Probe combination, chip, kit and method for detecting toxigenic microcystis strains
阅读说明：本技术 一种检测产毒微囊藻菌型的探针组合、芯片、试剂盒及方法 (Probe combination, chip, kit and method for detecting toxigenic microcystis strains ) 是由 束浩月 林德春 金桃 蒋华 于 2021-07-27 设计创作，主要内容包括：本发明公开了一种检测产毒微囊藻菌型的探针组合,属于微生物检测技术领域。其中,所述探针组合包括检测产毒微囊藻菌型组合中各个产毒微囊藻菌型的探针。本发明还公开了利用上述探针组合制备的基因芯片、试剂盒和检测方法。利用本发明具有通量高和分辨率高的双重优势,并且,本发明检测方法操作方法简单,同时数据处理更为简单便捷,使得本发明对于水体危害蓝藻污染的长期动态监测具有重要应用价值,可指导藻华控制和水生态修复。(The invention discloses a probe combination for detecting toxigenic microcystis strains, belonging to the technical field of microbial detection. Wherein the probe combination comprises probes for detecting each toxigenic microcystis type in the toxigenic microcystis type combination. The invention also discloses a gene chip, a kit and a detection method which are prepared by utilizing the probe combination. The method has the advantages of high flux and high resolution, and the detection method is simple in operation method and simpler and more convenient in data processing, so that the method has important application value for long-term dynamic monitoring of blue-green algae pollution harmed by water, and can guide algal bloom control and water ecological restoration.)
1. A probe combination for detecting toxigenic Microcystis types, which is characterized by comprising a probe for detecting each toxigenic Microcystis type in the toxigenic Microcystis type combination, wherein the toxigenic Microcystis type combination comprises at least two of Microcystis wesenbergii FACHB-929, Microcystis aeruginosa FACHB-909, Microcystis aeruginosa FACHB-911, Microcystis aeruginosa FACHB-925, Microcystis aeruginosa FACHB-975, Microcystis aeruginosa FACHB-978, Microcystis sp.FACHB-1005, Microcystis sp.FACHB-1023, Microcystis sp.FACHB-1026, Microcystis sp.FACHB-1027 and Microcystis FACHB-917.
2. The probe combination according to claim 1, wherein the probe for detecting Microcystis wesenbergii FACHB-929 type is at least one selected from the group consisting of probes represented by SEQ ID No. 1-47; the probe for detecting Microcystis aeruginosa FACHB-909 strain is selected from at least one of the probes shown in SEQ ID NO. 48-87; the probe for detecting Microcystis aeruginosa FACHB-911 strain is at least one of probes shown in SEQ ID NO. 88-132; the probe for detecting Microcystis aeruginosa FACHB-925 bacterial type is selected from at least one probe shown in SEQ ID NO. 133-161; the probe for detecting Microcystis aeruginosa FACHB-975 bacterial type is at least one of the probes shown in SEQ ID NO. 162-205; the probe for detecting Microcystis aeruginosa FACHB-978 bacterial type is at least one of the probes shown in SEQ ID NO. 206-241; the probe for detecting Microcystis sp.FACHB-1005 bacterial type is at least one of the probes shown in SEQ ID NO. 242-283; the probe for detecting Microcystis sp.FACHB-1023 bacterial type is at least one of the probes shown in SEQ ID NO. 284-327; the probe for detecting Microcystis sp.FACHB-1026 bacterial type is at least one probe selected from the probes shown in SEQ ID NO. 328-387; the probe for detecting Microcystis sp.FACHB-1027 bacterial type is at least one probe selected from the group consisting of probes shown in SEQ ID NO. 388-451; the probe for detecting Microcystis elabens FACHB-917 bacterial type is at least one of probes shown in SEQ ID NO. 452-504.
3. Use of a combination of probes according to claim 1 or 2 for the preparation of a gene chip or kit for the detection of toxigenic microcystis types.
4. A gene chip for detecting toxigenic microcystis types, characterized in that the gene chip comprises the probe combination of claim 1.
5. The gene chip of claim 4, further comprising a negative control probe, preferably, the nucleotide sequence of the negative control probe is shown in SEQ ID No. 506.
6. The gene chip of claim 4 or 5, further comprising a global quality control probe, preferably, the global quality control probe comprises a nucleotide sequence shown in SEQ ID No. 507.
7. The gene chip according to any one of claims 4 to 6, wherein the gene chip further comprises a positive control probe, preferably, the nucleotide sequence of the positive control probe is shown in SEQ ID No. 505.
8. A kit for detecting toxigenic microcystis types, characterized in that the kit comprises the probe combination of any one of claims 1-2 or the gene chip of any one of claims 4-7.
9. The kit according to claim 8, wherein the kit further comprises a genomic DNA extraction reagent, a nucleic acid amplification reagent, a fluorescent labeling reagent and/or a purification reagent of the sample to be detected.
10. A method for detecting toxigenic microcystis types is characterized by comprising the following steps:
s1, obtaining the genome DNA of the sample to be detected;
s2, performing nucleic acid amplification, fluorescence labeling and purification on the obtained genome DNA;
s3, performing hybridization detection by using the gene chip of any one of claims 4 to 7;
and S4, judging the detection result according to the detected probe signal.
Technical Field
The invention belongs to the technical field of microbial detection, and particularly relates to a probe combination, a chip, a kit and a method for detecting toxigenic microcystis strains.
