inhibitors comprising a transcription inhibitor domain and a DNA binding domain that binds to a target site in the mutant C9orf72 gene allele. The inhibitor(s) can comprise one or more zinc finger protein transcription factors (ZFP-TF comprising a ZFP DNA binding domain), one or more TAL effector domain transcriptionFactors (TALE-TF comprising TAL effector domain DNA binding domain) and/or one or more CRISPR/Cas transcription factor systems (comprising a single guide RNA DNA binding domain). In certain embodiments, two or more different inhibitors are used (e.g., one or more pharmaceutical compositions comprising the two or more different inhibitors). In certain embodiments, the C9orf72 gene comprises one or more (G)₄C₂) Mutant alleles of repetitive sequences, optionally wherein the target site to which the DNA binding domain of the inhibitor binds is at the one or more (G)₄C₂) Within a repetitive sequence. Thus, the present invention provides one or more conjugates comprising one or more (G) ₄C₂) Use of a mutant C9orf72 of the repeat sequence to amplify an inhibitor (e.g., formulated as one or more pharmaceutical compositions comprising the one or more inhibitors) of ZFP-TF, TALE-TF, or CRISPR/CasTF of an allele for an inhibitor (e.g., to inhibit 50%, 70% or more inhibition of sense and/or antisense transcription as compared to untreated cells/subjects) of a subject in need thereof (e.g., a subject with ALS and/or FTD in which the disease is treated and/or symptoms are improved). In certain embodiments, sense and/or antisense transcription is not inhibited by more than 90% of normal (control) levels. In certain embodiments, both antisense and sense transcription are inhibited at the same or different levels (e.g., antisense and sense transcription are similarly inhibited); antisense transcription is more inhibited than sense transcription, or sense transcription is more inhibited than antisense transcription. In certain embodiments, a particular sense transcript is inhibited while others are not. In some embodiments, transcription from the promoter in the 1b intron segment is not inhibited, while transcription from the promoter in the 1a intron and antisense transcript are inhibited. In certain embodiments, transcripts comprising the amplified repeats are selectively inhibited (e.g., antisense transcription is inhibited, sense transcription from the 1a promoter is inhibited, and/or sense transcription from the 1b promoter is not inhibited). In certain embodiments, one or more ZFP-TF inhibitors comprising a recognition helix region as shown in table 1, optionally with one or more different inhibitors, (are used in the methods and uses described herein E.g. further different ZFP-TF, e.g. one or more further ZFP-TF combinations comprising ZFPs as shown in table 1). In certain embodiments, one or more inhibitors are administered to a cell using one or more non-viral vectors (e.g., in the form of mRNA) and/or viral vectors (e.g., AAV, such as AAV 2/9). Multiple copies of one or more modulators (e.g., inhibitors) may be administered using the same or different modalities (e.g., mRNA and/or AAV). In certain embodiments, the same or different modes may be used to deliver one or more different modulators (e.g., inhibitors). In vivo methods and uses in living subjects (e.g., humans) may involve intravenous administration (e.g., one or more pharmaceutical compositions comprising an inhibitor and/or a polynucleotide encoding an inhibitor) by any suitable means, including but not limited to intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal, and/or intracisternal. Brain administration may be unilateral or bilateral (e.g., to the hippocampus). Any amount (dose) may be administered, for example 1E10 to 1E13 (e.g., 6E11) vg/hemisphere. In any of the methods and uses described herein, the subject's ALS and/or FTD is treated (and/or one or more symptoms of these diseases are treated).

Provided herein are genetic modulators of the C9orf72 gene, the modulators comprising a DNA binding domain (e.g., a Zinc Finger Protein (ZFP), a TAL effector domain protein (TALE), or a single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene; and a transcriptional regulator domain (e.g., a repressor domain). Also provided are one or more polynucleotides (e.g., viral or non-viral gene delivery vehicles, such as AAV vectors) encoding one or more of the genetic modulators described herein. In other aspects, described herein are pharmaceutical compositions comprising one or more polynucleotides and/or one or more gene delivery vehicles as provided herein. In some embodiments, the genetic modulator comprises a regulator domain, the genetic modulator (and pharmaceutical compositions comprising one or more genetic modulators or polynucleotides encoding one or more genetic modulators) modulates (e.g., inhibits or activates) C9orf72 gene expression. The sense and/or antisense strands of the gene may be bound and/or regulated. Also provided herein are isolated cells (including cell populations) comprising one or more genetic modulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and/or one or more pharmaceutical compositions. Also provided are methods and uses (in vitro, in vivo, or ex vivo) for modulating expression (e.g., inhibition) of the C9orf72 gene in a cell, the methods comprising administering (via any method including but not limited to intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, or intracisternal) to the cell one or more genetic modulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and/or one or more pharmaceutical compositions. The methods may be used to treat and/or prevent Amyotrophic Lateral Sclerosis (ALS) or frontotemporal dementia (FTD) in a subject. Also provided are one or more genetic modulators; one or more polynucleotides; one or more gene delivery vehicles; and/or one or more pharmaceutical compositions for use in treating and/or preventing ALS or FTD in a subject. Also provided are kits comprising one or more genetic modulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and/or one or more pharmaceutical compositions, and optionally instructions for use.

Thus, in one aspect, engineered (non-naturally occurring) genetic modulators (e.g., repressors) of one or more genes are provided. These genetic regulators may comprise systems that modulate (e.g., inhibit) allele expression (e.g., zinc finger proteins, TAL effector (TALE) proteins, or CRISPR/dCas-TF). The expression of the wild type and/or mutant alleles may be regulated together or separately. In certain embodiments, the level of modulation of the mutant allele is greater compared to the wild-type allele (e.g., no more than 50% inhibition of the wild-type allele compared to an untreated control, but at least 70% inhibition of the mutant allele). In some embodiments, modulating expression may comprise modulating both sense and antisense transcripts of the C9orf72 gene. In some embodiments, modulation of expression may primarily modulate sense transcripts, while in other embodiments, modulation of expression may primarily modulate antisense transcripts.

Amplification mutations in the C9orf72 alleles result in the expression of both sense and antisense RNA products associated with ALS and FTD, thus, in one embodiment, engineered transcription factors designed to suppress expression of these mutant C9orf72 alleles are provided for the treatment of ALS or FTD. Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA binding domain (e.g., recognition helix or RVD) has been altered (e.g., by selection and/or rational design) to bind to a preselected target site. Any of the zinc finger proteins described herein may include 1, 2, 3, 4, 5, 6, or more zinc fingers, each zinc finger having a recognition helix that binds to a target subsite in the selected sequence(s) (e.g., gene (s)). In certain embodiments, the ZFP-TF comprises a ZFP having a recognition helical region as shown in the single column of table 1. Similarly, any of the TALE proteins described herein can include any number of TALERVD. In some embodiments, at least one RVD has non-specific DNA binding. In some embodiments, at least one recognition helix (or RVD) is non-naturally occurring. In certain embodiments, the TALE-TF comprises a TALE of at least 12 base pairs that binds to a target site as shown in table 1. The CRISPR/Cas-TF comprises a single guide RNA that binds to a target sequence. In certain embodiments, the engineered transcription factor binds (e.g., via ZFP, TALE, or sgRNA DNA binding domain) to a target site of at least 9 to 12 base pairs in the disease-associated gene, e.g., a target site comprising at least 9 to 20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more), including contiguous or non-contiguous sequences within these target sites (e.g., target sites as shown in table 1). In certain embodiments, the genetic modulator comprises a DNA binding molecule (ZFP, TALE, single guide RNA) as described herein operably linked to a transcriptional repressor domain (to form a genetic repressor).

Thus, a Zinc Finger Protein (ZFP), a Cas protein of a CRISPR/Cas system, or a TALE protein as described herein can be placed in operative linkage with a regulator domain as part of a fusion molecule. The functional domain may be, for example, a transcriptional activation domain, a transcriptional repressor domain, and/or a nuclease (cleavage) domain. Such molecules can be used to activate or inhibit gene expression by selecting an activation domain or a suppression domain for use with a DNA binding molecule. In certain embodiments, the functional domain or modulator domain may play a role in histone post-translational modification. In some cases, the domain is Histone Acetyltransferase (HAT), Histone Deacetylase (HDAC), histone methylase or an enzyme that ubiquitinates or biotinylates histones, or other enzyme domain that allows for post-translational histone modification regulation gene inhibition (kousarrides, (2007) Cell 128: 693-705). In some embodiments, molecules are provided that comprise ZFPs, dCas, or TALEs targeted to a gene as described herein (e.g., C9orf72) fused to a transcription repressor domain that can be used to down-regulate gene expression. In some embodiments, the methods and compositions of the invention are suitable for use in the treatment of eukaryotes. In certain embodiments, the activity of the modulator domain is modulated by an exogenous small molecule or ligand such that no interaction with the transcriptional machinery of the cell will occur in the absence of the exogenous ligand. Such external ligands control the extent of interaction of the ZFP-TF, CRISPR/Cas-TF or TALE-TF with the transcription machinery. The modulator domain(s) can be operably linked to any portion(s) of one or more of the ZFPs, dCas, or TALEs, including between the one or more ZFPs, dCas, or TALEs, external to the one or more ZFPs, dCas, or TALEs, and any combination thereof. In a preferred embodiment, the modulator domain causes inhibition of gene expression of a targeted gene (e.g., C9orf 72). Any of the fusion proteins described herein can be formulated into a pharmaceutical composition.

In some embodiments, the artificial regulator binds to a promoter region upstream (e.g., 5' to) the Transcription Start Site (TSS) of the gene. In some embodiments, the artificial modulator binds to a region downstream of the TSS. In a preferred embodiment, the artificial regulator preferentially binds to the amplified repeat region in the C9orf72 gene. In some embodiments, the artificial regulator in combination with the C9orf72 gene inhibits expression of the promoter in the 1a intron. In some embodiments, the artificial regulator in combination with the C9orf72 gene inhibits expression of the promoter in the 1b intron. In some embodiments, binding of the artificial regulator inhibits expression from the 1a promoter and the antisense promoter, but does not inhibit the 1b promoter. See also fig. 1B and 1C.

In some embodiments, the methods and compositions of the invention include the use of two or more fusion molecules as described herein, for example two or more C9orf72 modulators (artificial transcription factors). Two or more fusion molecules may bind to different target sites and comprise the same or different functional domains. Alternatively, two or more fusion molecules as described herein may bind to the same target site, but comprise different functional domains. In some cases, three or more fusion molecules are used; in other cases, four or more fusion molecules are used; while in other cases 5 or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or components thereof) are delivered to a cell in the form of a nucleic acid. In a preferred embodiment, the fusion molecule causes inhibition of the expression of the targeted gene. In some embodiments, the two fusion molecules are given at doses where each molecule is active on its own, but the inhibitory activity is additive in the combination. In some embodiments, the two fusion molecules are given at doses where neither is active on its own, but the inhibitory activity is synergistic in the combination.

In yet another aspect, a polynucleotide encoding any of the DNA binding domains described herein is provided.

