阅读说明：本技术 用于检测淋病奈瑟氏球菌的组合物和方法 (Compositions and methods for detecting neisseria gonorrhoeae ) 是由 E·H·菲斯赫巴尔特 J·孙 于 2020-05-05 设计创作，主要内容包括：描述了用于快速检测生物样品或非生物样品中NG菌毛蛋白转化蛋白(Piv-(Ng))基因的存在或不存在的方法。所述方法可包括进行扩增步骤、杂交步骤和检测步骤。此外,提供了靶向所述NG Piv-(Ng)基因的引物、探针以及被设计用于检测淋病奈瑟氏球菌(NG)的试剂盒。(Described is a method for the rapid detection of NG pilin converting protein (Piv) in a biological or non-biological sample Ng ) A method for the presence or absence of a gene. The method may comprise performing an amplification step, a hybridization step and a detection step. Furthermore, targeting said NG Piv is provided Ng Primers and probes for the gene and kits designed for the detection of Neisseria Gonorrhoeae (NG).)

1. A method of detecting Neisseria Gonorrhoeae (NG) in a sample, said method comprising:

performing an amplification step comprising contacting the sample with a set of NG Piv_NgGene primer contact to presence NG Piv in the sample_NgProducing an amplification product in the case of a nucleic acid;

-performing a hybridization step comprising contacting the amplification product with one or more detectable NG Piv_NgContacting a gene probe; and

-detecting the presence or absence of the amplification product, wherein the presence of the amplification product is indicative of the presence of NG in the sample, and wherein the absence of the amplification product is indicative of the absence of NG in the sample;

wherein the set of NG Piv_NgThe gene primer set comprises a first primer and a second primer, wherein the first primer comprises SEQ ID NO: 1 or a complement thereof, and the second primer comprises the first oligonucleotide sequence of SEQ ID NO: 2 or a complement thereof; and is

Wherein the one or more detectable NG Piv_NgThe gene probe comprises SEQ ID NO: 3 or a complement thereof.

2. The method of claim 1, wherein:

the hybridizing step comprises contacting the amplification product with the detectable NG Piv labeled with a donor fluorescent moiety and a corresponding acceptor moiety_NgContacting a gene probe; and is

The detecting step comprises detecting the presence or absence of Fluorescence Resonance Energy Transfer (FRET) between the donor fluorescent moiety and the acceptor moiety of the probe, wherein the presence or absence of fluorescence is indicative of the presence or absence of NG in the sample.

3. The method of claim 2, wherein the amplifying step employs a polymerase having 5 'to 3' nuclease activity.

4. The method of any one of claims 2 to 3, wherein the donor fluorescent moiety and the corresponding acceptor moiety are no more than 8-20 nucleotides from each other on the probe.

5. The method of any one of claims 2 to 4, wherein the acceptor moiety is a quencher.

6. The method of any one of claims 1 to 5, wherein the first oligonucleotide and the second oligonucleotide each comprise at least one modified nucleotide.

7. The method of claim 6, wherein the at least one modified nucleotide is selected from N⁶-benzyl-dA, N⁴-benzyl-dC, N⁶p-tert-butyl-benzyl-dA and N4-p-tert-butyl-benzyl-dC.

8. The method of any one of claims 1 to 7, further comprising the step of contacting the sample with a set of primers and probes for amplifying and detecting the NGDR9 gene sequence.

9. A kit for detecting a nucleic acid of Neisseria Gonorrhoeae (NG) comprising:

-a first primer comprising SEQ ID NO: 1 or a complement thereof;

-a second primer comprising SEQ ID NO: 2 or a complement thereof; and

-a fluorescently detectably labeled probe comprising SEQ ID NO: 3 or a complement thereof, the detectably labeled probe configured to hybridize to an amplicon generated by the first primer and the second primer.

10. The kit of claim 9, wherein the third detectably labeled oligonucleotide sequence comprises a donor fluorescent moiety and a corresponding acceptor moiety.

11. The kit of claim 10, wherein the acceptor moiety is a quencher.

12. The kit of any one of claims 9 to 11, further comprising at least one of nucleoside triphosphates, a nucleic acid polymerase, and a buffer required for the function of the nucleic acid polymerase.

13. The kit of any one of claims 9 to 12, wherein at least one of the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide comprises at least one modified nucleotide.

14. The kit of any one of claims 9 to 13, wherein the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide have 40 nucleotides or less.

15. The kit of any one of claims 9 to 14, wherein the first oligonucleotide and the second oligonucleotide each comprise at least one modified nucleotide.

16. The kit of claim 15, wherein the at least one modified nucleotide is selected from N⁶-benzyl-dA, N⁴-benzyl-dC, N⁶-p-tert-butyl-benzyl-dA and N⁴-p-tert-butyl-benzyl-dC.

17. The kit of any one of claims 9 to 16, further comprising a set of primers and probes for amplifying and detecting the NGDR9 gene sequence.

Technical Field

The present disclosure relates to the field of molecular diagnostics, and more particularly to the detection of Neisseria gonorrhoeae (Neisseria gonorrhoeae).

Background

Neisseria Gonorrhoeae (NG), also known as gonococcus or gonococcus, is a gram-negative diplococcus isolated by Albert Neisser in 1879. NG is the pathogen of gonorrhea, a cytochrome oxidase positive, non-motile, non-sporulating gram-negative diplococcus. It causes sexually transmitted urogenital infectious gonorrhea and other forms of gonococcal disease, including disseminated gonococcemia, septic arthritis and gonococcal neonatal ophthalmia. Neisseria gonorrhoeae infects the mucosa of the reproductive tract, including the cervix, uterus and fallopian tubes in women and the urethra in women and men. Neisseria gonorrhoeae may also infect the mucosa of the mouth, throat, eyes and rectum.

Gonorrhea is a very common infectious disease. CDC estimates that there are approximately 820,000 new gonococcal infections annually in the united states, with more than half of the infections detected and reported to the centers for disease control and prevention (CDC). CDC estimates that 570,000 of these are young people 15-24 years of age. In 2017, 555,608 cases of gonorrhea were reported to the CDC.

Gonorrhea is transmitted by sexual contact with the penis, vagina, mouth or anus of an infected partner. Ejaculation is not necessary for the transmission or acquisition of gonorrhea. Gonorrhea can also be transmitted perinatally from mother to baby during labor. People who have gonorrhea and are treated may be reinfected if they come into physical contact with people infected with gonorrhea.

Gonorrhea is the second most commonly reported infectious disease. The clinical manifestations of NG infection are numerous. Many men with gonorrhea have no symptoms. Signs and symptoms of urinary tract infections in men include difficulty in urination or white, yellow or green urinary secretions, if any, which typically occur 1 to 14 days after infection. In the case of urinary tract infections complicated by epididymitis, men with gonorrhea may also complain of testicular or scrotal pain.

In women, the primary site of infection is the endocervix. The incidence of the combination of symptoms of Chlamydia Trachomatis (CT), Trichomonas vaginalis (Trichomonas vaginalis) and vaginosis is high; many women still have no symptoms and therefore do not seek medical care. Even when women are symptomatic, the symptoms are often so mild and nonspecific that they are mistaken for bladder or vaginal infections. Initial symptoms and signs in women include difficulty urinating, increased vaginal secretions, or vaginal bleeding occurring between menses. Women with gonorrhea are at risk of developing serious complications from infection, regardless of the presence or severity of the symptoms.