Background
With the continuous development of human industrial activities and socioeconomic performance, algal pollution of lakes due to eutrophication has become a major environmental problem worldwide. The eutrophication of water body mainly refers to the phenomenon that plankton in the water body is rapidly propagated and dissolved oxygen in water is reduced due to the accumulation of nutrient substances of nitrogen and phosphorus in the water. The eutrophication of water body mainly brings about three aspects of harm. Firstly, the ecological system of the water body is influenced, when nutrient substances in the water body are too rich, the excessive propagation of algae is caused, the water surface is covered by the algae, so the photosynthesis of organisms in the water at the lower layer is influenced, meanwhile, the oxygen is consumed when the dead algae are decomposed by microorganisms, finally, the oxygen deficiency of the water body is caused, the natural growth of other organisms in the water is influenced, the stability of the ecological system is damaged, and the development of the lake aquaculture industry is seriously hindered. On the other hand, after water eutrophication, algae usually erupts, the lake is covered with a thick green film, and dead water organisms emit unpleasant odor, which can reduce the ornamental value of the lake, influence the life of neighboring residents and hinder the development of social tourism economy. Finally, and most importantly, a large number of algae that can produce toxins are exploded and grown in eutrophic water, and water sources contaminated with algal toxins, whether consumed directly as drinking water or indirectly through aquatic products in water, can pose a significant threat to human health.
The most common toxigenic algae in known eutrophic waters are microcystis. Microcystis (Microcystis) is widely distributed in eutrophic lakes such as Dian lake, Taihu lake and nested lake. The microcystins produced by microcystis can cause diseases of liver, nervous system and skin of human body, so that the world health organization clearly stipulates that the microcystins in drinking water can not exceed 1 mug/L. The microcystis belongs to one of typical harmful algae, the strain diversity of the strain is very high, at present, hundreds of strains in the strain belong to ten species, and different strains have different living characteristics and whether toxin is produced, so that the long-term accurate detection of the strain level of the toxin-producing microcystis in water lakes has great significance for monitoring and early warning of toxin damage.
At present, the detection of the microcystis mainly divided into two detection strategies. One method is to utilize a mass spectrometer to directly detect the content of microcystins in the water body according to the characteristics of the microcystins so as to judge whether the water body is polluted by the microcystins. The main disadvantage of this detection strategy is that it can only be detected when the water body is already heavily contaminated with microcysts and enters the toxin release stage, whereas it is difficult to detect microcysts contamination in the early stage of microcysts dormancy. The second strategy is to detect whether the water body contains the microcystis or not by a mode of amplifying and sequencing specific DNA fragments of the microcystis, and comprises a quantitative PCR detection method aiming at a microcystis 16S rRNA fragment and an algal toxin functional gene fragment. The strategy has a good early-stage microcystis early warning effect, but the resolution for detecting microcystis is not enough, and the level of the microcystis can only be identified generally, so that the toxin-producing difference of different microcystis strains is confused.
The gene chip is composed of oligonucleotide probes densely fixed on a glass slide, the probes and fluorescence labeled sample DNA are used for base complementary pairing hybridization, and the detection of a probe target sequence can be completed by judging the strength of a hybridization signal. Because of the characteristics of high flux and high sensitivity of the gene chip, the gene chip is widely applied to the detection of human pathogenic microorganisms at present, but the application of the gene chip technology to the detection of toxigenic microcystis has not been reported at present.
Disclosure of Invention
In order to solve at least one of the above technical problems, the technical solution adopted by the present invention is as follows:
in a first aspect, the invention provides a probe combination for detecting toxigenic Microcystis types, which comprises a probe for detecting each toxigenic Microcystis type in the toxigenic Microcystis type combination, wherein the toxigenic Microcystis type combination comprises at least two of Microcystis wesenbergii FACHB-929, Microcystis aeruginosa FACHB-909, Microcystis aeruginosa FACHB-911, Microcystis aeruginosa FACHB-925, Microcystis aeruginosa FACHB-975, Microcystis aeruginosa FACHB-978, Microcystis sp.FACHB-1005, Microcystis sp.FACHB-1023, Microcystis sp.FACHB-1026, Microcystis sp.FACHB-1027 and Microcystis FACHB-917.
Microcystis is a genus of the phylum Cyanophyta, Chroococcales, Chroococcaceae. Also known as the genus Dunaliella. The cells are spherical and are packed in the colloid to form an irregular population. When the microcystis is propagated in a large quantity, the large quantity of the microcystis causes the large quantity of the laoindigo and generates toxins, which are harmful to aquaculture.
In the present invention, the toxigenic microcystis type means that different microcystis toxigenic types of the same microcystis, and the same type is used with a small difference in toxigenicity. In the present invention, the above 11 bacterial types are defined, and if the detection result of the probe detecting one of the bacterial types is positive, the toxigenic Microcystis exists in the sample to be detected.
In some embodiments of the invention, the combination of toxigenic microcystis types comprises 3, 4, 5, 6, 7, 8, 9, 10, or all 11 of the 11 types.