In some embodiments, the polynucleotide encoding the DNA binding protein is mRNA. In some aspects, the mRNA can be chemically modified (e.g., Kormann et al, (2011) Nature Biotechnology 29(2): 154-7). In other aspects, the mRNA can comprise an ARCA cap (see U.S. patent nos. 7,074,596 and 8,153,773). In other embodiments, the mRNA may comprise a mixture of unmodified and modified nucleotides (see U.S. patent publication No. 2012/0195936).

In yet another aspect, a gene delivery vector is provided comprising any one of the polynucleotides (e.g., inhibitors) as described herein. In certain embodiments, the vector is an adenoviral vector (e.g., an Ad5/F35 vector); lentiviral Vectors (LV), including integration-competent or integration-defective lentiviral vectors; or an adeno-associated virus vector (AAV). In certain embodiments, the AAV vector is an AAV2, AAV6, AAV8, or AAV9 vector, or a pseudotyped AAV vector, such as AAV2/8, AAV2/5, AAV2/9, and AAV 2/6. In some embodiments, the AAV vector is an AAV vector capable of crossing the blood brain barrier (e.g., U.S. patent publication No. 2015/0079038). In other embodiments, the AAV is a self-complementary AAV (sc-AAV) or single-stranded (ss-AAV) molecule. Also provided herein are adenovirus (Ad) vectors, LV or adeno-associated virus vectors (AAV) comprising a sequence encoding at least one nuclease (ZFN or TALEN) and/or a donor sequence for targeted integration into a gene of interest. In certain embodiments, the Ad vector is a chimeric Ad vector, such as an Ad5/F35 vector. In certain embodiments, the lentiviral vector is an integrase-deficient lentiviral vector (IDLV) or an integrating-capable lentiviral vector. In certain embodiments, the vector is pseudotyped with a VSV-G envelope or other envelope.

In addition, pharmaceutical compositions are also provided that include nucleic acids and/or fusions, such as artificial transcription factors (e.g., ZFPs, Cas, or TALEs or fusion molecules comprising ZFPs, Cas, or TALEs). For example, certain compositions include a nucleic acid comprising a sequence encoding one of the ZFPs, Cas, or TALEs described herein operably linked to a regulatory sequence that allows expression of the nucleic acid in a cell in combination with a pharmaceutically acceptable carrier or diluent. In certain embodiments, the encoded ZFP, Cas, CRISPR/Cas, or TALE modulates the wild-type and/or mutant allele. In some embodiments, the mutant allele is preferentially modulated, e.g., suppressed, over the wild-type allele. In some embodiments, the pharmaceutical composition comprises a ZFP, CRISPR/Cas, or TALE that preferentially modulates the mutant allele, and a ZFP, CRISPR/Cas, or TALE that modulates the neurotrophic factor. Protein-based compositions include one or more ZFPs, CRISPR/Cas, or TALEs as disclosed herein and a pharmaceutically acceptable carrier or diluent.

In yet another aspect, isolated cells comprising any of the proteins, fusion molecules, polynucleotides, and/or compositions as described herein are also provided. The isolated cells may be used for non-therapeutic uses (such as providing cells or animal models for diagnostic and/or screening methods), and/or for therapeutic uses (such as ex vivo cell therapy).

In yet another aspect, pharmaceutical compositions comprising one or more genetic modulators, one or more polynucleotides (e.g., gene delivery vehicles), and/or one or more (e.g., a population) of isolated cells as described herein are also provided. In certain embodiments, the pharmaceutical composition comprises two or more genetic modulators. For example, certain compositions include nucleic acids comprising sequences encoding one or more genetic regulators of one of the rare disease-associated genes (e.g., C9orf72) as described herein. In certain embodiments, the genetic modulator(s) (e.g., comprising a ZFP, Cas, or TALE described herein) is operably linked to a regulatory sequence, in combination with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence allows expression of the nucleic acid in the cell. In certain embodiments, the encoded ZFP, CRISPR/Cas, or TALE is specific for a mutant or wild-type allele (e.g., C9orf 72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR/Cas-TF, or TALE-TF that modulates the mutant and/or wild-type allele (e.g., C9orf72), including TFs that can preferentially modulate (e.g., suppress at a greater level) the mutant allele as compared to the wild-type allele. Protein-based compositions include one or more genetic modulators as disclosed herein and a pharmaceutically acceptable carrier or diluent. In certain embodiments, a composition comprising two or more genetic modulators (supported on the same or different types of vectors, e.g., AAV vectors) is used, optionally wherein one of the genetic modulators comprises a ZFP-TF inhibitor comprising a ZFP designated 74949, 74978, 75027, or 75109.

The invention also provides methods and uses for inhibiting gene expression in a subject in need thereof (e.g., a subject having a rare disease as described herein), comprising by providing to the subject one or more polynucleotides, one or more gene delivery vehicles, and/or a pharmaceutical composition as described herein. In certain embodiments, the compositions described herein are used to inhibit expression of mutant C9orf72 in a subject, including for use in treating and/or preventing ALS or FTD. The compositions described herein inhibit gene expression in the brain (including but not limited to the frontal cortex, including but not limited to the prefrontal cortex, the parietal cortex, the occipital cortex, the temporal cortex, including but not limited to the entorhinal cortex, the hippocampus, the brainstem, the striatum, the thalamus, the midbrain, the cerebellum) and the spinal cord (including but not limited to the lumbar, thoracic, and cervical regions) over sustained periods of time (4 weeks, 3 months, 6 months, to one year or more). The compositions described herein may be provided to a subject by any means of administration, including but not limited to intraventricular, intrathecal, intracranial, intravenous, orbital (retroorbital (RO)), intranasal, and/or intracisternal administration. Also provided are kits comprising one or more of the compositions (e.g., genetic modulators, polynucleotides, pharmaceutical compositions, and/or cells) as described herein and instructions for use of the compositions.

In another aspect, provided herein are methods for treating and/or preventing the CNS (e.g., ALS and/or FTD) using the methods and compositions described herein. In some embodiments, the methods relate to compositions in which polynucleotides and/or proteins can be delivered using viral vectors, non-viral vectors (e.g., plasmids), and/or combinations thereof. In some embodiments, the methods involve compositions comprising a population of stem cells comprising an artificial transcription factor (e.g., ZFP-TF, TALE-TF, or dCas-TF). Administration of a composition (protein, polynucleotide, cell and/or pharmaceutical composition comprising such protein, polynucleotide and/or cell) as described herein results in a therapeutic (clinical) effect, including but not limited to ameliorating or eliminating any clinical symptoms associated with ALS and/or FTD, as well as increasing the function and/or number of CNS cells (e.g., neurons, astrocytes, myelin sheath, etc.). In certain embodiments, the compositions and methods described herein reduce expression of sense and/or antisense transcripts of a gene of interest (e.g., C9orf72) by at least 30% or 40%, e.g., at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95%, as compared to a control that does not receive an artificial inhibitor as described herein. In some embodiments, at least a 50% reduction is achieved. In certain embodiments, the artificial inhibitor preferentially inhibits the mutant allele (e.g., amplification allele) by, e.g., at least 20% (e.g., inhibits the wild-type allele by no more than 50% and inhibits the mutant allele by at least 70%) over the wild-type allele. In some embodiments, the inhibitor preferentially inhibits sense transcripts on the mutant allele, while in other embodiments, the inhibitor preferentially inhibits antisense transcripts on the mutant allele. In some embodiments, the inhibitor inhibits both sense and antisense transcripts on mutant alleles.

In another aspect, described herein are methods of delivering a gene inhibitor to the brain of a subject using a viral or non-viral vector. In certain embodiments, the viral vector is an AAV9 vector. Delivery may be by any suitable means, including through the use of a cannula to reach any brain region, such as the hippocampus or entorhinal cortex. Broad delivery of genetic modulators (e.g., inhibitors) to the brain of a subject is provided, including any AAV vector delivered via anterograde and retrograde axonal transport to brain regions not directly administered with the vector (e.g., delivery to the putamen results in delivery to other structures such as the cortex, substantia nigra, thalamus, etc.). In certain embodiments, the subject is a human, and in other embodiments, the subject is a non-human primate. Administration may be in the form of: a single dose, or a series of doses given simultaneously, or multiple administrations (at any timing between administrations).

Thus, in other aspects, described herein are methods of preventing and/or treating a disease (e.g., ALS and/or FTD) in a subject, the method comprising administering an inhibitor of a gene to the subject using an AAV. In certain embodiments, the inhibitor is administered to the CNS (e.g., hippocampus and/or entorhinal cortex) or PNS (e.g., spinal cord/spinal fluid) of the subject. In other embodiments, the inhibitor is administered intravenously. In certain embodiments, described herein are methods of preventing and/or treating ALS or FTD in a subject, the method comprising administering to the subject an inhibitor of the C9orf72 allele (wild type and/or mutant) using one or more AAV vectors. In certain embodiments, AAV encoding a genetic modulator is administered to the CNS (brain and/or CSF) via any method of delivery, including, but not limited to, intraventricular, intrathecal, intracranial, intravenous, intranasal, retroorbital, or intracisternal delivery. In other embodiments, the AAV encoding the inhibitor is administered directly into the brain parenchyma (e.g., hippocampus and/or entorhinal cortex) of the subject. In other embodiments, the AAV encoding the inhibitor is administered Intravenously (IV). In any of the methods described herein, one administration (a single administration) or multiple administrations (any time interval between administrations) can be performed at each administration of the same or different dose. When administered multiple times, the same or different doses and/or modes of administration of the delivery vehicle (e.g., different AAV vectors administered IV and/or ICV) may be used. The methods include methods of reducing loss of muscle function, loss of physical coordination, muscle sclerosis, muscle spasm, loss of speech function, dysphagia, cognitive impairment, methods of reducing loss of motor function, and/or methods of reducing loss of one or more cognitive functions in a subject with ALS, all as compared to a subject not receiving the method, or as compared to the subject itself prior to receiving the method. Thus, the methods described herein result in a reduction in biomarkers and/or symptoms of rare diseases such as ALS or FTD, including one or more of the following: loss of muscle function, loss of body coordination, muscle sclerosis, muscle spasm, loss of language function, dysphagia, cognitive disorders, ALS-related blood and/or cerebrospinal fluid chemicals, including changes in G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1 alpha, TNF-alpha and VEGF levels (see Chen et al, Front Immunol. (2018)9:2122) and/or other biomarkers known in the art. In certain embodiments, the methods may further comprise administering one or more gene inhibitors of tau (mapt), e.g., in a subject with FTD. See, for example, U.S. patent publication No. 2018/0153921.