Other gonococcal infection sites in men and women are the pharynx and conjunctiva, and to a lesser extent, the disease manifests itself as disseminated gonococcal infection. Throat infections can cause sore throats, but are usually asymptomatic. The infant of the infected mother may suffer from conjunctivitis.

Screening for neisseria gonorrhoeae infection is recommended annually for all sexually active women under the age of 25 years and for older women at increased risk of infection (e.g., older women with new sexual partners, more than one sexual partner, sexual partners with the same sex partner, or sexual partners with Sexually Transmitted Infections (STI)).

If left untreated, gonorrhea can also spread into the blood and cause Disseminated Gonococcal Infection (DGI). DGI is often characterized by arthritis, tenosynovitis and/or dermatitis. This situation can be life threatening. Untreated gonorrhea can increase the risk of a person acquiring or transmitting HIV (the virus that causes AIDS).

Urogenital gonorrhea can be diagnosed by testing urine, urethral samples (for males), or endocervical or vaginal samples (for females) using the Nucleic Acid Amplification Test (NAAT). Therefore, there is a need in the art for a better and more sophisticated method for specifically detecting NG.

Disclosure of Invention

Certain embodiments in the present disclosure relate to methods for rapidly detecting the presence or absence of NG in a biological or non-biological sample, e.g., by multiplex detection of NG by real-time polymerase chain reaction in a single tube. Embodiments include methods of detecting NG that include performing at least one cycling step that may include an amplification step and a hybridization step. In addition, embodiments include primers, probes, and kits designed for detecting NG in a single tube. The detection methods are designed to target specific genes in the neisseria gonorrhoeae genome with the potential to distinguish between other neisseria species.

A method is provided for detecting Neisseria Gonorrhoeae (NG) in a sample, the method comprising performing an amplification step comprising contacting the sample with a set of primers designed to target a particular NG gene to produce an amplification product in the presence of NG in the sample; performing a hybridization step comprising contacting the amplification product with one or more detectable probes of the target NG gene; and detecting the presence or absence of the amplification product, wherein the presence of the amplification product is indicative of the presence of NG in the sample, and wherein the absence of the amplification product is indicative of the absence of NG in the sample; wherein the target NG gene is a pilin transforming protein (Piv)_Ng) A gene.

In one aspect, a method of detecting NG in a sample is provided, the method comprising performing an amplification step comprising contacting the sample with a set of pivs_NgContacting the gene primers to produce an amplification product in the presence of NG nucleic acid in the sample; performing a hybridization step comprising contacting the amplification product with one or more detectable Piv_NgContacting a gene probe; and detecting the presence or absence of the amplification product, wherein the presence of the amplification product is indicative of the presence of NG in the sample, and wherein the absence of the amplification product is indicative of the absence of NG in the sample; wherein the group Piv_NgThe gene primer comprises a first primer and a second primer, wherein the first primer comprises SEQ ID NO: 1 or the complement thereof, and the second primer comprises or consists of the sequence of SEQ ID NO: 2 or the complement thereof or consists of the sequence; and wherein one or more of the Piv is detectable_NgThe gene probe comprises SEQ ID NO: 3 or a complement thereof or consists of the sequence. In certain embodiments, the method of detecting NG further comprises contacting the sample with a set of primers and probes for amplifying and detecting the NGDR9 gene sequence, the primers and probes being described in U.S.7,476,736 (which is incorporated by reference in its entirety)Incorporated herein) are disclosed.

In some embodiments, the hybridizing step comprises contacting the amplification product with detectable NG Piv labeled with a donor fluorescent moiety and a corresponding acceptor moiety_NgContacting a gene probe; and the detecting step comprises detecting the presence or absence of Fluorescence Resonance Energy Transfer (FRET) between the donor fluorescent moiety and the acceptor moiety of the probe, wherein the presence or absence of fluorescence is indicative of the presence or absence of NG in the sample. In some embodiments, the amplification and hybridization steps are repeated. In this context, the number of repetitions depends, for example, on the nature of the sample. If the sample is a complex mixture of nucleic acids, more amplification and hybridization steps will be required to amplify the target sequence sufficient for detection. In some embodiments, the amplification and hybridization steps are repeated at least about 20 times, but may be repeated as many as at least 25, 30, 40, 50, 60, or even 100 times. Further, the presence or absence of amplification products can be detected during or after each amplification and hybridization step, during or after every other amplification and hybridization step, during or after a particular amplification and hybridization step, or during or after a particular amplification and hybridization step, where sufficient amplification products, if present, are expected to be available for detection. In some embodiments, the amplifying step uses a polymerase having 5 'to 3' nuclease activity. In some embodiments, the donor fluorescent moiety and the corresponding acceptor moiety are no more than 8-20 nucleotides from each other on the probe. In some embodiments, the acceptor moiety is a quencher. In some embodiments, the oligonucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 1-3 nucleotides or its complement, and has 100 or fewer nucleotides, 50 or fewer nucleotides, 40 or fewer nucleotides, or 30 or fewer nucleotides. In some embodiments, the first and second NG Piv_NgGene primer and detectable NG Piv_NgThe gene probe has 40 or fewer nucleotides (e.g., 35 or fewer nucleotides, 30 or fewer nucleotides, etc.).

In another embodiment, the present disclosure provides an oligonucleotide comprising a nucleotide sequence identical to SEQ ID NO: 1-3 or the complement thereofA nucleic acid having a sequence with at least 70% sequence identity (e.g., at least 75%, 80%, 85%, 90%, or 95%, etc.), and the oligonucleotide having 100 or fewer nucleotides. Generally, in these embodiments, the oligonucleotides can be primer nucleic acids, probe nucleic acids, and the like. In some embodiments, the oligonucleotide comprises at least one modified nucleotide, e.g., to alter nucleic acid hybridization stability relative to an unmodified nucleotide. In some embodiments, at least one modified nucleotide is selected from N⁶-benzyl-dA, N4-benzyl-dC, N⁶-p-tert-butyl-benzyl-dA and N⁴-p-tert-butyl-benzyl-dC. Optionally, the oligonucleotide comprises at least one label and/or at least one quencher moiety. In some embodiments, the oligonucleotide comprises at least one conservatively modified variation. "conservatively modified variations" or simply "conservative variations" of a particular nucleic acid sequence refers to those nucleic acids that encode identical or substantially identical amino acid sequences, or where the nucleic acids do not encode an amino acid sequence, to substantially identical sequences. One skilled in the art will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 4%, 2% or 1%) in the encoded sequence are "conservatively modified variations" where such alterations result in the deletion of an amino acid, addition of an amino acid, or substitution of an amino acid with a chemically similar amino acid. In some embodiments, at least one of the first and second target NG gene primers and the detectable target NG gene probe comprises at least one modified nucleotide.

In some embodiments, the amplification (amplification step) may employ a polymerase having 5 'to 3' nuclease activity. Thus, the donor fluorescent moiety and the acceptor moiety (e.g., quencher) can be no more than 5 to 20 nucleotides (e.g., 8 or 10) from each other along the length of the probe. In another aspect, the detectable probe comprises a nucleic acid sequence that allows for secondary structure formation. Such secondary structure formation typically results in spatial proximity between the first fluorescent moiety and the second fluorescent moiety. According to this method, the second fluorescent moiety on the probe can be a quencher.