In some embodiments of the present invention, the probe for detecting Microcystis wesenbergii FACHB-929 bacterial type is at least one probe selected from the group consisting of the probes set forth in SEQ ID NO. 1-47; the probe for detecting Microcystis aeruginosa FACHB-909 strain is selected from at least one of the probes shown in SEQ ID NO. 48-87; the probe for detecting Microcystis aeruginosa FACHB-911 strain is at least one of probes shown in SEQ ID NO. 88-132; the probe for detecting Microcystis aeruginosa FACHB-925 bacterial type is selected from at least one probe shown in SEQ ID NO. 133-161; the probe for detecting Microcystis aeruginosa FACHB-975 bacterial type is at least one of the probes shown in SEQ ID NO. 162-205; the probe for detecting Microcystis aeruginosa FACHB-978 bacterial type is at least one of the probes shown in SEQ ID NO. 206-241; the probe for detecting Microcystis sp.FACHB-1005 bacterial type is at least one of the probes shown in SEQ ID NO. 242-283; the probe for detecting Microcystis sp.FACHB-1023 bacterial type is at least one of the probes shown in SEQ ID NO. 284-327; the probe for detecting Microcystis sp.FACHB-1026 bacterial type is at least one probe selected from the probes shown in SEQ ID NO. 328-387; the probe for detecting Microcystis sp.FACHB-1027 bacterial type is at least one probe selected from the group consisting of probes shown in SEQ ID NO. 388-451; the probe for detecting Microcystis elabens FACHB-917 bacterial type is at least one of probes shown in SEQ ID NO. 452-504.
In a second aspect, the invention provides the use of a probe set according to any one of the first aspect of the invention in the preparation of a gene chip or a kit for detecting toxigenic microcystis types.
The third aspect of the present invention provides a gene chip for detecting toxigenic microcystis types, which comprises the probe combination of claim 1.
Furthermore, the gene chip also comprises a negative control probe. In some preferred embodiments of the invention, the nucleotide sequence of the negative control probe is shown in SEQ ID No. 506.
Furthermore, the gene chip also comprises a global quality control probe. In some preferred embodiments of the present invention, the nucleotide sequence of the global quality control probe is shown as SEQ ID No. 507.
Furthermore, the gene chip also comprises a positive control probe. In some preferred embodiments of the invention, the nucleotide sequence of the positive control probe is shown in SEQ ID No. 505.
The fourth aspect of the present invention provides a kit for detecting toxigenic microcystis types, which is characterized in that the kit comprises the probe combination according to any one of the first aspect of the present invention or the gene chip according to any one of the third aspect of the present invention.
Further, the kit also comprises a reagent for extracting the genomic DNA of the sample to be detected.
Still further, the kit further comprises a nucleic acid amplification reagent and a fluorescent labeling reagent.
Still further, the kit further comprises a purification reagent.
The fifth aspect of the invention provides a method for detecting toxigenic microcystis types, which comprises the following steps:
s1, obtaining the genome DNA of the sample to be detected;
s2, performing nucleic acid amplification, fluorescence labeling and purification on the obtained genome DNA;
s3, performing hybridization detection using the gene chip according to any one of the third aspects of the present invention;
and S4, judging the detection result according to the detected probe signal.
As such, in some embodiments of the present invention, in step S1, the obtaining of the genomic DNA of the test sample may be performed by performing nucleic acid extraction using methods conventional in the art.
In some embodiments of the invention, in step S2, the nucleic acid amplification is non-specific random amplification; fluorescence labeling was performed using Cyanine 3-dUTP.
In some embodiments of the present invention, the gene chip of step S3 includes probes for detecting at least two of Microcystis wesenbergii FACHB-929, Microcystis aeruginosa FACHB-909, Microcystis aeruginosa FACHB-911, Microcystis aeruginosa FACHB-925, Microcystis aeruginosa FACHB-975, Microcystis aeruginosa FACHB-978, Microcystis sp.FACHB-1023, Microcystis sp.FACHB-1026, Microcystis. FACHB-1027 and Microcystis elabens FACHB-917, and further includes a negative control probe, a global quality control probe and a positive control probe 1005.
In some embodiments of the invention, the probe for detecting Microcystis wesenbergii FACHB-929 bacterial type is selected from at least one of the probes set forth in SEQ ID NO. 1-47; the probe for detecting Microcystis aeruginosa FACHB-909 strain is selected from at least one of the probes shown in SEQ ID NO. 48-87; the probe for detecting Microcystis aeruginosa FACHB-911 strain is at least one of probes shown in SEQ ID NO. 88-132; the probe for detecting Microcystis aeruginosa FACHB-925 bacterial type is selected from at least one probe shown in SEQ ID NO. 133-161; the probe for detecting Microcystis aeruginosa FACHB-975 bacterial type is at least one of the probes shown in SEQ ID NO. 162-205; the probe for detecting Microcystis aeruginosa FACHB-978 bacterial type is at least one of the probes shown in SEQ ID NO. 206-241; the probe for detecting Microcystis sp.FACHB-1005 bacterial type is at least one of the probes shown in SEQ ID NO. 242-283; the probe for detecting Microcystis sp.FACHB-1023 bacterial type is at least one of the probes shown in SEQ ID NO. 284-327; the probe for detecting Microcystis sp.FACHB-1026 bacterial type is at least one probe selected from the probes shown in SEQ ID NO. 328-387; the probe for detecting Microcystis sp.FACHB-1027 bacterial type is at least one probe selected from the group consisting of probes shown in SEQ ID NO. 388-451; the probe for detecting Microcystis elabens FACHB-917 bacterial type is at least one of probes shown in SEQ ID NO. 452-504.