In any of the methods described herein, the allele-targeted suppressor can be a ZFP-TF, e.g., a fusion protein comprising a ZFP that specifically binds to the allele and a transcription suppressor domain (e.g., KOX, KRAB, etc.). In other embodiments, the allele-targeted suppressor can be a TALE-TF, e.g., a fusion protein comprising a TALE polypeptide that specifically binds to an allele of a gene and a transcription suppressor domain (e.g., KOX, KRAB, etc.). In some embodiments, the targeted allele inhibitor is CRISPR/Cas-TF, wherein the nuclease domain in the Cas protein has been inactivated such that the protein no longer cleaves DNA. The resulting CasRNA-guided DNA-binding domain is fused to a transcription repressor (e.g., KOX, KRAB, etc.) to repress the targeted allele. In some embodiments, the engineered transcription factor is capable of inhibiting the expression of a mutant allele but not a wild-type allele. In other embodiments, the DNA binding molecule preferentially recognizes the hexameric GGGGCC (SEQ ID NO:1) amplification.

In some embodiments, a sequence encoding a gene suppressor as described herein (e.g., ZFP-TF, TALE-TF, or CRISPR/Cas-TF) is inserted (integrated) into the genome, while in other embodiments, the sequence encoding the suppressor remains episomal. In some cases, the nucleic acid encoding the TF fusion is inserted at a safe harbor site comprising a promoter (e.g., via nuclease-mediated integration) such that expression is driven by the endogenous promoter. In other embodiments, a suppressor (TF) donor sequence is inserted (via nuclease-mediated integration) into the safe harbor site, and the donor sequence comprises a promoter that drives expression of the suppressor. In some embodiments, the promoter sequence is broadly expressed, while in other embodiments, the promoter is tissue or cell/type specific. In a preferred embodiment, the promoter sequence is specific for neuronal cells. In other embodiments, the promoter sequence is specific for a muscle cell. In some embodiments, the selected promoter is characterized by low expression. Non-limiting examples of suitable promoters include the nerve-specific promoters NSE, synapsin, CAMKiia, and MECP. Non-limiting examples of ubiquitous (ubiquitous) promoters include CMV, CAG, and Ubc. Other embodiments include the use of self-regulated promoters as described in U.S. patent publication No. 2015/0267205. Other embodiments include the use of self-regulated promoters as described in U.S. patent publication No. 2015/0267205.

In any of the methods described herein, the method can result in about 50% or greater, 55% or greater, 60% or greater, 65% or greater, about 70% or greater, about 75% or greater, about 85% or greater, about 90% or greater, about 92% or greater or about 95% or greater inhibition, 98% or greater or 99% or greater inhibition of the allele of interest (e.g., mutant or wild-type C9orf72) in one or more neurons of a subject (e.g., a subject with ALS). In certain embodiments, the expression of the wild-type allele is inhibited by no more than 50% in the subject (compared to an untreated subject), while the mutant allele is inhibited by at least 70% (70% or any value thereon) in the subject (compared to an untreated subject). In some embodiments, expression of the antisense promoter is inhibited by at least 70%. In certain embodiments, expression of antisense activators found in the region of intron 1a, 1b, and/or 1C of C9orf72 is inhibited by at least 70%, while expression of sense promoters in the region of intron 1b of C9orf72 is inhibited by no more than 50%.

In any of the methods described herein, the modulator (e.g., inhibitor or activator) can be delivered to the subject as a protein, a polynucleotide, or any combination of protein and polynucleotide. In certain embodiments, the one or more inhibitors are delivered using an AAV vector. In other embodiments, at least one component of the modulator (e.g., the sgRNA of the CRISPR/Cas system) is delivered in RNA form. In other embodiments, the modulator(s) are delivered using a combination of any of the expression constructs described herein, e.g., one inhibitor (or portion thereof) on one expression construct (AAV9) and one inhibitor (or portion thereof) on a separate expression construct (AAV or other viral or non-viral construct).

Furthermore, in any of the methods described herein, a modulator (e.g., inhibitor) can be delivered to a cell (ex vivo or in vivo) at any concentration (dose) that provides the desired effect. In some embodiments, the modulator is delivered at 10,000 to 500,000 vector genomes per cell (or any value therebetween) using an adeno-associated virus (AAV) vector. In certain embodiments, the modulator is delivered at an MOI of between 250 and 1,000 (or any value therebetween) using a lentiviral vector. In other embodiments, the modulator is delivered at 0.01 to 1,000 nanograms per 100,000 cells (or any value therebetween) using a plasmid vector. In other embodiments, the inhibitor is delivered as mRNA at 150 to 1,500 nanograms per 100,000 cells (or any value therebetween). Furthermore, for in vivo use, in any of the methods described herein, the genetic modulator(s) (e.g., inhibitor (s)) can be delivered at any concentration (dose) that provides the desired effect in a subject in need thereof. In some embodiments, the inhibitor is delivered at 10,000 to 500,000 vector genomes per cell (or any value therebetween) using an adeno-associated virus (AAV) vector. In certain embodiments, the inhibitor is delivered at an MOI of between 250 and 1,000 (or any value therebetween) using a lentiviral vector. In other embodiments, the inhibitor is delivered at 0.01 to 1,000 nanograms per 100,000 cells (or any value therebetween) using a plasmid vector. In other embodiments, the inhibitor is delivered as mRNA in a range of 0.01 to 3000 nanograms per cell number (e.g., 50,000 to 200,000 (e.g., 100,000) cells) (or any value therebetween). In other embodiments, the inhibitor is delivered to the brain parenchyma using an adeno-associated virus (AAV) vector at 1E11-1E14Vg/mL in a fixed volume of 1 to 300 μ L. In other embodiments, the inhibitor is delivered to the CSF using an adeno-associated virus (AAV) vector at 1E11-1E14Vg/mL in a fixed volume of 0.5 to 10 mL.

In any of the methods described herein, the method can result in modulation (e.g., inhibition) of about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more of the targeted allele(s) in one or more cells of the subject. In some embodiments, the wild-type and mutant alleles are modulated differently, such as the mutant allele is preferentially modified compared to the wild-type allele (e.g., the mutant allele is inhibited by at least 70% and the wild-type allele is inhibited by no more than 50%).

In any of the methods described herein, the method can result in modulation (e.g., inhibition) of antisense expression of the targeted allele(s) in one or more cells of the subject by about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more. In some embodiments, sense expression and antisense expression in the mutant allele are modulated differently, e.g., in the mutant allele expression of antisense transcript is preferentially modulated (e.g., antisense expression is inhibited by at least 70% and sense expression is inhibited by no more than 50%) compared to expression of sense transcript.

In other aspects, a transcription factor as described herein, such as a transcription factor comprising one or more of: zinc finger proteins (ZFP-TF), TALEs (TALE-TF), and CRISPR/Cas-TF, such as ZFP-TF, TALE-TF, or CRISPR/Cas-TF, are used to inhibit expression of a mutant and/or wild-type allele (e.g., C9orf72) in the brain (e.g., neurons) of a subject. Inhibition can be inhibition of a targeted allele in the one or more cells of a subject by about 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more, as compared to untreated (wild-type) cells of the subject. In certain embodiments, inhibition of the wild type allele is no more than 50% (compared to untreated cells or subjects) and inhibition of the mutant (lesion or isoform variant) is at least 70% (compared to untreated cells or subjects). In certain embodiments, antisense transcription is completely (fully) inhibited. In certain embodiments, inhibition of a sense transcript is no more than 50% (compared to an untreated cell or subject) and inhibition of an antisense transcript is at least 70% (compared to an untreated cell or subject). In certain embodiments, targeted modulation of transcription factors can be used to achieve one or more of the methods described herein.

Thus, described herein are methods and compositions for modulating gene expression associated with the rare disorders disclosed herein, including suppression with or without expression of exogenous sequences (such as artificial TF). The compositions and methods can be used ex vivo (e.g., to provide cells for studying (via modulation of) a gene of interest; for drug discovery; and/or to make genetically transgenic animals and animal models), in vivo, or ex vivo, and comprise administering an artificial transcription factor or nuclease comprising a DNA binding molecule targeted to a rare disease-associated gene, optionally in the case of a nuclease with a donor integrated into the gene following cleavage by the nuclease. In some embodiments, the donor gene (transgenic gene) is maintained extrachromosomally in the cell. In certain embodiments, the cell is in a disease patient. In other embodiments, the cell is modified by any of the methods described herein, and the modified cell is administered to a subject in need thereof (e.g., a subject with a rare disease). Also provided are genetically modified cells (e.g., stem cells, precursor cells, T cells, muscle cells, etc.) comprising a genetically modified gene (e.g., an exogenous sequence), including cells made by the methods described herein. These cells can be used to provide therapeutic protein(s) to a subject with a rare disease, for example, by administering the cell(s) to a subject in need thereof, or alternatively, by isolating the protein produced by the cell and administering the protein to a subject in need thereof (enzyme replacement therapy).

Also provided are kits comprising one or more of the following: a genetic modulator (e.g., an inhibitor) and/or a polynucleotide comprising a component of and/or encoding a modulator of interest (or a component thereof) as described herein. The kit can further comprise cells (e.g., neurons or muscle cells), reagents (e.g., for detecting and/or quantifying proteins, e.g., in CSF), and/or instructions for use including the methods as described herein.

The methods and compositions of the present invention are described in further detail below.

I. Zinc finger proteinsTranscription factor

The ZFP-TF of the invention is a fusion protein containing a DNA-binding Zinc Finger Protein (ZFP) domain and a transcriptional repressor domain, wherein the two domains can be associated with each other by a direct peptidyl linkage or a peptidic linker, or by a bipolymer (e.g., via a leucine zipper, STAT protein N-terminal domain, or FK506 binding protein). As used herein, "fusion protein" refers to a complex of polypeptides having covalently linked domains, and polypeptides that associate with each other via non-covalent bonds. The transcription repressor domain can be associated with the ZFP domain at any suitable location, including the C-terminus or N-terminus of the ZFP domain.

In some embodiments, the ZFP-TF of the invention inhibits transcription of the human mutant C9orf72 gene by 45% or more (e.g., 50%, 60%, 70%, 80%, 90%, or 95% or more). In some embodiments, two or more ZFP-TFs of the invention are used simultaneously in a patient, wherein the ZFP-TFs bind to different DNA motifs in the sense and/or antisense strand that amplify the C9orf72 region, in order to achieve optimal inhibition of transcription of the mutant C9orf 72.

Target of ZFP Domain

The ZFP domain of the fusion protein of the invention preferentially binds to the amplified region in the mutant human C9orf72 gene allele. The human C9orf72 gene is located at short (p) arm position 21.2(9p21.2) of chromosome 9. It spans base pairs 27,546,546 to 27,573,866 on this chromosome. The genomic structure of human C9orf72 is shown in fig. 1A. The DNA-binding ZFP domain of ZFP-TF directs the fusion protein to the amplified repeat region of the mutant C9orf72 gene and brings the transcriptional repressor domain of the fusion protein to the target region. The inhibitory domain then inhibits transcription of the C9orf72 gene by RNA polymerase.

In some embodiments, the length of the target sequence in the amplified region is at least 8 bp. For example, the target sequence may be 8 bp to 40 bp in length, such as 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp in length. In certain embodiments, the target sequence of a ZFP-TF of the invention is 12 to 20 (e.g., 12 to 18, 15 to 19, 15, 18, or 19) bp in length. In some embodiments, the target sequence comprises non-contiguous subsequences.