The present disclosure provides methods for detecting the presence or absence of Neisseria Gonorrhoeae (NG) in a biological sample from an individual. Such methods typically comprise performing at least one cycling step comprising an amplification step and a dye binding step. Typically, the amplifying step comprises contacting the sample with a plurality of pairs of primers designed to target a particular NG gene to produce one or more target NG gene amplification products when the target NG gene nucleic acid molecule is present in the sample, and the dye binding step comprises contacting the target NG gene amplification products with a double-stranded DNA binding dye. In one embodiment, the target NG gene is NG Piv_NgA gene. Such methods further comprise detecting the presence or absence of binding of the double-stranded DNA binding dye to the amplification product, wherein the presence of binding indicates the presence of NG in the sample, and wherein the absence of binding indicates the absence of NG in the sample. A representative double stranded DNA binding dye is ethidium bromide. Additionally, such methods can further comprise determining a melting temperature between the target NG gene amplification product and the double-stranded DNA binding dye, wherein the melting temperature confirms the presence or absence of NG. In certain embodiments, the method of detecting the presence or absence of NG in a biological sample from an individual further comprises amplification with a set of primers for amplifying the NGDR9 gene sequence.

In yet another aspect, a method for detecting NG Piv is provided_NgA kit for a gene. The kit may comprise one or more sets of specifically amplifying NG Piv_NgGene primers and one or more specific detection methods for NG Piv_NgA detectable probe for a gene amplification product. In one embodiment, the kit further comprises one or more sets of primers and probes for amplifying and detecting the NGDR9 gene sequence.

In particular, the oligonucleotide primers and probes disclosed above in connection with the method according to the invention are suitable for inclusion in a kit according to the invention. Herein, a Piv for detecting NG is provided_NgA kit of genes, the kit comprising a first primer and a second primer, the first primer comprising SEQ ID NO: 1 or the complement thereof, and the second primer comprises or consists of the sequence of SEQ ID NO: 2, a second oligonucleotideA sequence or its complement or consisting of the sequence; and a fluorescently detectably labeled probe comprising SEQ ID NO: 3 or its complement, and the fluorescently detectably labeled probe is configured to hybridize to the amplicon generated by the first primer and the second primer. In one aspect, the kit can include a probe that has been labeled with a donor and a corresponding acceptor moiety (e.g., another fluorescent moiety or a dark quencher), or can include a fluorescent moiety for labeling the probe. The kit may further comprise at least one of nucleoside triphosphates, a nucleic acid polymerase, and a buffer required for the function of the nucleic acid polymerase. The kit can further include packaging instructions and instructions for using the primers, probes, and fluorescent moieties to detect the presence or absence of NG in a sample. In some embodiments, the third detectably labeled oligonucleotide sequence comprises a donor fluorescent moiety and a corresponding acceptor moiety. In some embodiments, the acceptor moiety is a quencher. In some embodiments, at least one of the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide comprises at least one modified nucleotide. In some embodiments, at least one modified nucleotide is selected from N⁶-benzyl-dA, N⁴-benzyl-dC, N⁶-p-tert-butyl-benzyl-dA and N⁴-p-tert-butyl-benzyl-dC. In some embodiments, the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide have 40 nucleotides or less.

In another aspect, a composition is provided comprising a set of oligonucleotide primers for amplifying a target NG gene as disclosed above. In some embodiments, the set of NG pivs_NgThe gene primer set comprises a first primer and a second primer, wherein the first primer comprises SEQ ID NO: 1 or the complement thereof, and the second primer comprises or consists of the sequence of SEQ ID NO: 2 or a complement thereof or consists of the sequence. In certain embodiments, the composition further comprises detectable NG Piv_NgA genetic probe comprising SEQ ID NO: 3, a third oligonucleotide sequenceA sequence or its complement or consists of such a sequence.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present subject matter, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the drawings and description, and from the claims.

Drawings

FIG. 1 shows a graph formed by NG Piv_NgPCR growth curves for real-time PCR experiments generated with primers and probes, where the concentration of genomic N.gonorrhoeae DNA template from strain #2949 was present at a genomic equivalent concentration (ge/PCR) of 30,000 (NG-2949-Neat), 3,000 (NG-2949-DF10-D1), 300 (NG-2949-DF10-D2), 30 (NG-2949-DF10-D3) and 3 (NG-2949-DF10-D4) per PCR reaction.

Detailed Description

Diagnosis of NG infection by nucleic acid amplification provides a method for rapid and accurate detection of bacterial infection. Described herein are real-time assays for detecting NG in a sample. Primers and probes for detecting NG are provided, as well as articles of manufacture or kits comprising such primers and probes. The higher sensitivity of real-time PCR to NG compared to other methods, and the improved characteristics of real-time PCR, including sample containment and real-time detection of amplification products, make this technique feasible for routine diagnosis of NG infection in clinical laboratories.

The present disclosure includes oligonucleotide primers and fluorescently labeled hydrolysis probes that hybridize to specific loci of the NG genome to useAmplification and detection techniques specifically identify NG. Targeted selection of NG requires a comprehensive search of public sequence databases and literature searches for NG targets that may distinguish between the nearest neighbors neisseria meningitidis (n.meningitidis) and neisseria lactis (n.lactamica). Multiple targets from public sequence databases were analyzed during targeted selection, but many showed cross-reactivity with other neisserial species. In addition, sequences in public databases are complicated by "bulk" sequence data from multiple copies of the target. As a result of the analysis, the target NG gene selected was NG pilin-converting protein (Piv)_Ng) Gene (GenBank accession U65994.1, residue 3603-4577).

The disclosed methods can include performing at least one cycling step that includes amplifying one or more portions of a nucleic acid molecule gene target from a sample using one or more pairs of primers. As used herein, a "primer" refers to an oligonucleotide primer that specifically anneals to a target gene in NG and initiates DNA synthesis therefrom under appropriate conditions to produce a corresponding amplification product. Each of the primers in question anneals to a target within or adjacent to the respective target nucleic acid molecule such that at least a portion of each amplification product contains a nucleic acid sequence corresponding to the target. If one or more of the target NG gene nucleic acids are present in the sample, one or more amplification products are produced, such that the presence of one or more of the target NG gene amplification products indicates the presence of NG in the sample. The amplification product should contain a nucleic acid sequence that is complementary to one or more detectable probes for the target NG gene. As used herein, a "probe" refers to an oligonucleotide probe that specifically anneals to a nucleic acid sequence encoding a target NG gene. Each cycling step comprises an amplification step, a hybridization step, and a detection step, wherein the sample is contacted with one or more detectable probes to detect the presence or absence of NG in the sample.

As used herein, the term "amplification" refers to the process of synthesizing a nucleic acid molecule that is complementary to one or both strands of a template nucleic acid molecule. Amplification nucleusAcid molecules generally include denaturing a template nucleic acid, annealing a primer to the template nucleic acid at a temperature below the melting temperature of the primer, and enzymatically extending from the primer to generate an amplification product. Amplification usually requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase (e.g.Taq) and suitable buffers and/or cofactors (e.g. MgCl) for optimizing polymerase activity₂And/or KCl).