Optionally, the nucleotide sequence of the negative control probe is shown as SEQ ID No.506, optionally, the nucleotide sequence of the global quality control probe is shown as SEQ ID No.507, and optionally, the nucleotide sequence of the positive control probe is shown as SEQ ID No. 505.
Further, the step S4 is:
s41, scanning and feature extraction: scanning the cleaned chip in a Multi-TIFF mode by using an Agilent chip scanner to obtain chip characteristic data, and extracting signal characteristics by using characteristic extraction software to obtain probe signal characteristic data;
s42, data quality inspection: and (3) performing quality inspection on the probe signal characteristic data in the previous step, setting a signal detection threshold value to be 100, and if: a) all negative control probes were not detected (fluorescence signal values were below threshold); b) more than 50% of positive control probes are detected; c) all the global quality control probes are detected, and the data quality inspection is qualified if no signal supersaturation occurs;
s43, judging probe signals: firstly, screening hybridization confidence coefficients of probe signal values of all probes, and deleting probe hybridization fluorescent signals with lower confidence coefficients to obtain the number or proportion of probes with qualified signal values; the detection standard for a certain bacterial type detected in a sample to be detected is as follows: at least one of the probes for detecting the bacterial type or all of the probes for detecting the bacterial type has a ratio of probes with qualified signal values higher than a threshold value.
In some embodiments of the present invention, the determination of whether a probe has a qualified signal value is mainly determined by performing statistical analysis on fluorescence values of all pixels contained in the hybridization site image.
In some embodiments of the invention, the step of determining whether the probe signal value is acceptable comprises:
screening signal-to-noise ratio of probe signals: the signal to noise ratio is more than 2, the signal value of a single probe subtracts a background value, and then the background value is divided by the standard deviation of the background value, and the probe signal with the result more than 2 is judged as a qualified signal;
secondly, screening signal multiplication ratio of the probe: the signal-to-back ratio is larger than 2, the signal value of a single probe is divided by the background signal value, and the probe signal with the result larger than 2 is judged as a qualified signal.
In some preferred embodiments of the invention, the threshold is 50%, 60%, 70% or 80%.
In the present invention, the sample to be tested can be derived from any water source, including but not limited to rivers, streams, seas, lakes, ponds, reservoirs, ponds, and other water sources that may or may not flow.
The invention has the advantages of
Compared with the prior art, the invention has the following beneficial effects:
1. most of the existing toxigenic microcystis molecule detection technologies limit a detection target area to a 16S rRNA ribosomal gene or a microcystis toxin gene area, and because the target detection area is small, the resolution is low, and species and the following levels cannot be identified. The invention can detect the toxigenic microcystis at the strain level by using a strain specific probe in the whole genome range through a gene chip technology, and overcomes the defect of insufficient resolution of the existing detection technology.
2. The invention can simultaneously detect the existence of 11 common toxigenic microcystis strains in water by utilizing a gene chip technology. And the detection method is simple in operation method, saves the steps of PCR and sequencing of the target region compared with the detection method based on sequencing, and is simpler and more convenient in data processing. The method for conveniently detecting the toxigenic microcystis strains with high flux and high resolution has important application value for long-term dynamic monitoring of blue-green algae pollution harmed by water, and can guide algal bloom control and water ecological restoration.
Drawings
Fig. 1 shows the distribution of significant fluorescent probe ratios for target and non-target strains in mock samples, where the dashed lines represent the strain criteria and strains with ratios above 60% can be determined as detected.
FIG. 2 shows the effect of detecting target toxigenic microcystis under different DNA total hybridization gradients.
Detailed Description
Unless otherwise indicated, implied from the context, or customary in the art, all parts and percentages herein are by weight and the testing and characterization methods used are synchronized with the filing date of the present application. Where applicable, the contents of any patent, patent application, or publication referred to in this application are incorporated herein by reference in their entirety and their equivalent family patents are also incorporated by reference, especially as they disclose definitions relating to synthetic techniques, products and process designs, polymers, comonomers, initiators or catalysts, and the like, in the art. To the extent that a definition of a particular term disclosed in the prior art is inconsistent with any definitions provided herein, the definition of the term provided herein controls.
The numerical ranges in this application are approximations, and thus may include values outside of the ranges unless otherwise specified. A numerical range includes all numbers from the lower value to the upper value, in increments of 1 unit, provided that there is a separation of at least 2 units between any lower value and any higher value. For example, if a compositional, physical, or other property (e.g., molecular weight, melt index, etc.) is recited as 100 to 1000, it is intended that all individual values, e.g., 100, 101, 102, etc., and all subranges, e.g., 100 to 166, 155 to 170, 198 to 200, etc., are explicitly recited. For ranges containing a numerical value less than 1 or containing a fraction greater than 1 (e.g., 1.1, 1.5, etc.), then 1 unit is considered appropriate to be 0.0001, 0.001, 0.01, or 0.1. For ranges containing single digit numbers less than 10 (e.g., 1 to 5), 1 unit is typically considered 0.1. These are merely specific examples of what is intended to be expressed and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application.