G₄C₂The repeat sequences give rise to the following six nucleotide DNA motifs in the sense and antisense strands of the gene:

motif in sense C9orf72 chain:

(i)GGGGCC(SEQ ID NO:1)

(ii)GGGCCG(SEQ ID NO:2)

(iii)GGCCGG(SEQ ID NO:3)

(iv)GCCGGG(SEQ ID NO:4)

(v)CCGGGG(SEQ ID NO:5)

(vi)CGGGGC(SEQ ID NO:6)

motif in antisense C9orf72 chain:

(vii)GGCCCC(SEQ ID NO:7)

(viii)GCCCCG(SEQ ID NO:8)

(ix)CCCCGG(SEQ ID NO:9)

(x)CCCGGC(SEQ ID NO:10)

(xi)CCGGCC(SEQ ID NO:11)

(xii)CGGCCC(SEQ ID NO:12)

in some embodiments, the target sequence of a ZFP-TF of the invention comprises one or more (e.g., 2, 3, or 4) tandem repeats of these DNA motifs. In some embodiments, the target sequence consists of three tandem repeats of one of the motifs. In some embodiments, the target sequence comprises one or more (e.g., 2 or 3) tandem repeats of the motif, plus several (e.g., 1, 2, 3, 4, or 5) nucleotides (e.g., CC (G) from upstream and/or downstream adjacent sequences₄C₂)₂GG)(SEQ ID NO:75)。

The target sequence may be on the sense strand of the gene or the antisense strand of the gene. In certain embodiments, the ZFP-TF used in the patient binds to both the sense and antisense strands of the mutant allele. To ensure targeting accuracy and to reduce off-target binding of ZFP-TF, the sequence of the selected C9orf72 target region preferably has less than 75% homology (e.g., less than 70%, less than 65%, less than 60%, or less than 50% homology) to sequences in other genes in the genome.

Other criteria for further evaluating target segments include the previous availability of ZFPs to bind to such segments or related segments, the ease of designing new ZFPs to bind a given target segment, and the risk of off-target binding.

B. Zinc finger protein domains

"zinc finger protein" or "ZFP" refers to a protein having a DNA binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Individual DNA binding domains are referred to as "fingers". ZFPs have at least one finger, each finger binding two to four DNA base pairs, typically three or four DNA base pairs. Each zinc finger typically comprises approximately 30 amino acids and is chelated to zinc. Engineered ZFPs can have novel binding specificities compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, the use of databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, wherein each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of a zinc finger that binds to a particular triplet or quadruplet sequence. See, e.g., ZFP design methods described in detail below: us patent 5,789,538; 5,925,523, respectively; 6,007,988, respectively; 6,013,453, respectively; 6,140,081, respectively; 6,200,759, respectively; 6,453,242; 6,534,261; 6,979,539, respectively; 8,586,526, respectively; 8,841,260, respectively; 8,956,828; and 9,234,016; and International patent publication No. WO 95/19431; WO 96/06166; WO 98/53057; WO 98/53058; WO 98/53059; WO 98/53060; WO 98/54311; WO 00/27878; WO 01/60970; WO 01/88197; WO 02/016536; WO 02/099084; and WO 03/016496.

The ZFP domains of the ZFP-TFs of the invention can include at least three (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or more) zinc fingers. ZFP domains with three fingers typically recognize target sites that include 9 to 12 nucleotides. ZFP domains with four fingers typically recognize target sites that include 12 to 15 nucleotides. ZFP domains with five fingers typically recognize target sites that include 15 to 18 nucleotides. A ZFP domain with six fingers can recognize a target site that includes 18 to 21 nucleotides.

The target specificity of the ZFP domain can be increased by mutations to the ZFP backbone, as described, for example, in U.S. patent publication 2018/0087072. Mutations include mutations made to residues in the ZFP backbone that can interact non-specifically with phosphates on the DNA backbone, but are not involved in nucleotide target specificity. In some embodiments, the mutations comprise mutations of cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, the mutations comprise mutations of polar amino acid residues to neutral or non-polar amino acid residues. In other embodiments, the mutation is at position (-5), (-9), and/or (-14) relative to the DNA binding helix. In some embodiments, the zinc finger may comprise one or more mutations at positions (-5), (-9), and/or (-14). In other embodiments, one or more zinc fingers in a multi-finger ZFP domain may comprise a mutation at position (-5), (-9), and/or (-14). In some embodiments, amino acids (e.g., arginine (R) or lysine (K)) at positions (-5), (-9), and/or (-14) are mutated to alanine (a), leucine (L), ser(s), asp (n), glu (e), tyr (y), and/or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q.

Alternatively, the DNA binding domain may be derived from a nuclease. For example, recognition sequences for homing endonucleases and meganucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII are known. See also U.S. patent nos. 5,420,032 and 6,833,252; belfort et al, Nucleic Acids Res. (1997)25: 3379-88; dujon et al, Gene (1989)82: 115-8; perler et al, Nucleic Acids Res. (1994)22: 1125-7; jasin, Trends Genet (1996)12: 224-8; gimble et al, J Mol Biol. (1996)263: 163-80; argast et al, J Mol Biol. (1998)280: 345-53; and New England biologies laboratories (New England Biolabs) catalog.

In some embodiments, the ZFP-TF of the invention comprises one or more zinc finger domains. The domains may be linked together via extendable flexible linkers such that, for example, one domain includes one or more (e.g., 4, 5, or 6) zinc fingers and the other domain includes one or more (e.g., 4, 5, or 6) other zinc fingers. In some embodiments, the linker is a standard inter-finger linker, such that the array of fingers comprises one DNA binding domain comprising 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a flexible linker. For example, two ZFP domains can be linked to the transcription repressor TF in the following configuration (N-terminal to C-terminal): ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins are fused together via a linker).

In some embodiments, the ZFP-TF is "two-handed", i.e., it contains two zinc finger clusters (two ZFP domains) separated by an intermediate amino acid, such that the two ZFP domains bind to two non-contiguous target sites. An example of a two-handed zinc finger binding protein is SIP1, in which a cluster of four zinc fingers is located at the amino-terminus of the protein and a cluster of three fingers is located at the carboxy-terminus (see Remacle et al, EMBO J. (1999)18(18): 5073-84). Each cluster of zinc fingers in these proteins is capable of binding to a unique target sequence, and the space between two target sequences may comprise many nucleotides.

In an alternative embodiment, a protein functionally similar to ZFP-TF may be used in place of ZFP-TF. For example, a transcription repressor fusion protein can include a DNA binding domain derived from a transcriptional activator, such as an effector (TALE) DNA binding domain, rather than a ZFP domain. See, e.g., U.S. patents 8,586,526 and 9,458,205; U.S. patent publications 2013/0196373 and 2013/0253040; WO 2010/079430; schornack et al, J Plant Physiol (2006)163(3): 256-72); kay et al, Science (2007)318: 648-51; moscou and Bogdannove, Science (2009)326: 1501; and Boch et al, Science (2009)326: 1509-12. In another example, the transcription repressor fusion protein can include a DNA binding domain that is a single guide RNA of the CRISPR/Cas system. See, e.g., U.S. patent publication 2015/0056705; jinek et al, Science (2012)337: 816; ramalingam et al, Genome Biol. (2013)14: 107; hwang et al (2013) Nature Biotechnology 31(3): 227.

C. Transcriptional repressor domain

The ZFP-TF of the invention comprises one or more transcriptional repressor domains that attenuate the transcriptional activity of the mutant C9orf72 allele. Non-limiting examples of transcriptional repressor domains are the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGF-beta inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, DNMT family members (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP 2. See, e.g., Bird et al, Cell (1999)99: 451-54; tyler et al, Cell (1999)99: 443-46; knoepfler et al, Cell (1999)99: 447-50; robertson et al, Nature Genet, (2000)25: 338-42. Further exemplary suppression domains include, but are not limited to, ROM2 and AtHD 2A. See, e.g., Chem et al, Plant Cell (1996)8: 305-21; and Wu et al, Plant J. (2000)22: 19-27.

In some embodiments, the transcription repressor domain comprises the sequence of the Kruppel-associated box (KRAB) domain from human zinc finger protein 10/KOX1(ZNF10/KOX1) (e.g., GenBank accession No. NM-015394.4). Exemplary KRAB domain sequences are:

DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPD VILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV

(SEQ ID NO:13)。

variants of this KRAB sequence may also be used, provided they have the same or similar transcription repression function.

D. Peptide linker

The ZFP domains and transcription repressor domains of the ZFP-TF of the invention and/or the zinc fingers within the ZFP domains may be connected via a peptide linker, such as a non-cleavable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are flexible amino acid sequences synthesized as recombinant fusion proteins. See, e.g., the description above; and U.S. patent 6,479,626; 6,903,185, respectively; 7,153,949, respectively; 8,772,453, respectively; and 9,163,245; and WO 2011/139349. The proteins described herein can include any combination of suitable linkers. Non-limiting examples of linkers are DGGGS (SEQ ID NO:14), TGEKP (SEQ ID NO:15), LRQKDGERP (SEQ ID NO:16), GGRR (SEQ ID NO:17), GGRRGGGS (SEQ ID NO:18), LRQRDGERP (SEQ ID NO:19), LRQKDGGGSERP (SEQ ID NO:20), LRQKD (G ID NO:20) ₃S)₂ERP (SEQ ID NO:21), TGSQKP (SEQ ID NO:22), LRQKDAARGS (SEQ ID NO:26) and LRQKDAARGSGG (SEQ ID NO: 76).

In some embodimentsThe peptide linker is 3 to 20 amino acid residues in length and is rich in G and/or S. A non-limiting example of such a linker is G₄S-shaped linker (' G)₄S "is disclosed as SEQ ID NO:23), i.e., a linker containing one or more (e.g., 2, 3, or 4) GGGGS (SEQ ID NO:23) motifs or variants of motifs, such as those having one, two, or three amino acid insertions, deletions, and substitutions in the motif.

In some embodiments, the ZFP-TF comprises a nuclear localization signal (e.g., from the SV40 mid T antigen) and/or an epitope tag (e.g., FLAG and hemagglutinin).

Expression of ZFP-TF

The ZFP-TF of the present disclosure can be introduced into a patient via a nucleic acid molecule encoding the same. For example, the nucleic acid molecule is an RNA molecule, and the RNA molecule is introduced into the brain of the patient via injection of a composition comprising a lipid-nucleic acid complex (e.g., a liposome). Alternatively, the ZFP-TF can be introduced into the patient via a nucleic acid expression vector comprising the coding sequence of the ZFP-TF. The expression vector can include expression control sequences (such as promoters, enhancers), transcription signal sequences, and transcription termination sequences that allow the coding sequence of the ZFP-TF to be expressed in cells of the nervous system (e.g., the central nervous system). In some embodiments, the expression vector persists in the cell in the form of a stable episome (episome). In other embodiments, the expression vector is integrated into the genome of the cell.