The term "primer" as used herein is known to the skilled person and refers to an oligomeric compound capable of "priming" DNA synthesis by a template-dependent DNA polymerase, primarily to an oligonucleotide, but also to a modified oligonucleotide, i.e. e.g. the 3 '-end of the oligonucleotide provides a free 3' -OH group to which an additional "nucleotide" can be attached by a template-dependent DNA polymerase, thereby establishing a 3 'to 5' phosphodiester bond, thereby using deoxynucleoside triphosphates and thereby releasing pyrophosphate. Thus, there is no fundamental distinction between "primer", "oligonucleotide" or "probe" except for the possible intended function.

The term "hybridization" refers to the annealing of one or more probes to the amplification product. Hybridization conditions generally include a temperature below the melting temperature of the probe but which avoids non-specific hybridization of the probe.

The term "5 ' to 3 ' nuclease activity" refers to the activity of a nucleic acid polymerase that is normally associated with the synthesis of a nucleic acid strand, thereby removing nucleotides from the 5 ' end of the nucleic acid strand.

The term "thermostable polymerase" refers to a polymerase enzyme that is thermostable, i.e., that catalyzes the formation of primer extension products complementary to a template and that does not irreversibly denature when subjected to elevated temperatures for the time required to effect denaturation of double-stranded template nucleic acid. Generally, synthesis is initiated at the 3 ' end of each primer and proceeds in the 5 ' to 3 ' direction along the template strand. Thermostable polymerases have been isolated from Thermus flavus (Thermus flavus), Thermus rhodochrous (T.ruber), Thermus thermophilus (T.thermophilus), Thermus aquaticus (T.aquaticus), Thermus lactis (T.lactis), Thermus rubrus (T.rubens), Bacillus stearothermophilus (Bacillus stearothermophilus) and Methanothermus ferus (Methanothermus ferrus). However, non-thermostable polymerases may also be used in PCR assays, provided that the enzyme is supplemented.

The term "complementary sequence thereof" refers to a nucleic acid that is the same length as a given nucleic acid and is fully complementary.

The term "extension" or "elongation" when used in reference to a nucleic acid refers to the incorporation of additional nucleotides (or other similar molecules) into the nucleic acid. For example, the nucleic acid is optionally extended by a nucleotide incorporation biocatalyst, such as a polymerase that typically adds nucleotides at the 3' end of the nucleic acid.

The term "identical" or percent "identity," in the context of two or more nucleic acid sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same, when compared and aligned for maximum correspondence (e.g., as measured using one of the sequence comparison algorithms available to the skilled artisan or by visual inspection). An exemplary algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST program described, for example, in the following documents: altschul et al (1990) "Basic local alignment search tool" J.mol.biol.215: 403-; gish et al (1993) "Identification of protein coding regions by database similarity search" Nature Genet.3: 266-272; madden et al (1996) "Applications of network BLAST server" meth.Enzymol.266: 131-141; altschul et al (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs "Nucleic Acids Res.25: 3389 and 3402; and zhang et al (1997) "PowerBLAST: a new network BLAST application for interactive or automatic sequence analysis and interpretation "Genome Res.7: 649-656, each of which is incorporated herein by reference.

In the context of an oligonucleotide, "modified nucleotide" refers to an alteration in which at least one nucleotide of the oligonucleotide sequence is replaced with a different nucleotide that provides the oligonucleotide with a desired property. Can be in the oligonucleotides described hereinExemplary modified nucleotides that are substituted include, for example, C5-methyl-dC, C5-ethyl-dC, C5-methyl-dU, C5-ethyl-dU, 2, 6-diaminopurine, C5-propynyl-dC, C5-propynyl-dU, C7-propynyl-dA, C7-propynyl-dG, C5-propargylamino-dC, C5-propargylamino-dU, C7-propargylamino-dA, C7-propargylamino-dG, 7-deaza-2-deoxyxanthosine, pyrazolopyrimidine analog, pseudo-dU, nitropyrrole, nitroindole, 2 '-O-methylribose-U, 2' -O-methylribose-C, N4-ethyl-dC, N⁶-methyl-dA, N⁶-benzyl-dA, N4-benzyl-dC, N⁶p-tert-butyl-benzyl-dA, N4-p-tert-butyl-benzyl-dC, and the like. Many other modified nucleotides that may be substituted in the oligonucleotide are mentioned herein or otherwise known in the art. In certain embodiments, the modified nucleotide replaces the melting temperature (Tm) of the modified oligonucleotide relative to the melting temperature of the corresponding unmodified oligonucleotide. To further illustrate, in some embodiments, certain modified nucleotide substitutions can reduce non-specific nucleic acid amplification (e.g., minimize primer dimer formation, etc.), increase the yield of the desired target amplicon, and the like. Examples of these types of nucleic acid modifications are described, for example, in U.S. Pat. No. 6,001,611 (incorporated herein by reference).

Detection of NG

The present disclosure provides for amplification of, for example, NG Piv_NgA method for detecting NG in a portion of a nucleic acid sequence of a gene. The nucleic acid sequence of the gene is publicly available (e.g., GenBank accession No. U65994.1 residue 3603-4577, SEQ ID NO: 4). In particular, primers and probes for amplifying and detecting specific NG nucleic acid molecule targets are provided by embodiments of the present disclosure.

For the detection of NG, an amplification of NG Piv is provided_NgPrimers and probes for the gene. Nucleic acids other than those exemplified herein can also be used to detect NG in a sample. For example, one skilled in the art can use routine methods to assess the specificity and/or sensitivity of a functional variant. Representative functional variants can include, for example, one or more deletions, insertions, and/or substitutions in a target NG gene nucleic acid as disclosed herein.

More specifically, embodiments of the oligonucleotides each include a polynucleotide having a sequence selected from SEQ ID NOs: 1-3, a variant thereof that is substantially identical, wherein the variant has a sequence identical to SEQ ID NO: 1-3 or SEQ ID NO: 1-3 and the complement of the variant have at least, e.g., 80%, 90%, or 95% sequence identity.

Table I: piv_NgPrimers and probes

In one embodiment, the primer and probe sets described above are used in order to detect NG in a biological sample suspected of containing NG. The primer and probe sets may comprise the pair NG Piv_NgPrimers and probes specific for the nucleic acid sequence of the gene or consisting of these primers and probes comprising the nucleotide sequence of SEQ ID NO: 1-3 or consists of these nucleic acid sequences. In another embodiment, NG Piv_NgPrimers and probes for the gene comprise SEQ ID NO: 1-3 or consists of the functionally active variant of any of the primers and probes. In yet another embodiment, detecting NG in a biological sample further comprises providing primers and probes specific for the NGDR9 gene sequence (SEQ ID NO: 5), which are disclosed in U.S. Pat. No. 7,476,736 (incorporated herein by reference in its entirety).

The nucleic acid sequence of SEQ ID NO: 1-3. SEQ ID NO: 1-3, the functionally active variant of the primer and/or probe is related to the sequence as set forth in SEQ ID NO: 1-3 provide similar or higher specificity and sensitivity than the primers and/or probes in the described methods or kits.