When used with respect to chemical compounds, the singular includes all isomeric forms and vice versa (e.g., "hexane" includes all isomers of hexane, individually or collectively) unless expressly specified otherwise. In addition, unless explicitly stated otherwise, the use of the terms "a", "an" or "the" are intended to include the plural forms thereof.
The terms "comprising," "including," "having," and derivatives thereof do not exclude the presence of any other component, step or procedure, and are not intended to exclude the presence of other elements, steps or procedures not expressly disclosed herein. To the extent that any doubt is eliminated, all compositions herein containing, including, or having the term "comprise" may contain any additional additive, adjuvant, or compound, unless expressly stated otherwise. Rather, the term "consisting essentially of … …" excludes any other components, steps or processes from the scope of any of the terms hereinafter recited, insofar as such terms are necessary for performance. The term "consisting of … …" does not include any components, steps or processes not specifically described or listed. Unless explicitly stated otherwise, the term "or" refers to the listed individual members or any combination thereof.
In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.
Examples
The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
The molecular biological experiments, which are not specifically described in the following examples, were performed according to the specific methods listed in the manual of molecular cloning, laboratory manual (fourth edition) (j. sambrook, m.r. green, 2017), or according to the kit and product instructions. Other experimental methods, unless otherwise specified, are conventional. The instruments used in the following examples are, unless otherwise specified, laboratory-standard instruments; the test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.
EXAMPLE 1 toxigenic microcystis type specificity detection Probe screening
This example utilizes the genomic sequences of 11 strains for probe design. The 11 strains include Microcystis wesenbergii FACHB-929, Microcystis aeruginosa FACHB-909, Microcystis aeruginosa FACHB-911, Microcystis aeruginosa FACHB-925, Microcystis aeruginosa FACHB-975, Microcystis aeruginosa FACHB-978, Microcystis sp.FACHB-1005, Microcystis sp.FACHB-1023, Microcystis sp.FACHB-1026, Microcystis sp.FACHB-1027 and Microcystis elabes FACHB-917. All 11 strains are derived from fresh water Algae seed bank (Freshwater Algae Culture Collection of Hydrobiology, FACHB) of Chinese academy of sciences, and genome sequences are obtained.
The following is a procedure for designing a specific detection probe for the Microcystis wesenbergii FACHB-929 toxigenic strain using the genomic sequence (GCA _014698625.1) of the toxigenic Microcystis wesenbergii FACHB-929 strain.
1. Collecting a data set:
for designing a specific probe of Microcystis wesenbergii FACHB-929 toxigenic strain, the prepared data mainly comprises two parts, the genomic sequence of the toxigenic Microcystis wesenbergii FACHB-929 strain and the background genomic sequence.
In this example, all 2531 other cyanobacteria genome sequences (data up to 3/12/2021) in the NCBI database were set as background sequences.
2. Primary selection of specific probes:
and (2) completely breaking 2531 cyanobacteria genome sequences into Kmer segments with the length of 50 mers, establishing a background sequence Kmer segment hash library, and recording the occurrence frequency of the Kmers and the information of the affiliated strains. Then, a Kmer fragment (50mer length) hash library of the genome sequence of the Microcystis wesenbergii FACHB-929 Microcystis strain is established. And comparing and analyzing the target sequence Kmer library and the background sequence Kmer library, and selecting the Kmers which only exist in the target sequence Kmer library but do not exist in the background sequence Kmer library as an alternative specific probe library of the strain.
3. Elimination of potential non-specific binding probes in the alternative specific probes:
potential non-specific binding may occur if the probe has a continuous match of more than 20 bases with the non-target sequence. And (3) carrying out sequence comparison on the alternative specific probes and the background Kmer library by using a Blast program of NCBI, and removing probes which are continuously matched with the background Kmer and have more than 20 basic groups in the alternative specific probes according to a comparison result.
4. Screening the physical and chemical properties of the probe:
after the above steps, 253 Microcystis wesenbergii FACHB-929 strain-specific probes were obtained, and the probe sequences existed uniquely in the genome of the strain and did not match with the genome of other strains by more than 20 continuous bases. Then screening the physicochemical properties of the residual specific probes, wherein the main conditions comprise:
(1) if the Free energy of nucleic acid (in kcal/mol) between the probe sequence and the target sequence is less than-30, the probe sequence is removed.
(2) If the probe occurs 5 times in consecutive identical bases, the probe complexity is too low and the probe sequence is removed.
(3) The final screening of strain specific probes was performed based on melting temperature Tm (65< Tm <95) and GC content (0.2< GC content < 0.8).
Finally, 47 specific probes distributed over the entire genome of Microcystis wesenbergii FACHB-929 were designed. As shown in table 1:
TABLE 1 Microcystis wesenbergii FACHB-929 toxigenic bacteria type specific probes
Example 2 preparation of specific detection Gene chip for toxigenic Microcystis
Using the methods of the examples, probes were designed using the genomic sequences of Microcystis aeruginosa FACHB-909, Microcystis aeruginosa FACHB-911, Microcystis aeruginosa FACHB-925, Microcystis aeruginosa FACHB-975, Microcystis aeruginosa FACHB-978, Microcystis sp.FACHB-1005, Microcystis sp.FACHB-1023, Microcystis sp.FACHB-1026, Microcystis sp.FACHB-1027 and Microcystis elabes FACHB-917, respectively, and the results are shown in Table 2.