In some embodiments, the promoter on the vector used to direct expression of ZFP-TF in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, the Rous Sarcoma Virus (RSV) Long Terminal Repeat (LTR) promoter (optionally accompanied by a RSV enhancer), the Cytomegalovirus (CMV) promoter (optionally accompanied by a CMV enhancer), the CMV immediate early promoter, the monkey virus 40(SV40) promoter, the dihydrofolate reductase (DHFR) promoter, the β -actin promoter, the phosphoglycerate kinase (PGK) promoter, the EFl α promoter, the Moloney murine leukemia virus (MoMLV) LTR, the creatine kinase (CK6) based promoter, the thyroxine transporter promoter (TTR), the Thymidine Kinase (TK) promoter, the tetracycline responsive promoter (TRE), the Hepatitis B Virus (HBV) promoter, the human α 1-antitrypsin (hAAT) promoter, the chimeric Liver Specific Promoter (LSP), the E2 factor (E2F) promoter, the tetracycline responsive promoter (TRE), The human telomerase reverse transcriptase (hTERT) promoter, the CMV enhancer/chicken β -actin/rabbit β -globin promoter (CAG promoter; Niwa et al, Gene (1991)108(2):193-9) and the RU-486-responsive promoter. Neuron-specific promoters such as the synapsin I promoter, the calcium/calcitonin-dependent protein kinase ii (camkii) promoter, the methyl CpG-binding protein 2(MeCP2) promoter, the choline acetyltransferase (ChAT) promoter, and the calbindin (Calb) promoter may also be used. Stellate cell-specific promoters may also be used, such as the Glial Fibrillary Acidic Protein (GFAP) promoter or the aldehyde dehydrogenase family 1 member L1(Aldh1L1) promoter. Oligodendrocyte-specific promoters, such as Olig2 promoter, may also be used. In addition, the promoter may include one or more self-regulatory elements whereby ZFP-TF can bind and repress its expression level to a pre-determined threshold. See us patent 9,624,498.

Any method of introducing a nucleotide sequence into a cell can be used, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes combined with a nuclear localization signal, naturally occurring liposomes (e.g., exosomes), or viral transduction.

For in vivo delivery of expression vectors, viral transduction may be used. A variety of viral vectors known in the art may be suitable for use in the present invention, such as vaccinia vectors, adenoviral vectors, lentiviral vectors, poxviral vectors, herpesvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, and hybrid viral vectors. In some embodiments, a viral vector as used herein is a recombinant aav (raav) vector. AAV vectors are particularly useful for Central Nervous System (CNS) gene delivery because AAV infects both dividing and non-dividing cells and has very low immunogenicity, and the viral genome is present in the form of stable episomal structures for long-term expression (Hadaczek et al, Mol Ther. (2010)18: 1458-61; Zaiss et al, Gene Ther. (2008)15: 808-16). Any suitable AAV serotype may be used. For example, the AAV may be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or have a pseudotype (e.g., AAV2/8, AAV2/5, AAV2/6, AAV2/9, or AAV 2/6/9). See, for example, U.S. patents 7,198,951 and 9,585,971.

In some embodiments, the expression vector is an AAV vector and is introduced into a target human cell by a recombinant AAV virion whose genome comprises a construct comprising AAV Inverted Terminal Repeat (ITR) sequences at both ends such that the AAV virion can be produced in a production system such as an insect cell/baculovirus production system or a mammalian cell production system. AAV can be engineered such that its capsid protein has reduced immunogenicity and enhanced transduction potential in humans. In some embodiments, AAV9 is used. The viral vectors described herein can be produced using methods known in the art. Any suitable permissive or packaging cell type may be used to produce viral particles. For example, mammalian (e.g., 293) insect (e.g., Sf9) cells can be used as packaging cell lines.

For methods of expressing therapeutic proteins, including ZFPs, in the nervous system of a patient in need thereof, see also us patent 6,309,634; 6,453,242; 6,503,717, respectively; 6,534,261; 6,599,692, respectively; 6,607,882, respectively; 6,689,558, respectively; 6,824,978, respectively; 6,933,113, respectively; 6,953,575, respectively; 6,979,539, respectively; 7,013,219, respectively; 7,163,824, respectively; 7,182,944, respectively; 8,309,355, respectively; 8,337,458, respectively; 8,586,526, respectively; 9,050,299, respectively; and 9,089,667.

Pharmaceutical use

The ZFP-TF of the invention can be used to treat patients in need of downregulation of C9orf72 expression, in particular downregulation of mutant C9orf72 allele expression. The patient has or is at risk of developing a C9orf 72-associated neurodegenerative disease (such as ALS and C9 FTD). Patients at risk include patients who are genetically predisposed to disease, patients who suffer from repeated brain injuries (such as concussions), and patients who have been exposed to environmental neurotoxins. The invention provides methods of treating a C9orf 72-associated neurological disease (e.g., ALS and C9FTD) in a subject (such as a human patient in need thereof), comprising introducing into the nervous system (e.g., CNS) of the subject a therapeutically effective amount (e.g., an amount such that expression of a mutant C9orf72 allele can be sufficiently inhibited) of ZFP-TF (e.g., a rAAV vector expressing the same). The term "treating" encompasses alleviating symptoms, preventing the onset of symptoms, slowing disease progression, improving quality of life, and improving survival.

The invention provides pharmaceutical compositions comprising a viral vector, such as a rAAV whose recombinant genome comprises an expression cassette for ZFP-TF. The pharmaceutical composition can further comprise a pharmaceutically acceptable carrier, such as water, physiological saline (e.g., phosphate buffered physiological saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. In addition, the compositions may contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, stabilizing agents or other agents that enhance the effectiveness of the pharmaceutical compositions. The pharmaceutical compositions may contain delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles and vesicles.

The cells targeted by the therapeutic agents of the present invention are cells in the brain and/or spinal cord, including, but not limited to, neuronal cells (e.g., motoneurons, sensory neurons, dopaminergic neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons); glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglial cells); ependymal cells; or a neuroepithelial cell. The targeted brain regions may be the cortical region, frontotemporal lobe region, entorhinal cortex, hippocampus, cerebellum, pons and medulla. These regions may be reached directly via an intra-hippocampal injection, intracerebral injection, Intracisternal (ICM) injection, or more generally via an intraparenchymal injection, Intracerebroventricular (ICV) injection, intrathecal injection, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, the viral vector is spread throughout CNS tissue following direct administration to cerebrospinal fluid (CSF), e.g., via intrathecal and/or intracerebral or intracisternal or intracerebroventricular injection. In other embodiments, following intravenous administration, the viral vector crosses the blood-brain barrier and achieves widespread distribution throughout the CNS tissue of the subject. In other embodiments, the viral vector is delivered directly to the target region via intraparenchymal injection into the brain. In some cases, following intraparenchymal delivery, viral vectors may undergo retrograde or anterograde transport to other brain regions. In some aspects, the viral vectors have unique CNS tissue targeting capabilities (e.g., CNS tissue tropism) that achieve stable and avirulent gene transfer with high efficiency.

By way of example, the pharmaceutical composition may be provided to the patient via intraventricular administration, e.g., to a ventricular region of the patient's forebrain, such as the right, left, third or fourth ventricle. The pharmaceutical composition can be provided to the patient via intracerebral administration, e.g., injection of the composition into or near the brain, medulla, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid, or pia mater of the brain. In some cases, intracerebral administration may include administering an agent into the cerebrospinal fluid (CSF) of the subarachnoid space surrounding the brain.

In some cases, intracerebral administration involves the use of stereotactic surgical injection. Stereotactic surgery is well known in the art and generally involves the use of a computer and three-dimensional scanning device that together are used to direct injections to a particular intracerebral region, such as the ventricular region. Microinjection pumps (e.g., from World Precision Instruments) may also be used. In some cases, a microinjection pump is used to deliver the composition comprising the viral vector. In some cases, the infusion rate of the composition is in the range of 1 microliter/minute to 100 microliter/minute. As will be appreciated by those skilled in the art, the rate of infusion will depend on a variety of factors including, for example, the age of the subject, the weight/size of the subject, the serotype of the AAV, the desired dose, and the region within the brain targeted. Thus, other infusion rates may be deemed appropriate by those skilled in the art in certain circumstances.

Delivery of rAAV to a subject can be achieved, for example, by intravenous administration. In some cases, it may be desirable to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neuronal cells, glial cells, meninges, astrocytes, oligodendrocytes, interstitial spaces, and the like. In some cases, the treatment may be by injection into the ventricular region and/orInjection into the hippocampus, cortex, cerebellar lobules, or other brain regions, recombinant AAV (e.g., 10)⁷-10¹⁵Vg/dose) is delivered directly to the CNS. AAV can be delivered using a needle, catheter, or related device, using neurosurgical techniques known in the art, such as by stereotactic injection. See, e.g., Stein et al, JVir, (1999)73: 3424-9; davidson et al, PNAS (2000)97: 3428-32; davidson et al, NatGenet, (1993)3: 219-; and Alisky and Davidson, hum. GeneTher. (2000)11: 2315-29; U.S. Pat. Nos. 7,837,668 and 8,092,429.

Unless otherwise defined herein, scientific and technical terms used in connection with the present invention will have the meanings that are commonly understood by those of skill in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. In case of conflict, the present specification, including definitions, will control. Generally, the nomenclature used in connection with, and the techniques of, neurology, medicine, medical and medicinal chemistry and cell biology described herein are those well known and commonly employed in the art. Enzymatic reactions and purification techniques are generally accomplished as is commonly practiced in the art or as described herein according to the manufacturer's instructions. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the examples, the words "have" and "comprise", or variations such as "has/has", "comprises/comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although reference may be made in this text to a number of documents, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art. As used herein, the term "about" as applied to one or more values of interest refers to a value that is similar to the stated reference value. In certain embodiments, unless stated otherwise or otherwise apparent from the context, the term refers to a range of values within (greater than or less than) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of) any of the stated reference values.

In order that the invention may be better understood, the following embodiments and examples are set forth. These implementations and examples are for illustrative purposes only and should not be construed as limiting the scope of the invention in any way.

Exemplary embodiments

Non-limiting exemplary embodiments of the invention are described below.

1. A method of inhibiting sense and/or antisense transcription of a C9orf72 gene in a cell, the method comprising treating the cell with one or more C9orf72 gene repressors comprising a transcription repressor domain and a DNA binding domain that binds to a target site in the C9orf72 gene, optionally wherein the one or more repressors comprise one or more zinc finger protein transcription factors (ZFP-TF), one or more TAL effector domain transcription factors (TALE-TF), and/or one or more CRISPR/Cas transcription factors.

2. The method of embodiment 1, wherein the C9orf72 gene comprises one or more amplifications (G)₄C₂) Mutant alleles of repetitive sequences, optionally wherein the target site is amplified at one or more (G)₄C₂) Within a repetitive sequence.