Variants may be identical to SEQ ID NO: 1-3 are different in sequence. As described above, the primer (and/or probe) may be chemically modified, i.e. the primer and/or probe may comprise a modified nucleotide or non-nucleotide compound. The probe (or primer) is a modified oligonucleotide. "modified nucleotides" (or "nucleotide analogs") differ from natural "nucleotides" in some modifications, but still consist of a base or base-like compound, a pentofuranosyl sugar or pentofuranosyl sugar-like compound, a phosphate moiety or phosphate-like moiety, or a combination thereof. For example, a "label" may be attached to the base portion of a "nucleotide", thereby obtaining a "modified nucleotide". The natural base in the "nucleotide" can also be replaced, for example, by a 7-deazapurine, whereby a "modified nucleotide" is also obtained. The terms "modified nucleotide" or "nucleotide analog" are used interchangeably in this application. A "modified nucleoside" (or "nucleoside analog") differs from a natural nucleoside by some modifications in the manner as outlined above for a "modified nucleotide" (or "nucleotide analog").

The amplification-encoded target NG Piv can be designed using, for example, a computer program such as OLIGO (Molecular Biology instruments Inc., Cascade, Colo.)_NgOligonucleotides, including modified oligonucleotides and oligonucleotide analogs, of nucleic acid molecules of a gene. When designing oligonucleotides for use as amplification primers, important features include, but are not limited to, an amplification product of appropriate size to facilitate detection (e.g., by electrophoresis), a similar melting temperature for the members of a pair of primers, and the length of each primer (i.e., the primers need to be long enough to specifically anneal to sequences and initiate synthesis, but not so long that fidelity is reduced during oligonucleotide synthesis). Typically, oligonucleotide primers are 8 to 50 nucleotides in length (e.g., 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides in length). In some embodiments, the oligonucleotide primer is 40 nucleotides or less in length.

In addition to a set of primers, these methods may use one or more probes to detect the presence or absence of NG. The term "probe" refers to synthetically or biologically produced nucleic acids (DNA or RNA) that are designed or selected to contain a specific nucleotide sequence that allows them to specifically (i.e., preferentially) hybridize to a "target nucleic acid" (in the case of the present invention, to a target NG gene nucleic acid) under a defined predetermined stringency. A "probe" can be referred to as a "detection probe," meaning that it detects a target nucleic acid.

In some embodiments, the described NG Piv_NgThe gene probe may be labeled with at least one fluorescent label. In one embodiment, NG Piv_NgGene probes can be labeled with a donor fluorescent moiety (e.g., a fluorescent dye) and a corresponding acceptor moiety (e.g., a quencher). In one embodiment, the probe comprises or consists of a fluorescent moiety and the nucleic acid sequence comprises SEQ ID NO: 3 or consists thereof.

The design of oligonucleotides for use as probes can be performed in a manner similar to primer design. Embodiments may use a single probe or a pair of probes to detect the amplification product. According to embodiments, the probe used may comprise at least one label and/or at least one quencher moiety. As with the primers, the probes generally have similar melting temperatures, and each probe must be long enough for sequence-specific hybridization to occur, but not so long that fidelity is reduced during synthesis. Oligonucleotide probes are typically 15 to 40 (e.g., 16, 18, 20, 21, 22, 23, 24, or 25) nucleotides in length.

The constructs may comprise each NG Piv_NgA vector of one of a gene primer and a probe nucleic acid molecule. The construct may be used, for example, as a control template nucleic acid molecule. Suitable vectors are commercially available and/or produced by recombinant nucleic acid techniques conventional in the art. NG Piv_NgThe genetic nucleic acid molecule may be obtained, for example, by chemical synthesis, direct cloning from a CA, or by PCR amplification.

Except for NG Piv_NgIn addition to genetic nucleic acid molecules (e.g., nucleic acid molecules comprising one or more of the sequences of SEQ ID NOS: 1-3), constructs suitable for use in the methods generally include sequences encoding a selectable marker (e.g., an antibiotic resistance gene) for selection of the desired construct and/or transformant, as well as an origin of replication. Selection of the vector System in generalDepending on several factors, including but not limited to the choice of host cell, replication efficiency, selectivity, inducibility, and ease of recovery.

The construct containing the target NG gene nucleic acid molecule can be propagated in a host cell. As used herein, the term host cell is intended to include prokaryotes and eukaryotes, such as yeast, plant, and animal cells. Prokaryotic hosts may include E.coli (E.coli), Salmonella typhimurium (Salmonella typhimurium), Serratia marcescens (Serratia marcescens), and Bacillus subtilis. Eukaryotic hosts include yeast (such as saccharomyces cerevisiae (s. cerevisiae), schizosaccharomyces pombe (s. pombe), Pichia pastoris (Pichia pastoris)), mammalian cells (such as COS cells or Chinese Hamster Ovary (CHO) cells), insect cells and plant cells (such as Arabidopsis thaliana (Arabidopsis thaliana) and tobacco (Nicotiana tabacum)). The construct may be introduced into the host cell using any technique known to those of ordinary skill in the art. For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and virus-mediated nucleic acid transfer are common methods for introducing nucleic acids into host cells. In addition, naked DNA can be delivered directly to cells (see, e.g., U.S. Pat. nos. 5,580,859 and 5,589,466).

Polymerase Chain Reaction (PCR)

U.S. Pat. nos. 4,683,202, 4,683,195, 4,800,159 and 4,965,188 disclose conventional PCR techniques. PCR typically employs two oligonucleotide primers that bind to a selected nucleic acid template (e.g., DNA or RNA). Primers useful in some embodiments include oligonucleotides that can serve as initiation points for nucleic acid synthesis within the described target NG gene nucleic acid sequences. The primer may be purified from the restriction digest by conventional methods, or it may be produced synthetically. The primer is preferably single stranded for maximum amplification efficiency, but the primer may be double stranded. The double stranded primer is first denatured (i.e., treated) to separate the strands. One method of denaturing double-stranded nucleic acids is by heating.

If the template nucleic acid is double-stranded, the two strands must be separated before it can be used as a template in PCR. Strand separation may be accomplished by any suitable denaturing method, including physical, chemical, or enzymatic means. One method of separating nucleic acid strands involves heating the nucleic acid until a substantial portion thereof is denatured (e.g., greater than 50%, 60%, 70%, 80%, 90%, or 95% denatured). The heating conditions required to denature the template nucleic acid will depend on, for example, the buffer salt concentration and the length and nucleotide composition of the nucleic acid to be denatured, but are generally in the range of about 90 ℃ to about 105 ℃ for a period of time, depending on the characteristics of the reaction such as temperature and nucleic acid length. Denaturation is typically carried out for about 30 seconds to 4 minutes (e.g., 1 minute to 2 minutes for 30 seconds, or 1.5 minutes).

If the double-stranded template nucleic acid is denatured by heating, the reaction mixture is cooled to a temperature that facilitates annealing of each primer to the target sequence on the described target NG gene nucleic acid molecule. The temperature for annealing is typically from about 35 ℃ to about 65 ℃ (e.g., from about 40 ℃ to about 60 ℃; from about 45 ℃ to about 50 ℃). The annealing time can be from about 10 seconds to about 1 minute (e.g., from about 20 seconds to about 50 seconds; from about 30 seconds to about 40 seconds). The reaction mixture is then adjusted to a temperature that promotes or optimizes polymerase activity, i.e., a temperature sufficient for extension to occur from the annealed primer to generate a product complementary to the template nucleic acid. The temperature should be sufficient to synthesize extension products from each primer that anneals to the nucleic acid template, but should not be so high as to denature the extension products from their complementary template (e.g., the temperature used for extension is typically in the range of about 40 ℃ to about 80 ℃ (e.g., about 50 ℃ to about 70 ℃; about 60 ℃)). The extension time can be from about 10 seconds to about 5 minutes (e.g., from about 30 seconds to about 4 minutes; from about 1 minute to about 3 minutes; from about 1 minute to 30 seconds to about 2 minutes).