TABLE 210 specific probes for toxinogenic bacterial types
Thus, the number of probes designed is shown in Table 3:
TABLE 3 probes corresponding to each toxigenic bacteria type
Toxigenic bacteria type
Number of probes
SEQ ID No.
Microcystis wesenbergii FACHB-929
47
1～47
Microcystis aeruginosa FACHB-909
40
48～87
Microcystis aeruginosa FACHB-911
45
88～132
Microcystis aeruginosa FACHB-925
29
133～161
Microcystis aeruginosa FACHB-975
44
162～205
Microcystis aeruginosa FACHB-978
36
206～241
Microcystis sp.FACHB-1005
42
242～283
Microcystis sp.FACHB-1023
44
284～327
Microcystis sp.FACHB-1026
60
328～387
Microcystis sp.FACHB-1027
64
388～451
Microcystis elabens FACHB-917
53
452～504
Designing positive and negative control probes and a global quality control probe:
positive probe sequence (SEQ ID No. 505):
GCGCTCGTTGCGGGACTTAACCCAACACCTCACGGCACGAGCTGACGACA
negative control probe sequence (SEQ ID No. 506):
GACCTGATAAAGCGCAACCGATAACTAAAGAGGGCAGATATAATATCTGT
global quality control probe sequence (SEQ ID No. 507):
TGAGCATGAGGTCGCGTTGATTAATCCCGAAGGTCAACTGGCGGATTTCT
the design method of the probe sequence comprises the following steps: all the three probes have no hybridization affinity with the currently known microbial sequences.
All designed specific probes were synthesized by Agilent.
Meanwhile, the specific probes are combined differently to prepare different gene chips, for example, even one or more of the 11 bacterial types are selected, and one or more probes are selected correspondingly according to the selected bacterial types, and the gene chips are prepared. Thus, a large number of different gene chips can be prepared.
The arrangement modes of the contrast probe and the global quality control probe are as follows: randomly distributed among the detection probes;
control probe and global quality control probe number: the control probes and the quality control probes are 40 repeated probes randomly arranged on the chip.
In this example, the following gene chips were prepared:
gene chip #1, included probes as shown in Table 4:
TABLE 4 Gene chip #1 Probe information
Toxigenic bacteria type
Number of probes
SEQ ID No.
Microcystis aeruginosa FACHB-911
10
89、91、93、95、102、104、110、115、119、123
Microcystis sp.FACHB-1023
10
286、289、290、296、299、301、308、314、319、323
Microcystis elabens FACHB-917
10
455、459、462、468、473、481、485、489、493、500
Gene chip #2, included probes as shown in Table 5:
TABLE 5 Gene chip #2 Probe information
Toxigenic bacteria type
Number of probes
SEQ ID No.
Microcystis wesenbergii FACHB-929
5
3、8、14、29、38
Microcystis aeruginosa FACHB-975
5
168、171、174、188、194
Microcystis sp.FACHB-1005
5
245、254、253、278、281
Microcystis sp.FACHB-1023
5
288、291、298、305、314
Microcystis sp.FACHB-1026
5
328、330、343、356、377
Gene chip #3, included probes as shown in Table 6:
TABLE 6 Gene chip #3 Probe information
Toxigenic bacteria type
Number of probes
SEQ ID No.
Microcystis wesenbergii FACHB-929
47
1～47
Microcystis aeruginosa FACHB-911
45
88～132
Microcystis aeruginosa FACHB-975
44
162～205
Microcystis aeruginosa FACHB-978
36
206～241
Microcystis sp.FACHB-1026
60
328～387
Microcystis elabens FACHB-917
53
452～504
Gene chip #4, included probes as shown in Table 7:
TABLE 7 Gene chip #4 Probe information
Gene chip #5, included probes as shown in Table 8:
TABLE 8 Gene chip #5 Probe information
Example 3 method for rapidly detecting toxigenic microcystis in common water body by using gene chip prepared in example 2
1. Target sample DNA extraction
Collecting water in lakes or rivers, enriching blue algae by filtering with a filter membrane, taking the enrichment as a sample to be detected, and then extracting nucleic acid of the sample to be detected by using a DNA extraction kit of Agilent CGH MicroArray, or extracting nucleic acid of the sample to be detected by using other conventional methods in the field.
DNA purification
The main steps of DNA purification are:
(1) taking 500ng of the extracted DNA sample in a broken tube, and complementing H2O to 50. mu.L. Setting the interruption time to 90 s;
(2) balancing Onebubble MagBeads at room temperature for 30min in advance, fully oscillating and uniformly mixing to ensure that no obvious magnetic bead precipitation exists;
(3) adding 60 mu L of Onebubble MagBeads (1.2 x) into the low adsorption tube/eight-connected tube, adding the interrupting product in the step (1), uniformly mixing by vortex, collecting liquid on the tube wall instantly, and standing for 5min at room temperature;
(4) placing the low adsorption tube or the eight-connected tube on a magnetic frame, and removing the supernatant after the solution in the tube is clarified;
(5) adding 200 mu L of 80% freshly prepared ethanol into a 1.5mL low adsorption tube or an octal tube, standing for 30s, removing a supernatant, and repeating the operation steps until the supernatant is completely removed;
(6) placing the low adsorption tube or the eight-connected tube on a magnetic frame, standing at room temperature for 1-2 min until the magnetic beads are dried or opening the tube and placing the tube on a metal bath at 45 ℃ until the surfaces of the magnetic beads are dried and cracked without water and ethanol residue at the bottom of the tube;
(7) removing the centrifuge tube from the magnetic frame, adding 15 μ L of incubated nucleic-free water to resuspend the magnetic beads, vortexing or blowing, mixing, collecting the tube wall liquid instantly, and standing at room temperature for 3 min;
(8) the low adsorption tube or the octal tube is placed on a magnetic frame, and when the solution in the tube is clarified, 13. mu.L of supernatant is transferred to a new PCR tube for the next labeling.