3. Bound to a peptide containing one or more (G)₄C₂) Use of a mutant C9orf72 of a repeat sequence to amplify one or more ZFP-TF, TALE-TF, and/or CRISPR/CasTF inhibitors of an allele for inhibiting sense and/or antisense transcription in a subject in need thereof.

4. The method or use of any of the preceding embodiments, wherein antisense transcription is inhibited by at least 50% compared to untreated cells.

5. The method or use of any of the preceding embodiments, wherein antisense transcription is inhibited by at least 70% compared to untreated cells.

6. The method or use of any one of the preceding embodiments, wherein transcripts comprising said amplification repeats are selectively inhibited, optionally wherein antisense transcription is inhibited, sense transcription from the 1a promoter is inhibited and/or sense transcription from the 1b promoter is not inhibited.

7. The method or use of any of the preceding embodiments, wherein the one or more ZFP-TF inhibitors comprise ZFPs having recognition helical regions in the order shown in table 1.

8. The method or use of any of the preceding embodiments, wherein the one or more ZFP-TF inhibitors are administered to the cell as mRNA or using a viral vector.

9. The method or use of embodiment 8, wherein the viral vector is an Ad or AAV vector.

10. The method or use of embodiment 9, wherein the AAV vector is an AAV2/9 vector.

11. The method or use of any of the preceding embodiments, wherein the cell is in a living subject and the one or more ZFP-TF inhibitors are administered to the subject.

12. The method or use of embodiment 11, wherein the one or more ZFP-TF inhibitors are administered intraventricularly, intrathecally, intracranially, Retroorbitally (RO), intravenously, intranasally, and/or intracisternally to the brain of the subject.

13. The method or use of embodiment 12, wherein the ZFP-TF inhibitor is administered to the subject's hippocampus unilaterally or bilaterally, optionally using an AAV vector at a dose of 1E10 to 1E13 (e.g., 6E11) vg/hemisphere.

14. The method or use of any one of the preceding embodiments, wherein the cell is a neuron.

15. The method or use of any of the previous embodiments, wherein two more ZFP-TF inhibitors are administered.

16. The method or use of embodiment 15, wherein the two or more ZFP-TF inhibitors are supported on the same or different non-viral or viral vectors.

17. The method or use of any one of the preceding embodiments, wherein the subject is being treated for ALS and/or FTD.

18. The method or use of any one of the preceding embodiments, wherein one or more symptoms of ALS and/or FTD are ameliorated in the subject.

19. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 78021.

20. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in a single column of table 1, wherein the SBS ID is 75114.

21. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 75115.

22. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 74969.

23. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79895.

24. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79898.

25. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 74986.

26. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79899.

27. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79901.

28. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79902.

29. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79904.

30. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79916.

31. A ZFP-TF fusion protein that binds to a target sequence and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 75027.

32. A ZFP-TF fusion protein that binds to a sequence of interest and comprises a zinc finger corresponding to an SBS ID as shown in table 1, the zinc finger comprising a DNA-binding (recognition) helix sequence of the SBS ID shown in the single column of table 1, wherein the SBS ID is 79921.

33. The ZFP-TF fusion protein of any of embodiments 19 to 32, wherein the ZFP-TF fusion protein comprises a transcription repressor domain comprising SEQ ID NO 13.

34. The ZFP-TF fusion protein of any of embodiments 19 to 33, wherein the zinc finger domain and the transcription repressor domain are connected by a peptide linker comprising SEQ ID NO: 26.

Examples

Example 1: artificial transcription inhibitors

A panel of ZFP-TFs was generated to target amplification of the human C9orf72 allele. Exemplary ZFP-TFs are shown in table 1 below. These ZFP-TF each contain a ZFP domain with six fingers and a KRAB domain as described above (SEQ ID NO: 13). Peptide linkers were used to link the ZFP domain to the KRAB domain. The linker has the following amino acid sequence: LRQKDAARGS (SEQ ID NO: 26).

Table 1 shows the DNA sequence of the target site in each ZFP-TF and the amino acid sequence of the DNA binding helix of each zinc finger (F1 to F6). SEQ ID NO is shown in parentheses. The target sequences in the target site bound by the ZFP domain are shown in upper case letters, while flanking sequences are shown in lower case letters. SEQ ID NO. 24 is the target site on the sense strand of the gene allele and SEQ ID NO. 25 is the target site on the antisense strand of the gene allele.

DNA binding helices are variable portions of zinc fingers and typically contain six or seven amino acid residues. The target specificity of the ZFP domain can be increased by mutations to the ZFP backbone, as described, for example, in U.S. patent publication 2018/0087072. The symbol "^" in the table indicates that the arginine (R) residue at position 4 upstream of the 1 st amino acid in the designated helix is changed to glutamine (Q). In each zinc finger helix sequence, the seven DNA binding amino acids are numbered-1, +2, +3, +4, +5, and + 6. Thus, the position of R to Q substitution is numbered (-5).

Exemplary C9orf72ZFP-TF of Table 1

ZFP-TF was evaluated by standard SELEX analysis (see, e.g., Miller et al, Nat Biotech. (2010) doi: 10.1038/nbt.1755; Wilen et al, PLoS (2011)7(4): e 1002020). All ZFP-TF was shown to bind to their target site.

Five types of human cell lines and one mouse cell line were used in the study. C9021 fibroblast cell line was obtained from the university of columbia ALS institute) and was derived from ALS-FTD patients. The cell line contains 5G's on its normal allele₄C₂A repeat sequence and contains approximately 850 repeats on its amplified allele. Wild type fibroblast cell lines (NDS00035), 353TRAD and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. Wild type lines contain two G's on each allele₄C₂The sequence is repeated. The 353TRAD line contains 5 repeats on one allele and 8 repeats on the other allele. 204TDP has 2 repeats on one allele and 20 repeats on the other allele. For all fibroblast experiments, human neuronal lines were obtained from Cell Dynamics International (iCell GABANeurons kit, 01434; catalog No. R1013; Cell batch No. 104901). Mouse cortical neurons were obtained from GIBCO (catalog number a 15586). ZFP74960, which binds to its target region but does not have observable inhibitory effect, was used as a negative control.

For all experiments performed in patient-derived fibroblasts, transfection of ZFP-TF mRNA into cells was performed using a 96-well Shuttle Nucleofector system from Lonza. 1, 3, 10, 30, 100 and 300ng ZFP-TF mRNA per 40,000 Cells were transfected with the CA-137 program using the Amaxa P2 Primary Cells Nuclear effector kit. After overnight incubation, the Cells-to-Ct kit (Thermo Fisher Scientific) was used to generate cDNA from transfected Cells, followed by gene expression analysis using qRT-PCR.

For neuronal transduction, ZFPs were entered into AAV6 plasmids. Neurons were transduced with AAV 6-ZFP. All transduction was performed at 3,000 MOI. Mouse neurons were collected 7 days post transduction, while human neurons were collected 19 days post transduction. After the cells are collected, they are processed for microarray analysis.

Screening assays were performed in multiple rounds. In each round, ZFPs were tested at multiple concentrations to identify ZFP-TFs with an on-target (selective inhibition) pattern appropriate for the target. Round 2 screens were performed in C9(C9021) cells to assess amplified sense transcript (disease) C9orf72 levels relative to total C9orf72 ("total C9") mature mRNA after ZFP-TF treatment. RT-PCR analysis used a primer/probe set targeting intron region 1 a.

Amplifying the sense C9orf72 transcript:

forward direction: 5'CCCTCTCTCCCCACTACTTG 3' (SEQ ID NO:61)

And (3) reversing: 5'CTACAGGCTGCGGTTGTTTCC 3' (SEQ ID NO:62)

And (3) probe: 5'TCTCACAGTACTCGCTGAGGGTGA 3' (SEQ ID NO: 63).

G₄C₂Amplification resulted in inefficient splicing and accumulation of precursor mRNA containing the amplification (fig. 2A). In contrast, the highly spliced wild-type (WT) pre-mRNA is present at very low levels. By using this assay in C9021 cells, we show that the ZFP-TF tested showed a broad range of inhibition of amplifying the sense (disease) C9orf72 transcript. (FIG. 2B to FIG. 2D).

To assess inhibition of total C9orf72mRNA, different primer/probe sets, denoted "total C9" (fig. 2A), were used:

total C9orf72 mRNA:

forward direction: 5'CTATGTGTGTGGTGGGATATGG 3' (SEQ ID NO:58)

And (3) reversing: 5'CTCCAGGTTATGTGAAGCAGAA 3' (SEQ ID NO:59)

And (3) probe: 5'AGGCCTGCTAAAGGATTCAACTGGAA 3' (SEQ ID NO: 60).

This primer/probe set can detect mRNA comprising regions spanning exons 8 and 9. This region is present in all C9orf72mRNA isoforms. As shown in fig. 2b, many ZFP-TFs showed modest inhibition of total C9orf72 transcripts. For example, ZFP-TF 75114 and 75115 inhibited amplification of sense (disease) transcripts by more than 70%, while keeping total C9orf72mRNA expression by more than 50% (fig. 2D, round 2 data).

In round 3, total C9orf72mRNA was evaluated and compared between C9021 cells and Wild Type (WT) cells in order to further evaluate the effect of the tested ZFP-TF on the amount of total C9orf72 mRNA. The data show that the reduction in total C9orf72mRNA levels in mutant cells was much more pronounced than in WT cells (fig. 2B-2D), and that the levels were much less affected in wild-type cells treated with the same ZFP-TF. The overall data demonstrates that for some ZFPs, such as 75109, 75114, and 75115, expansion isoforms were significantly inhibited (about 70%), while maintaining about 50% of the total C9 transcripts of the C9 patient fibroblast cell line.

Isoform-selective inhibition of ZFP-TF75109, 75114 and 75115 was evaluated in three different patient-derived fibroblasts containing different G on their amplification alleles₄C₂Repeat sequences (600, 800 and 850) were amplified (fig. 6). All three ZFPs exhibited similar behavior independent of repeat amplification length, indicating that selective inhibition of ZFP-TF was independent of G4C2 repeat length.

Evaluation of inhibition of total C9 transcript in two cell lines from healthy individuals, the cell line having G on its allele ₄C₂The number of repeats was greater than normal (FIG. 7). In healthy cell lines, total C9 transcripts were minimally affected. ZFP-mediated inhibition of total C9mRNA transcripts in patient-derived cell lines (C9021) did not truly represent WT isoform levels, since PCR analysis was used to detect total C9mRNA transcript target exons 8 and 9, which left off in both amplified and non-amplified (WT) isoforms (fig. 2A). With different G on alleles₄C₂Total C9mRNA transcript inhibition in response to isoform-selective ZFP-TF (75109, 75114 and 75115) was assessed in two different healthy cell lines of repeat length (fig. 7).Cell line 353TREAD has 5 repeats on one allele and 8 repeats on the other allele, while cell line 204TDP has 2 repeats on one allele and 20 repeats on the other allele. Although total C9mRNA transcript was inhibited in a dose-dependent manner in C9 cell line C921 (5 repeats on the non-amplified allele and 850 repeats on the amplified allele), it was minimally affected in the other two cell lines without amplified alleles, indicating the result of inhibition of the amplification isoform by the inhibitory line of total C9 isoform in the disease line (5/850) and that expression of the non-amplified isoform was not affected by the selective ZFP-TF (fig. 7).