PCR analysis can employ nucleic acids such as RNA or dna (cdna). Template nucleic acid does not need to be purified; it may be a small part of a complex mixture, such as a nucleic acid contained in a human cell. Nucleic acid molecules can be extracted from biological samples by conventional techniques, such as Diagnostic Molecular Microbiology: those described in Principles and Applications (Perssing et al (ed.), 1993, American Society for Microbiology, Washington D.C.). Nucleic acids can be obtained from a number of sources, such as plasmids or natural sources, including bacteria, yeast, protozoan viruses, organelles, or higher organisms, such as plants or animals.

Oligonucleotide primers are mixed with PCR reagents under reaction conditions that induce primer extension. For example, chain extension reactions typically include 50mM KCl, 10mM Tris-HCl (pH 8.3), 15mM MgCl₂0.001% (w/v) gelatin, 0.5-1.0. mu.g of the original denatured template DNA, 50pmol of each oligonucleotide primer, 2.5U of Taq polymerase and 10% DMSO. The reaction typically comprises 150 to 320. mu.M of each of dATP, dCTP, dTTP, dGTP or one or more analogues thereof.

The newly synthesized strands form double-stranded molecules that can be used in subsequent reaction steps. The steps of strand separation, annealing, and extension can be repeated as many times as necessary to produce a desired number of amplification products corresponding to the target nucleic acid molecule. The limiting factors in the reaction are the amount of primer, thermostable enzyme and nucleoside triphosphates present in the reaction. Preferably at least one cycle of steps (i.e., denaturation, annealing and extension) is repeated. For use in detection, the number of cycling steps will depend on, for example, the nature of the sample. If the sample is a complex mixture of nucleic acids, more cycling steps will be required to amplify the target sequence sufficient for detection. Typically, the cycling step is repeated at least about 20 times, but may be repeated as many as 40, 60, or even 100 times.

Fluorescence Resonance Energy Transfer (FRET)

FRET techniques (see, e.g., U.S. Pat. nos. 4,996,143, 5,565,322, 5,849,489, and 6,162,603) are based on the concept of: when the donor fluorescent moiety and the corresponding acceptor fluorescent moiety are located within a certain distance of each other, an energy transfer between the two fluorescent moieties occurs, which can be visualized or otherwise detected and/or quantified. The donor typically transfers energy to the acceptor when excited by a suitable wavelength of optical radiation. The acceptor typically re-emits the transferred energy as optical radiation of a different wavelength. In certain systems, non-fluorescent energy can be transferred between donor and acceptor moieties by biomolecules that include substantially non-fluorescent donor moieties (see, e.g., U.S. patent No. 7,741,467).

In one example, an oligonucleotide probe can contain a donor fluorescent moiety and a corresponding quencher, which may or may not be fluorescent,and dissipates the transferred energy in a form other than light. When the probe is intact, energy transfer typically occurs between the donor and acceptor moieties such that fluorescent emission from the fluorescent moiety of the donor is quenched by the acceptor moiety. During the extension step of the polymerase chain reaction, the probe bound to the amplification product is cleaved by, for example, the 5 'to 3' nuclease activity of Taq polymerase, such that the fluorescent emission of the donor fluorescent moiety is no longer quenched. Exemplary probes for this purpose are described, for example, in U.S. Pat. nos. 5,210,015, 5,994,056, and 6,171,785. Commonly used donor-acceptor pairs include FAM-TAMRA pairs. Commonly used quenchers are DABCYL and TAMRA. Commonly used dark Quenchers include Black hole Quenchers^TM(BHQ)(Biosearch Technologies，Inc.，Novato，Cal.)、Iowa Black^TM(Integrated DNA Tech.，Inc.，Coralville，Iowa)、BlackBerry^TM Quencher 650(BBQ-650)(Berry&Assoc.，Dexter，Mich.)。

In another example, two oligonucleotide probes (each containing a fluorescent moiety) can hybridize to an amplification product at specific locations determined by the complementarity of the oligonucleotide probes to the target nucleic acid sequence. When the oligonucleotide probe hybridizes to the amplification product nucleic acid at the appropriate location, a FRET signal is generated. The hybridization temperature may be in the range of about 35 ℃ to about 65 ℃ for about 10 seconds to about 1 minute.

Fluorescence analysis can be performed using, for example, a photon-counting epifluorescence microscope system (including appropriate dichroic mirrors and filters for monitoring a specific range of fluorescence emissions), a photon-counting photomultiplier system, or a fluorometer. Excitation may be performed using an argon ion laser, a high intensity mercury (Hg) arc lamp, a fiber optic light source, or other high intensity light source appropriately filtered to excite within the desired range to initiate energy transfer or allow direct detection of the fluorophore.

As used herein with respect to a donor and a corresponding acceptor moiety, "corresponding" refers to an acceptor fluorescent moiety or dark quencher having an absorption spectrum that overlaps with the emission spectrum of the donor fluorescent moiety. The maximum wavelength of the emission spectrum of the acceptor fluorescent moiety should be at least 100nm greater than the maximum wavelength of the excitation spectrum of the donor fluorescent moiety. Thus, efficient non-radiative energy transfer can occur between them.

The fluorescence donor and corresponding acceptor moieties are typically selected for: (a) high efficiency Forster energy transfer; (b) larger final Stokes shift (> 100 nm); (c) shift the emission as far as possible into the red part of the visible spectrum (> 600 nm); and (d) shifting the emission to a wavelength higher than the Raman water fluorescence emission produced by excitation at the donor excitation wavelength. For example, the following donor fluorescent moieties can be selected: it has its excitation maximum near the laser line (e.g., helium-cadmium 442nm or argon 488nm), has a high extinction coefficient, high quantum yield, and its fluorescence emission overlaps well with the excitation spectrum of the corresponding acceptor fluorescent moiety. The following corresponding acceptor fluorescent moieties may be selected: it has a high extinction coefficient, a high quantum yield, its emission overlaps well with that of the fluorescent part of the donor, and it emits in the red part of the visible spectrum (> 600 nm).

Representative donor fluorescent moieties that can be used with various acceptor fluorescent moieties in FRET technology include fluorescein, Lucifer Yellow, B-phycoerythrin, 9-acridine isothiocyanate, Lucifer Yellow VS, 4-acetamido-4 ' -isothiocyanatodistyryl-2, 2 ' -disulfonic acid, 7-diethylamino-3- (4 ' -isothiocyanatophenyl) -4-methylcoumarin, 1-pyrenebutanoic acid succinimidyl ester, and 4-acetamido-4 ' -isothiocyanatodistyryl-2, 2 ' -disulfonic acid derivatives. Representative acceptor fluorescent moieties include LC Red640, LC Red705, Cy5, Cy5.5, lissamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriamine pentaacetate or other chelates of lanthanide ions such as europium or terbium, depending on the donor fluorescent moiety used. Donor and acceptor fluorescent moieties can be obtained, for example, from Molecular Probes (Junction City, Oreg.) or Sigma Chemical Co (st.