Fluorescent labeling of DNA
This example uses the Agilent SureTag Complete DNA Labeling Kit, including the following steps:
(1) to the purified gDNA after disruption, 2.5. mu.L of Random primer mix was added, and after mixing, the following denaturation reaction was carried out: hold at 98 deg.C for 3min and 4 deg.C;
(2) to the above denaturation reaction system (13. mu.L of gDNA and 2.5. mu.L of Random primer mix) were added the following reagents directly: 5. mu.L of 5 × Reaction buffer, 2.5. mu.L of 10 × dNTP, 1.5. mu.L of Cyanine3-dUTP, 0.5. mu.L of Exo (-) Klenow, and 25. mu.L in total;
(3) after the mixture is uniformly mixed by blowing or vortex oscillation by using a liquid transfer gun, quickly centrifuging and collecting liquid on the tube wall, and removing bubbles;
(4) the reaction system was placed on a PCR instrument with the hot lid set at 75 ℃ and the following procedure was run: hold at 37 ℃ for 2h, 65 ℃ for 10min and 4 ℃.
4. Hybridization of the fluorescent DNA of the target sample with the Gene chip prepared in example 3
The Agilent Oligo acGH/ChIP-on-ChIP Hybridization Kit is used in the embodiment, and comprises the following steps:
(1) the purified sample was concentrated to 14.3. mu.L, and after the hybrid system was prepared according to Table 9, the mixture was blown up with a gun and mixed, after flash separation, the reaction was placed on a PCR instrument with a hot lid temperature of 105 ℃ and the following procedure was run: hold at 98 deg.C for 3min, 37 deg.C for 30min, and 37 deg.C;
(2) and (3) hybridization:
a. firstly, a clean gasket is placed in the Agilent chamber, the label of the gasket faces upwards and is aligned with the rectangular part at the bottom of the chamber, and the gasket is ensured to be flush with the base of the chamber;
b. then sucking 55 mu L of the sample at the temperature of 37 ℃ in the previous step to the middle of the rubber ring on the gasket to avoid generating bubbles, and reversely buckling the chip on the gasket;
c. then, covering the chamber cover, and screwing down the knob;
d. each assembled device was loaded into an incubator carousel, a matched chamber was taken, the hybridization chamber was rotated vertically to wet the slides, and the mobility of the bubbles was assessed.
e. The rotation speed of the hybridization rotator was set at 20rpm and hybridization was carried out at 67 ℃ for 4 hours.
(3) Chip cleaning: after hybridization, the chip is taken out at room temperature, placed in washing liquor 1 (reagent of Agilent kit) and set at 250rpm, and washed by shaking at room temperature for 5 min; then washing solution 2 (reagent of Agilent kit) is set at 200rpm, shaking and washing is carried out for 1min at 39 ℃, and finally liquid on the surface of the chip is removed and scanning is carried out within 4 h.
TABLE 9 hybridization System Table in example 3
5. Fluorescence results scanning and signal analysis
(1) Scanning and feature extraction: scanning the cleaned chip in a Multi-TIFF mode by using an agile chip scanner to obtain chip characteristic data (TIFF picture format), and then extracting signal characteristics from a TIFF file by using characteristic extraction software (Agilent Feature extraction) v12.1 to obtain probe signal characteristic data;
(2) and (3) data quality inspection: performing quality inspection on the probe signal characteristic data in the last step, and setting a signal detection threshold value to be 100 if a) all negative control probes are not detected (the fluorescence signal values are all lower than the threshold value); b) more than 50% of positive control probes are detected; c) and detecting all the global quality control probes, and if no signal supersaturation occurs, the quality inspection of the experimental data is qualified.
(3) Signal interpretation: in order to avoid the interference of some non-specific probe signals in hybridization experiments, the following steps are used to read the probe signals of the chip. Firstly, hybridization confidence screening is carried out on all probe signals, and the probe hybridization fluorescent signals with lower confidence are deleted. And judging whether the signal of one hybridization site is qualified or not, wherein the signal is obtained by performing statistical analysis and judgment on the fluorescence values of all pixel points contained in the hybridization site image. Subsequently, a certain bacterial type is detected by the detection standard that at least 1 of all the specific probes for detecting the bacterial type has a qualified signal value. The probe signal analysis step mainly comprises:
and (4) screening the signal-to-noise ratio of the probe signal. The signal-to-noise ratio (the ratio of the fluorescence target signal to the fluorescence noise signal in a single probe pipeline) is more than 2, the signal value of a single probe subtracts a background value, and then the background value is divided by the standard deviation of the background value, and the probe signal with the result of more than 2 is judged as a qualified signal.