Without being bound by theory, it is possible that the ZFP-TF of the invention can act in a cooperative manner to selectively inhibit alleles having a large number of repeated sequences. It can be mediated by a high order (higher-order) complex, for example, via recruitment of KAP1 co-inhibitors associated with the KRAB domain linked to the ZFP. Under this assumption, the KAP1/KRAB "scaffold" spanning multiple ZFP-TFs increased the stability of the transcriptional repression mechanism and enabled preferential suppression of the amplified C9orf72 allele compared to the wild-type allele.

Example 2: specificity of C9orf72 inhibition

The global specificity of ZFP-TF shown in table 1 was assessed by microarray analysis in 3 cell lines as follows: c9021 fibroblasts, primary mouse cortical neurons, and human neurons. Briefly, for C9021 cells, 100ng ZFP-TF encoding mRNA was transfected in quadruplicate into 150,000C 9021 cells. After 24 hours, total RNA was extracted and processed via the manufacturer's protocol (Affymetrix Genechip MTA 1.0). Robust Multi-array averaging (RMA) was used to normalize the raw signals from each probe set. Analysis was performed using the Transcriptome Analysis Console3.0(Affymetrix) with the "Gene Level Differential Expression Analysis" option. The ZFP-TF transfected samples were compared to samples that had been treated with unrelated ZFP-TF (ZFP-TF that did not bind to the C9orf72 target site). For transcripts (probe sets) with mean signal > 2-fold difference versus control, and P-value <0.05 (single factor variability analysis, unpaired T assay for each probe set) reported change calls (call). Neurons were subjected to a similar procedure, except that they were transduced at 3000MOI with AAV6 and cultured for 7 days for mouse neurons and 19 days for human neurons, followed by collection.

Exemplary data are shown in fig. 8A-8C. The data show that ZFP-TF75027 exhibits several off-targets (off-targets) in addition to C9orf72 (shown circled), whereas ZFP-TF75109, 75114, and 75115 inhibit only C9orf72, with little off-targets in both fibroblasts and neurons in both humans and mice. These results demonstrate that representative ZFP-TF is highly specific for C9orf 72.

Example 3: detection of antisense specific inhibition

Since sense and antisense transcripts are encoded by overlapping regions of DNA, we developed detection strategies based on differential processing of transcripts. For sense mRNA from amplified alleles, the intron containing the amplified region (intron 1a) was mis-spliced and retained, while all other introns were removed, including intron 1 b. In contrast, the intron 1b region is the predicted exon of the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b and exhibited specific detection of antisense transcripts, as described further below.

To detect C9orf72 transcripts, we used droplet digital pcr (ddpcr). Briefly, to establish sense or antisense cDNA templates, RNA was purified from C9orf72 patients and healthy control cells (C9orf72 cell line: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control cell lines: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con 1; see Lagier-Tourene et al, PNAS (2013)110(47): E4530-9) and cDNA was synthesized using Superscript III (Thermo Fischer Scientific) first strand synthesis system as follows:

1) Mu.g of RNA, 0.5. mu.L of 10mM strand specific primer and dNTP mix were mixed and made up to 10. mu.L with water. To generate a sense template, primer 5'CTCTAGCGACTGGTGGAATTG3' (SEQ ID NO:64) was used. To generate the antisense template, primer 5'GTGCATGGCAACTGTTTGAATA3' (SEQ ID NO:65) was used.

2) The reaction was incubated at 65 ℃ for 5 minutes for denaturation and placed on ice for at least 1 minute.

3) cDNA synthesis mixtures were prepared using these reagents: 10XRT buffer (2. mu.L); 25mM MgCl2 (4. mu.L); 0.1M DTT (2. mu.L); RNase OUT (1. mu.L); superscript III (1. mu.L).

4) 10 μ L of this reaction was added to the RNA mixture and incubated at 50 ℃ for 50 minutes. The reaction was then inactivated by incubation at 85 ℃ for 5 minutes.

The template is then subjected to ddPCR using labeled probes according to the manufacturer's protocol. Briefly, PCR reactions were performed in ABI PCR 96-well plates using probes with ddPCR superscript without dUTP (Bio-Rad). The PCR master mix was prepared according to the manufacturer's instructions. The antisense primer-probe set located on the intron 1b region is shown below (FIG. 3).

Forward direction: 5'CAAAGCCTGGTGGTGTTCAA 3' (SEQ ID NO:66)

And (3) reversing: 5'GGACATGACCTGGTTGCTTC 3' (SEQ ID NO:67)

And (3) probe: 5'CGCGGCCAGATAGACCCAATGAGCA 3' (SEQ ID NO: 68).

The reaction was set up as follows:

1) the entire master mix was evenly distributed in 8 wells of ABI PCR plates.

2) mu.L of 1:10 diluted RT reaction or water was added to the sample wells.

3) Transfer 15 μ L of the master mix to wells containing RT.

4) The plates were sealed, vortexed and briefly centrifuged.

To prepare the droplets, cartridges were used as follows:

1) on the cartridge, 70. mu.L of probe oil was placed in the wells labeled as oil, and 20. mu.L of ddPCR reaction was placed in the wells labeled as sample.

2) A rubber pad was placed on top of the cylinder.

3) Transfer 40 μ L droplets to fresh Eppendorf 96 well culture plates. The plates were sealed with aluminum foil and PCR was performed according to the manufacturer's protocol.

The data show that in the C9orf72 fibroblast cell line, these primers amplified exons in the antisense amplified precursor mRNA (C9-AS), and the complementary region was absent in the sense region (C9-S) (fig. 4A). Thus, the ddPCR antisense primers specifically detected antisense precursor mRNA that was significantly elevated in 7 different C9 patient-derived fibroblasts compared to 6 different control fibroblasts herein (FIG. 4B).

Example 4: amplification of allele sense and antisense pre-mRNA inhibition

To test the activity of ZFP-TF inhibitors on amplifying alleles, cells were treated with ZFP-TF74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (table 1) or 74960 (negative control) as described above. Two independent PCR assays were used to assess ZFP-TF mediated inhibition by researchers blinded to sample order. Different primers/probes were used for each assay (fig. 5A to 5C).

For runs No. 1 and No. 2, the analysis to measure sense amplification, antisense amplification and total C9 was performed as described above, with the exception that amplification was performed with random hexamers and with primers shown below according to standard protocols in the art:

antisense amplification of C9orf72 precursor mRNA (fig. 5B): as shown in example 3 above.

Sense amplified C9orf72 precursor mRNA (fig. 5A): this primer/probe set can detect mRNA comprising a region spanning exon 1a and intron 1 a.

Forward direction: 5'ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69)

And (3) reversing: 5'TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70)

And (3) probe: 5'AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71).

Total C9orf72mRNA (fig. 5C): this primer/probe set can detect mRNA containing a region within exon 2.

Forward direction: 5'TGTGACAGTTGGAATGCAGTGA 3' (SEQ ID NO:72)

And (3) reversing: 5'GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO:73)

And (3) probe: 5'TCGACTCTTTGCCCACCGCCA 3' (SEQ ID NO: 74).

Run No. 3 (fig. 5A and 5C) used the primers shown in example 1 above (fig. 2B-2D). For antisense disease transcripts, the following primers/probes were used in order to detect intron region 1B (fig. 5B).

Forward direction: 5'CAGCTTCGGTCAGAGAAATGAG 3' (SEQ ID NO:78)

And (3) reversing: 5'AAGAGGCGCGGGTAGAA 3' (SEQ ID NO:79)

And (3) probe: 5'CTCTCCTCAGAGCTCGACGCATTT 3' (SEQ ID NO: 80).

Despite the fact that different primer/probe sets and different PCR analyses were used (run No. 1 and run No. 2 were performed by similar analyses, but different from run No. 3), the data were consistent and the inhibition levels were comparable.

Taken together, all runs consistently demonstrated that some ZFP-TFs were able to potently suppress all three transcripts (sense, antisense, and total) (e.g., ZFP-TF74978, 75003, and 75027), while some ZFP-TFs (e.g., ZFP-TF75109, 75114, and 75115) selectively suppressed sense and antisense disease transcripts while maintaining total C9 transcripts (selective suppression).

Example 5: modulation of human C9orf72 in BACC9orf72 gene transgenic mouse neurons

All inhibitors targeting BAC mouse C9orf72 were cloned into rAAV6 vectors using the CMV promoter driving expression. Recombinant AAV was produced in HEK293T cells, purified using CsCl density-gradient, and titrated by real-time qPCR according to methods known in the art. Cultured primary mouse cortical neurons were infected with purified virus at 3E5, 1E5, 3E4, and 1E4 Vg/cell. After 7 days, total RNA was extracted and expression of C9orf72 sense and antisense transcripts as well as two reference genes (e.g., Atp5b and Eif4a2) were monitored using RT-qPCR.

All ZFP-TF encoding AAV vectors will effectively inhibit their targets in mouse cells over a wide range of infectious doses, with some ZFPs reducing targets by more than 95% over multiple doses. In contrast, no gene inhibition was observed for CMV-GFPrAAV6 virus, or sham-treated neurons, tested at equivalent doses.

Example 6: ZFP-TF-driven in vivo Gene suppression delivered by AAV

C9orf72 BAC Gene transgenic mice for the target conjugation study contained 98kb human transgenic genes containing a transgene with about 500 Gs₄C₂The repeat sequence and the full length C9orf72 gene allele substantially flanking the sequence (Liu et al, Neuron (2016)90(3): 521-34). Two ZFP-TF ZFP-TF75027 or ZFP-TF75114 were chosen for this study and their potency was different (ZFP-TF75027 was more potent; FIG. 2D). The expression cassettes for both fusion proteins were cloned into rAAV vectors containing the synapsin promoter driving expression and the coding sequence for a self-cleavable peptide (e.g., a 2A peptide such as T2A or P2A) followed by the Venus tag for measurement of biodistribution (fig. 9, panel a). rAAV was produced in HEK293T cells and titrated by ddPCR on ITRs using primers.

To assess the effect of ZFP-TF expression on inhibition of amplified sense and antisense transcripts in vivo, ZFP-TFrAAV was delivered by Intracerebroventricular (ICV) injection into P0C9-BAC or WT mice. Briefly, vehicle (PBS) or ZFP-TF75027 rAAV or ZFP-TF75114 rAAV (total dose 2E10 Vg/ventricle) were administered bilaterally (2 μ Ι/ventricle) into neonatal C9-BAC mice (for repeat length matching) or WT mice (fig. 9, panel C). Animals were sacrificed four weeks post injection and one hemisphere was embedded for RNA aggregation site analysis and the other was microdissected into cortex, hippocampus and cerebellum for further analysis (fig. 9, panel B). Quantification of viral genome and Venusm RNA and protein showed broad biodistribution, transduction and expression equivalence of both ZFP-TF75027 and ZFP-TF 75114.