The donor and acceptor fluorescent moieties may be attached to a suitable probe oligonucleotide via a linker arm. The length of each linker arm is important because the linker arm will affect the distance between the donor and acceptor fluorescent moieties. The linker arm may be of a length selected from the group consisting of nucleotide basesDistance from base to fluorescent moiety (in angstroms)Representation). Generally, the joint arm is aboutTo aboutThe linker arm may be of the kind described in WO 84/03285. WO 84/03285 also discloses methods for attaching a linker arm to a specific nucleotide base and for attaching a fluorescent moiety to a linker arm.

An acceptor fluorescent moiety, such as LC Red640, can be combined with an oligonucleotide containing an amino linker, e.g., C6-phosphoramidite available from ABI (Foster City, Calif.) or Glen Research (Sterling, VA), to produce, for example, an LC Red640 labeled oligonucleotide. Frequently used linkers for coupling donor fluorescent moieties, such as fluorescein, to oligonucleotides include thiourea linkers (FITC-derivatized, e.g., fluorescein-CPG 'from Glen Research or ChemGene (Ashland, Mass.), amide linkers (fluorescein-NHS-ester derivatized, such as CX-fluorescein-CPG from BioGenex (San Ramon, Calif.), or 3' -amino-CPG which require coupling of fluorescein-NHS-ester after oligonucleotide synthesis.

Detection of NG

The present disclosure provides methods for detecting the presence or absence of NG in a biological or non-biological sample. The provided method avoids the problems of sample contamination, false negatives and false positives. These methods comprise performing at least one cycling step comprising amplifying a portion of a target nucleic acid molecule from a sample using one or more pairs of primers and a FRET detecting step. Preferably, multiple cycling steps are performed in a thermal cycler. The method can be performed using primers and probes that detect the presence of NG, and detection of a target NG gene indicates the presence of NG in the sample.

The amplification products can be detected using labeled hybridization probes using FRET techniques, as described herein. FRET form utilizationTechniques to detect the presence or absence of amplification products, and thus the presence or absence of CA.The technique utilizes a single-stranded hybridization probe labeled with, for example, a fluorescent dye and a quencher, which may or may not be fluorescent. When the first fluorescent moiety is excited with light of the appropriate wavelength, the absorbed energy is transferred to the second fluorescent moiety or the dark quencher according to the FRET principle. The second moiety is typically a quencher molecule. During the annealing step of the PCR reaction, the labeled hybridization probes bind to the target DNA (i.e., amplification products) and are degraded by, for example, the 5 'to 3' nuclease activity of Taq polymerase during the subsequent extension phase. Thus, the fluorescent moiety and the quencher moiety become spatially separated from each other. Thus, upon excitation of the first fluorescent moiety in the absence of the quencher, fluorescent emission from the first fluorescent moiety can be detected. For example, ABI7700 the sequence detection System (Applied Biosystems) usesTechniques, and is suitable for performing the methods described herein for detecting the presence or absence of NG in a sample.

The presence of amplified products can also be detected using real-time PCR methods using molecular beacons that bind FRET. Molecular beacon technology uses hybridization probes labeled with a first fluorescent moiety and a second fluorescent moiety. The second fluorescent moiety is typically a quencher, and a fluorescent label is typically located at each end of the probe. Molecular beacon technology uses probe oligonucleotides with sequences that allow the formation of secondary structures (e.g., hairpins). As a result of the formation of secondary structures within the probe, the two fluorescent moieties are in spatial proximity when the probe is in solution. Upon hybridization to the target nucleic acid (i.e., amplification product), the secondary structure of the probe is destroyed and the fluorescent moieties become separated from each other such that upon excitation with light of an appropriate wavelength, emission of the first fluorescent moiety can be detected.

Another common form of FRET technology utilizes two hybridization probes. Each probe may be labeled with a different fluorescent moiety and is typically designed to hybridize in close proximity to each other in the target DNA molecule (e.g., amplification product). The donor fluorescent moiety (e.g., fluorescein) is composed ofThe light source of the instrument was excited at 470 nm. During FRET, fluorescein transfers its energy to an acceptor fluorescent moiety, such as-Red 640(LC Red 640) orRed705 (LC Red 705). The acceptor fluorescent moiety then emits light of a longer wavelength, which is reflected byThe optical detection system of the instrument detects. Efficient FRET occurs only when the fluorescent moiety is in direct local proximity and when the emission spectrum of the donor fluorescent moiety overlaps with the absorption spectrum of the acceptor fluorescent moiety. The intensity of the emitted signal can be correlated to the number of original target DNA molecules (e.g., the number of CA genomes). If the target nucleic acid is amplified and an amplification product is produced, the hybridizing step produces a detectable signal based on FRET between the members of the probe pair.

Typically, the presence of FRET indicates the presence of NG in the sample, and the absence of FRET indicates the absence of NG in the sample. However, inadequate specimen collection, transport delays, improper transport conditions, or the use of certain collection swabs (calcium alginate or aluminum rods) are conditions that can affect the success and/or accuracy of the test results. Using the methods disclosed herein, FRET is detected within, for example, 45 cycling steps to indicate NG infection.

Representative biological samples that may be used in practicing the methods include, but are not limited to, respiratory tract specimens, fecal specimens, blood specimens, skin swabs, nasal swabs, wound swabs, blood cultures, skin and soft tissue infections. Methods for the collection and storage of biological samples are known to those skilled in the art. The biological sample can be treated (e.g., by nucleic acid extraction methods and/or kits known in the art) to release NG nucleic acids, or in some cases, the biological sample can be directly contacted with PCR reaction components and suitable oligonucleotides.

Melting curve analysis is an additional step that may be included in the cycling curve. Melting curve analysis is based on the fact that DNA melts at a characteristic temperature called the melting temperature (Tm), which is defined as the temperature at which half of a DNA duplex separates into single strands. The melting temperature of DNA depends mainly on its nucleotide composition. Thus, a DNA molecule rich in G and C nucleotides has a higher Tm than a DNA molecule rich in A and T nucleotides. By detecting the temperature at which signal is lost, the melting temperature of the probe can be determined. Similarly, by detecting the temperature at which the signal is generated, the annealing temperature of the probe can be determined. The melting temperature of the probe from the amplification product may confirm the presence or absence of NG in the sample.

Control samples can also be cycled during each thermocycler run. The positive control sample can amplify a target nucleic acid control template (in addition to the target gene amplification product described) using, for example, control primers and control probes. The positive control sample can also amplify, for example, a plasmid construct containing the target nucleic acid molecule. Such a plasmid control may be amplified internally (e.g., within the sample) or in a separate sample run in parallel with the patient sample using the same primers and probes as used to detect the intended target. Such controls are indicative of the success or failure of the amplification, hybridization and/or FRET reactions. Each thermal cycler run may also include, for example, a negative control lacking target template DNA. Negative controls can measure contamination. This ensures that the system and reagents do not produce false positive signals. Thus, control reactions can readily determine, for example, the ability of a primer to anneal and initiate extension with sequence specificity, and the ability of a probe to hybridize and FRET occurs with sequence specificity.

In one embodiment, the method comprises the step of avoiding contamination. For example, enzymatic methods utilizing uracil-DNA glycosylase are described in U.S. Pat. nos. 5,035,996, 5,683,896, and 5,945,313 to reduce or eliminate contamination between one thermal cycler run and the next.