② screening the signal multiplication ratio of the probe. The signal-to-back ratio (the ratio of the fluorescence target signal to the fluorescence background signal in a single probe pipeline) is more than 2, the signal value of the single probe is divided by the background signal value, and the probe signal with the result of more than 2 is judged as a qualified signal.
And screening the qualified rate of the probe signals. Counting the number or proportion of qualified probe signals in a certain strain.
Judging the detection result: the detection standard for detecting a certain bacterial type is as follows: if at least 1 probe for a characteristic probe for that type of bacterium has an acceptable probe signal value or has a ratio of acceptable probe signal values greater than a threshold value, such as 50%, 60%, 70%, or 80%, then the toxigenic microcystis type is detected as being present in the target water body.
Example 4 specificity test for Gene chip for detecting toxigenic Microcystis toxigenic types
Specificity refers to that the existence of the target strain in a water body sample can be detected in a targeted mode. In order to test the specific detection effect of the probe and the gene chip designed by the inventor, the toxigenic microcystis strains are subjected to multi-combination mixing, the mixed bacterial liquid is detected by using the method, the consistency between the detection result and the experimentally selected combination design is compared, and the false positive and false negative ratio of the detection result is analyzed.
The inventors obtained 11 toxigenic strains of microcystis from fresh water Algae Collection of the Institute of Hydrobiology, FACHB, and mixed the bacterial solutions of the 11 strains in various combinations (the total amount of DNA of each single bacterium used for mixing was 30ng), and designed 6 mock samples each containing three replicates (table 10).
TABLE 10 pure bacteria combinations of mock samples
Toxigenic microcystis strains
Simulation sample 1
Simulation sample 2
Simulation sample 3
Simulation sample 4
Simulation sample 5
Simulation sample 6
Microcystis aeruginosa FACHB-909
√
×
×
×
×
×
Microcystis aeruginosa FACHB-911
√
√
×
×
×
×
Microcystis aeruginosa FACHB-925
√
√
√
×
×
×
Microcystis aeruginosa FACHB-975
√
√
√
√
×
×
Microcystis aeruginosa FACHB-978
√
√
√
√
√
×
Microcystis sp.FACHB-1005
×
√
√
√
√
√
Microcystis sp.FACHB-1023
×
×
√
√
√
√
Microcystis sp.FACHB-1026
×
×
×
√
√
√
Microcystis sp.FACHB-1027
×
×
×
×
√
√
Microcystis elabens FACHB-917
×
×
×
×
×
√
Microcystis wesenbergii FACHB-929
×
×
×
×
×
√
The inventors examined the above 6 mock samples by the method of example 3 using the gene chip #5 prepared in example 2.
The results of the tests showed that the proportion of probes with significant fluorescence signals in the probe sets of the target strain in all 6 mock samples was greater than 60%, whereas the proportion of non-target strains was less than 60% (fig. 1). The strain detection standard is that the proportion of probes lighted by the probe group is more than 60 percent, all the microcystis strains detected by the simulated samples are identical with the strains actually added, and the proportion of false positive and false negative is 0 (table 11).
TABLE 11 simulation sample test results
Toxigenic microcystis strains
Simulation sample 1
Simulation sample 2
Simulation sample 3
Simulation sample 4
Simulation sample 5
Simulation sample 6
Microcystis aeruginosa FACHB-909
+
-
-
-
-
-
Microcystis aeruginosa FACHB-911
+
+
-
-
-
-
Microcystis aeruginosa FACHB-925
+
+
+
-
-
-
Microcystis aeruginosa FACHB-975
+
+
+
+
-
-
Microcystis aeruginosa FACHB-978
+
+
+
+
+
-
Microcystis sp.FACHB-1005
-
+
+
+
+
+
Microcystis sp.FACHB-1023
-
-
+
+
+
+
Microcystis sp.FACHB-1026
-
-
-
+
+
+
Microcystis sp.FACHB-1027
-
-
-
-
+
+
Microcystis elabens FACHB-917
-
-
-
-
-
+
Microcystis wesenbergii FACHB-929
-
-
-
-
-
+
Sample detection accuracy
100％
100％
100％
100％
100％
100％
False negative of sample detection
0％
0％
0％
0％
0％
0％
False positive in sample detection
0％
0％
0％
0％
0％
0％
The results prove that the probe, the gene chip and the detection method have reliable microcystis strain level detection effect.
Example 5 minimal detection of target toxigenic microcystis
In order to test whether the detection method has the capability of detecting the microcystis strains with extremely low concentration in the environment, a concentration gradient detection test is designed. The specific scheme is that three microcystis strains are randomly selected, DNA is respectively extracted from each strain, DNA with the total amount of 0.1, 0.5, 1, 5, 10, 50 and 100ng is selected to carry out a fluorescence hybridization experiment with the gene chip #5 in the embodiment 2, and the experimental steps are the same as those in the embodiment 3. Comparing the proportion of probes with obvious fluorescent signals occupying the bacterial probe group and the corresponding mean value of the fluorescent signals of the probes under different total DNA amounts.
As shown in FIG. 2, the results show that when the total amount of DNA of the target strain in the system reaches 5ng or more, the result of the positive probe in the strain-specific probe set is greater than 60%, and the detection can be judged to be successful by the judgment condition.
The results prove that the probe, the gene chip and the detection method still have good detection capability when the water body contains trace target toxigenic microcystis.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.