Total RNA was extracted from cortical and hippocampal tissues and cDNA was prepared using the iscript cDNA synthesis kit (BioRad). ddPCR was performed to measure expression of transcripts containing sense and antisense amplification, and the amount of total C9mRNA normalized to the amount of mouse TBP. The primers used for this analysis were:

total C9 mRNA:

forward direction: 5'TGTGACAGTTGGAATGCAGTGA3' (SEQ ID NO:72)

And (3) reversing: 5'GCCACTTAAAGCAATCTCTGTCTTG3' (SEQ ID NO:73)

And (3) probe: 5'TCGACTCTTTGCCCACCGCCA3' (SEQ ID NO: 74).

Sense amplification of precursor mRNA:

forward direction: 5'ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69)

And (3) reversing: 5'TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70)

And (3) probe: 5'AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71).

Antisense amplification of precursor mRNA:

forward direction: 5'AGTCGCTAGAGGCGAAAGC3' (SEQ ID NO:81)

And (3) reversing: 5'CGAGTGGGTGAGTGAGGAG3' (SEQ ID NO:82)

And (3) probe: 5'AAGAGGCGCGGGTAGAAGCGGGGGC3' (SEQ ID NO: 83).

The data show that ZFP-TF75027 inhibits the amount of total C9mRNA, sense-containing and antisense-amplified transcripts in hippocampus and cortex of C9-BAC animals relative to PBS-injected controls (fig. 9, panel D). (in the case of this animal model no selective inhibition could be observed, since genetically transgenic mice did not contain the WT human C9orf72 allele and the mouse C9orf72 gene did not contain G ₄C₂A repetitive sequence). No inhibition was observed in case of ZFP-TF 75114.

In addition, fluorescence in situ hybridization was used to measure the amount of positive and antisense RNA aggregates (foci) seen in the hippocampus after ZFP-TF injection (fig. 9, panel E). Briefly, 10 μm sections were hybridized with fluorophore-labeled probes: 5'GGCCCCGGCCCCGGCCCC-Cy3(SEQ ID NO:84) was used to measure the sense RNA foci and 5' GGGGCCGGGGCCGGGGCC-Cy3(SEQ ID NO:85) was used to measure the antisense RNA foci. Stack images were obtained on a confocal microscope (LSM880) at 40 x magnification. The number of accumulation points of sense and antisense RNA normalized to the total number of cells was quantified from the armonian horn (CA) region of the hippocampus. A lower percentage of antisense RNA foci was observed in animals injected with ZFP-TF 75027.

These results show that ZFP-TF targeting C9orf72 can effectively suppress expression of the pathogenic C9orf72 allele in vivo, and differences in ZFP-TF potency can be observed.

Sequence listing

<110> Sangomor biotherapy GmbH

<120> regulator for gene expression of chromosome 9 open reading frame 72 and use thereof

<130> 025297.WO017

<140>

<141>

<150> 62/964,844

<151> 2020-01-23

<150> 62/837,523

<151> 2019-04-23

<160> 85

<170> PatentIn version 3.5

<210> 1

<211> 6

<212> DNA

<213> Intelligent people

<400> 1

ggggcc 6

<210> 2

<211> 6

<212> DNA

<213> Intelligent people

<400> 2

gggccg 6

<210> 3

<211> 6

<212> DNA

<213> Intelligent people

<400> 3

ggccgg 6

<210> 4

<211> 6

<212> DNA

<213> Intelligent people

<400> 4

gccggg 6

<210> 5

<211> 6

<212> DNA

<213> Intelligent people

<400> 5

ccgggg 6

<210> 6

<211> 6

<212> DNA

<213> Intelligent people

<400> 6

cggggc 6

<210> 7

<211> 6

<212> DNA

<213> Intelligent people

<400> 7

ggcccc 6

<210> 8

<211> 6

<212> DNA

<213> Intelligent people

<400> 8

gccccg 6

<210> 9

<211> 6

<212> DNA

<213> Intelligent people

<400> 9

ccccgg 6

<210> 10

<211> 6

<212> DNA

<213> Intelligent people

<400> 10

cccggc 6

<210> 11

<211> 6

<212> DNA

<213> Intelligent people

<400> 11

ccggcc 6

<210> 12

<211> 6

<212> DNA

<213> Intelligent people

<400> 12

cggccc 6

<210> 13

<211> 96

<212> PRT

<213> Intelligent people

<400> 13

Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys

1 5 10 15

Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr

20 25 30

Ala Gln Gln Ile Val Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn

35 40 45

Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg

50 55 60

Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln

65 70 75 80

Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val

85 90 95

<210> 14

<211> 5

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 14

Asp Gly Gly Gly Ser

1 5

<210> 15

<211> 5

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 15

Thr Gly Glu Lys Pro

1 5

<210> 16

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 16

Leu Arg Gln Lys Asp Gly Glu Arg Pro

1 5

<210> 17

<211> 4

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 17

Gly Gly Arg Arg

1

<210> 18

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 18

Gly Gly Arg Arg Gly Gly Gly Ser

1 5

<210> 19

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 19

Leu Arg Gln Arg Asp Gly Glu Arg Pro

1 5

<210> 20

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 20

Leu Arg Gln Lys Asp Gly Gly Gly Ser Glu Arg Pro

1 5 10

<210> 21

<211> 16

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 21

Leu Arg Gln Lys Asp Gly Gly Gly Ser Gly Gly Gly Ser Glu Arg Pro

1 5 10 15

<210> 22

<211> 6

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 22

Thr Gly Ser Gln Lys Pro

1 5

<210> 23

<211> 5

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 23

Gly Gly Gly Gly Ser

1 5

<210> 24

<211> 28

<212> DNA

<213> Intelligent people

<400> 24

taggggccgg ggccggggcc ggggcgtg 28

<210> 25

<211> 28

<212> DNA

<213> Intelligent people

<400> 25

cacgccccgg ccccggcccc ggccccta 28

<210> 26

<211> 10

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 26

Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser

1 5 10

<210> 27

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 27

Asp Arg Ser Asp Leu Ser Arg

1 5

<210> 28

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 28

Arg Ser Thr His Leu Val Arg

1 5

<210> 29

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 29

Arg Ser Ala His Leu Ser Arg

1 5

<210> 30

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 30

Glu Arg Gly Asp Leu Lys Arg

1 5

<210> 31

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 31

Glu Arg Gly Thr Leu Ala Arg

1 5

<210> 32

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 32

Arg Ser Ala Asp Leu Ser Glu

1 5

<210> 33

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 33

Arg Ser Asp His Leu Ser Glu

1 5

<210> 34

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 34

Asp Arg Ser His Leu Ala Arg

1 5

<210> 35

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 35

Arg Ser Asp His Leu Ser Gln

1 5

<210> 36

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 36

Asp Asn Ser His Arg Thr Arg

1 5

<210> 37

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 37

Arg Asn Gly His Leu Leu Asp

1 5

<210> 38

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 38

Arg Ser Ala His Leu Ser Glu

1 5

<210> 39

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 39

Arg Ser Asp His Leu Ser Arg

1 5

<210> 40

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 40

Asp Trp Thr Thr Arg Arg Arg

1 5

<210> 41

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 41

His Arg Lys Ser Leu Ser Arg

1 5

<210> 42

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 42

Asp Ser Ser Asp Arg Lys Lys

1 5

<210> 43

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 43

Asp Ser Ser Thr Arg Arg Arg

1 5

<210> 44

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 44

Arg Ser Asp Asp Arg Lys Thr

1 5

<210> 45

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 45

Arg Ser Ala Asp Arg Lys Thr

1 5

<210> 46

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 46

Arg Asn Ala Asp Arg Ile Thr

1 5

<210> 47

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 47

Arg Arg Ala Thr Leu Leu Asp

1 5

<210> 48

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 48

Arg Ser Asp Thr Leu Ser Val

1 5

<210> 49

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 49

Asp Thr Ser Thr Arg Thr Lys

1 5

<210> 50

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 50

Arg Ser Ala Thr Leu Ser Glu

1 5

<210> 51

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 51

His His Arg Ser Leu His Arg

1 5

<210> 52

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 52

Thr Ser Ser Asp Arg Thr Lys

1 5

<210> 53

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 53

Asp Arg Ser His Leu Thr Arg

1 5

<210> 54

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 54

Asp Ser Ser Thr Arg Lys Thr

1 5

<210> 55

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 55

Asp Lys Arg Asp Leu Ala Arg

1 5

<210> 56

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 56

Ser Ser Arg Tyr Arg Thr Lys

1 5

<210> 57

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 57

Arg Glu Gln Asp Leu Lys Gln

1 5

<210> 58

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 58

ctatgtgtgt ggtgggatat gg 22

<210> 59

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 59

ctccaggtta tgtgaagcag aa 22

<210> 60

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 60

aggcctgcta aaggattcaa ctggaa 26

<210> 61

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 61

ccctctctcc ccactacttg 20

<210> 62

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 62

ctacaggctg cggttgtttc c 21

<210> 63

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 63

tctcacagta ctcgctgagg gtga 24

<210> 64

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 64

ctctagcgac tggtggaatt g 21

<210> 65

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 65

gtgcatggca actgtttgaa ta 22

<210> 66

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 66

caaagcctgg tggtgttcaa 20

<210> 67

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 67

ggacatgacc tggttgcttc 20

<210> 68

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 68

cgcggccaga tagacccaat gagca 25

<210> 69

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 69

actacttgct ctcacagtac tcg 23

<210> 70

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 70

tagcgcgcga ctcctgagtt cc 22

<210> 71

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 71

agggaaacaa ccgcagcctg tagcaagctc 30

<210> 72

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 72

tgtgacagtt ggaatgcagt ga 22

<210> 73

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 73

gccacttaaa gcaatctctg tcttg 25

<210> 74

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 74

tcgactcttt gcccaccgcc a 21

<210> 75

<211> 16

<212> DNA

<213> Intelligent people

<400> 75

ccggggccgg ggccgg 16

<210> 76

<211> 12

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 76

Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser Gly Gly

1 5 10

<210> 77

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Peptides "

<400> 77

Glu Arg Arg Asp Leu Arg Arg

1 5

<210> 78

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 78

cagcttcggt cagagaaatg ag 22

<210> 79

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 79

aagaggcgcg ggtagaa 17

<210> 80

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 80

ctctcctcag agctcgacgc attt 24

<210> 81

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 81

agtcgctaga ggcgaaagc 19

<210> 82

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Primers "

<400> 82

cgagtgggtg agtgaggag 19

<210> 83

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 83

aagaggcgcg ggtagaagcg ggggc 25

<210> 84

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 84

ggccccggcc ccggcccc 18

<210> 85

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/comment = "description of artificial sequence: synthesis of

Probe'

<400> 85

ggggccgggg ccggggcc 18