The method can be practiced using conventional PCR methods in combination with FRET techniques. In one embodiment, use is made ofAn apparatus. The following patent applications describeReal-time PCR used in the art: WO 97/46707, WO 97/46714 and WO 97/46712.

May operate using a PC workstation and may utilize the Windows NT operating system. The signal from the sample is obtained when the machine positions the capillary tube sequentially on the optical unit. The software can display the fluorescence signal in real time immediately after each measurement. Fluorescence acquisition times ranged from 10-100 milliseconds (msec). The quantitative display of fluorescence versus cycle number for all samples can be continuously updated after each cycle step. The generated data may be stored for further analysis.

As an alternative to FRET, a double stranded DNA binding dye such as a fluorescent DNA binding dye (e.g., a fluorescent DNA binding dye) may be usedGreen orGold (molecular probes)) to detect the amplification products. Upon interaction with double-stranded nucleic acids, such fluorescent DNA binding dyes emit a fluorescent signal upon excitation with light of a suitable wavelength. Double stranded DNA binding dyes, such as nucleic acid intercalating dyes, can also be used. When using double-stranded DNA binding dyes, melting curves are usually performedLine analysis to confirm the presence of amplified product.

It should be understood that embodiments of the present disclosure are not limited by the configuration of one or more commercially available instruments.

Article/kit

Embodiments of the present disclosure also provide an article, composition, or kit for detecting NG. The article of manufacture can include primers and probes for detecting the target NG gene, as well as suitable packaging materials. The composition can include a primer for amplifying the target NG gene. In certain embodiments, the composition can further comprise a probe for detecting the target NG gene. Representative primers and probes for detecting NG are capable of hybridizing to a target nucleic acid molecule. In addition, the kit may also include appropriately packaged reagents and materials required for DNA immobilization, hybridization, and detection, such as solid supports, buffers, enzymes, and DNA standards. Methods of designing primers and probes are disclosed herein, and representative examples of primers and probes that amplify and hybridize to a target nucleic acid molecule are provided.

The article of manufacture may also include one or more fluorescent moieties for labeling the probe, or, alternatively, the probe provided with the kit may be labeled. For example, the article of manufacture can include donor and/or acceptor fluorescent moieties for labeling the probe. Examples of suitable FRET donor fluorescent moieties and corresponding acceptor fluorescent moieties are provided above.

The article of manufacture may further comprise a package insert or package label having instructions thereon for using the primers and probes to detect NG in a sample. The articles and compositions can additionally include reagents (e.g., buffers, polymerases, cofactors, or contamination prevention reagents) for performing the methods disclosed herein. Such reagents may be specific to one of the commercially available instruments described herein.

Embodiments of the present disclosure are further described in the following examples, which do not limit the scope of the invention described in the claims.

Examples

The following examples, tables and drawings are provided to aid in the understanding of the subject matter, the true scope of which is set forth in the appended claims. It will be appreciated that modifications can be made to the procedures set forth without departing from the spirit of the invention.

Example 1

Targeted selection for NG is the result of a comprehensive search of public sequence databases and a literature search for NG targets that may distinguish between the nearest neighbors neisseria meningitidis and neisseria lactis. The NG target selected utilized the pilin conversion protein (Piv)_NG) Gene targets, and is 7 copies per genome. Piv_NGRegions contain sequence variants that can affect probe hybridization, however these variants do not contain more than three of the 7 copies in a sequence database review.

Use of4800 systems orThe 6800/8800 system platform (Roche Molecular Systems, inc., Pleasanton, CA) performs real-time PCR detection of NG. The final concentrations of amplification reagents are shown below:

TABLE II PCR amplification reagents

The following table shows a typical temperature profile for a PCR amplification reaction:

TABLE III PCR temperature Curve

The Pre-PCR procedure involves initial denaturation and incubation at 55 ℃,60 ℃ and 65 ℃ to reverse transcribe the RNA template. Incubation at three temperatures simultaneously had the following advantageous effects: at lower temperatures, slightly mismatched target sequences (such as genetic variants of an organism) are also transcribed, while at higher temperatures, the formation of RNA secondary structures is inhibited, thereby making transcription more efficient. The PCR cycle was divided into two measurements, where the two measurements applied a one-step setup (combined annealing and extension). The first 5 cycles at 55 ℃ allowed for increased inclusion by preamplification of slightly mismatched target sequences, while the second 45 cycles provided increased specificity by using an annealing/extension temperature of 58 ℃.

Piv Using the above conditions_NGAnd (3) amplification and detection of the gene. The genomic NG DNA from strain #2949 (present at concentrations of 30,000, 3,000 and 300, 30 and 3 genome equivalent concentrations (ge/PCR) per PCR reaction) was used with SEQ ID NO: 1-2 and the oligonucleotide primers of SEQ ID NO: 3 is shown in figure 1. Each assay was performed in duplicate and showed approximately 3.3 cycles of signal difference between 10-fold dilutions of NG strain # 2949.

Example 2

14 NG strains were used to evaluate SEQ ID NO: 1-3 inclusive of primer/probe combinations. Samples were extracted with a manual Qiagen kit and quantified by nanodrop. In all strains, NG was detected at 3.0e2 ge/PCR (Table IV). The range of Ct values obtained for each dilution level in the panel is relatively broad, which may be due to the inaccuracy of nanodrop readings for nucleic acid quantification.

Table IV: ct value of NG containment data

Example 3

For NG exclusivity, a panel of 18 commensal neisseria species was tested (table V). Samples were purified by manual Qiagen kit and quantified by nanodrop. No cross-reactivity was observed at 3.0e4 genomic copies/PCR (data not shown).

Table V: NG Exclusive group

Strain #	Species (II)
		6305	Neisseria subflavescens (Neisseria flavescens)
6318	Denitrification neisseria (N.Denitrificans)
		10231	Neisseria meningitidis serogroup D (n.meningidis ser D)
838	Polysaccharide neisseria (N.polysaccharea)
		6339	Neisseria profunda (N. perflava)
836	Yellow neisseria (N.flava)
		1927	Neisseria sicca (N.sicca)
6313	Lactose Neisseria (N.lactamica)
		6322	Neisseria longae (N.elonggata)
2631	Micro yellow neisseria (N.subflava)
		348	Neisseria meningitidis serogroup C (N.meningintidis ser C)
349	Neisseria meningitidis serogroup Y (n.meningidis ser Y)
		6336	Neisseria mucosa (N.mucosas)
33926	Neisseria monkey (N.macacae)
		577	Sample 577
839	Neisseria sicca (N.sicca)
		10230	Neisseria weissei (N.weaveeri)
6317	Neisseria gray (N.cinerea)

Although the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all of the techniques and apparatus described above may be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.

Informal sequence listing

SEQ ID NO 1: r6_1483F _ TBBC forward primer

CGCAGCATACGCGC

SEQ ID NO 2: r6_1483R _ TBB reverse primer

ATGGCTTTGATGATTTGCGC

SEQ ID NO 3: r6_1483_ P probe

TCATCACGCGGCAAAAGATGAAGAAGCGG

SEQ ID NO 4: PivNG gene sequence (GenBank accession No. U65994.1, residue 3603-

SEQ ID NO 5: NGDR9 gene sequence