阅读说明：本技术 核酸扩增方法及其应用 (Nucleic acid amplification method and application thereof ) 是由 王一凡 梁振伟 蒲珏 于 2020-07-21 设计创作，主要内容包括：本文公开了一种核酸扩增方法,包括向扩增反应体系中加入切刻内切酶和可以在扩增反应过程中形成该切刻内切酶的识别位点的扩增引物。本发明的核酸扩增方法可以以单链或双链DNA分子或RNA分子为模板在恒温条件下进行扩增反应,操作简便,反应快速,灵敏度高,可方便地应用于疾病诊断或病原体的检测。(Disclosed herein is a nucleic acid amplification method comprising adding a nicking endonuclease and amplification primers that can form a recognition site for the nicking endonuclease during an amplification reaction to an amplification reaction system. The nucleic acid amplification method of the invention can carry out amplification reaction under the constant temperature condition by taking single-stranded or double-stranded DNA molecules or RNA molecules as templates, has simple and convenient operation, quick reaction and high sensitivity, and can be conveniently applied to disease diagnosis or pathogen detection.)

1. A method for amplifying a nucleic acid, comprising adding to an amplification reaction system:

1) a target nucleic acid comprising a target fragment to be amplified, the target fragment to be amplified comprising, in order from the 5 'end to the 3' end, a 5 'end sequence, a middle sequence, and a 3' end sequence;

2) a nicking endonuclease;

3) a DNA polymerase having strand displacement activity, lacking 5 '→ 3' exonuclease activity; and

4) a core primer pair, the core primer pair comprising:

a) a forward core primer comprising, in order from the 5 'end to the 3' end, a forward core primer first sequence, a forward core primer second sequence, and a forward core primer third sequence, wherein the junction of the forward core primer first sequence and the forward core primer second sequence is designed as a cleavage site for the nicking endonuclease; the nucleotide sequence of the third sequence of the forward core primer is the same as the 5' end sequence of the fragment to be amplified; and

b) A reverse core primer comprising, in order from 5 ' to 3 ', a reverse core primer first sequence and a reverse core primer second sequence, the reverse core primer first sequence having a nucleotide sequence that is the same as or part of the 3 ' sequence of the forward core primer second sequence; the nucleotide sequence of the second sequence of the reverse core primer is reverse complementary to the 3' terminal sequence of the fragment to be amplified.

2. The nucleic acid amplification method of claim 1, further comprising adding a pair of displacement primers to the amplification reaction system, the pair of displacement primers comprising:

a) a forward displacement primer having a nucleotide sequence identical to a portion of the sequence upstream of the target fragment to be amplified in the target nucleic acid; and

b) a reverse displacement primer whose nucleotide sequence is reverse complementary to a portion of the sequence downstream of the target fragment to be amplified in the target nucleic acid.

3. The nucleic acid amplification method of claim 1 or 2, which is performed under a constant temperature condition.

4. The nucleic acid amplification method of any one of claims 1 to 3, wherein the target fragment to be amplified is 20 to 1000 bases in length.

5. The nucleic acid amplification method of any one of claims 1 to 4, wherein the target fragment to be amplified is 40 to 400 bases in length.

6. The nucleic acid amplification method of any one of claims 1 to 5 wherein the amplification product comprises a double-stranded DNA molecule and a stem-loop structure DNA molecule.

7. The nucleic acid amplification method of any one of claims 1 to 6, wherein one strand of the double-stranded DNA molecule comprises, in order from the 5 'end to the 3' end:

the forward core primer second sequence;

the target fragment to be amplified; and

the reverse complement of the second sequence of the forward core primer.

8. The nucleic acid amplification method of any one of claims 1 to 7, wherein the stem-loop structure DNA molecule comprises:

the forward core primer second sequence;

the target fragment to be amplified or a complementary sequence thereof; and

a reverse complement of the second sequence of the forward core primer;

wherein the forward core primer second sequence and the reverse complement of the forward core primer second sequence form a stem portion and the target fragment to be amplified or its complement forms a loop portion.

9. The nucleic acid amplification method according to any one of claims 1 to 8, wherein the Tm value of the stem-loop structure DNA molecule is not lower than the reaction temperature of the amplification reaction system.

10. The nucleic acid amplification method according to any one of claims 1 to 9, wherein the Tm value of a double strand formed by binding the forward core primer to the complementary strand of the target nucleic acid is not less than the Tm value of a double strand formed by binding the forward displacement primer to the complementary strand of the target nucleic acid, and the Tm value of a double strand formed by binding the reverse core primer to the target nucleic acid is not less than the Tm value of a double strand formed by binding the reverse displacement primer to the target nucleic acid.

11. The nucleic acid amplification method of any one of claims 1 to 10, wherein the Tm value of the double strand formed by the forward core primer first sequence and its complementary strand is not less than the Tm value of the double strand formed by the forward core primer second sequence and its complementary strand, and both are not less than the reaction temperature of the amplification reaction system.

12. The nucleic acid amplification method of any one of claims 1 to 11, further comprising adding a nucleic acid dye or a fluorescent probe to the reaction system for monitoring the progress of the amplification reaction.

13. The nucleic acid amplification method of any one of claims 1 to 12, wherein the fluorescent probe is a DNA molecular beacon, a PNA molecular beacon, or a double-stranded probe.

14. The nucleic acid amplification method of any one of claims 1 to 13, wherein the double-stranded probe comprises a long DNA strand and a short DNA strand, the short DNA strand is complementary to a 3 'end sequence or a 5' end sequence of the long DNA strand, and a fluorescent molecule and a quencher molecule are respectively attached to both complementary ends of the long DNA strand and the short DNA strand.

15. The nucleic acid amplification method of any one of claims 1 to 14, wherein the fluorescent probe comprises a sequence complementary to a loop portion of the stem-loop structure DNA molecule.

16. The nucleic acid amplification method according to any one of claims 1 to 15, wherein the target nucleic acid has a recognition site for the nicking endonuclease upstream of the target fragment to be amplified.

17. The nucleic acid amplification method of any one of claims 1 to 16, wherein the target nucleic acid is single-stranded or double-stranded DNA.

18. The nucleic acid amplification method of any one of claims 1 to 17, wherein the target nucleic acid is RNA and the DNA polymerase has reverse transcriptase activity.

19. A method for detecting the presence of a target nucleic acid in a sample, comprising amplifying a specific nucleotide sequence of said target nucleic acid by the method of any one of claims 1 to 18, wherein an amplification product from which said specific nucleotide sequence is obtained is indicative of the presence of said target nucleic acid in said sample.

20. A method of detecting the presence or absence of a bacterium or virus in a sample comprising:

1) extracting nucleic acids from the sample; and

2) amplifying a specific nucleotide sequence of said bacterium or virus by the method of any one of claims 1 to 18,

wherein an amplification product from which said specific nucleotide sequence is obtainable indicates the presence of said bacterium or virus in said sample.

Technical Field

The present disclosure relates to nucleic acid amplification methods, and in particular to isothermal nucleic acid amplification methods utilizing nicking endonucleases. The disclosure also relates to the use of the nucleic acid amplification method for bacterial or viral detection.

Background

The nucleic acid amplification technology has important significance in the fields of biochemical analysis, molecular diagnosis, food safety and the like. In recent years, the technology of nucleic acid amplification has been rapidly developed, and particularly, the Polymerase Chain Reaction (PCR) technology invented by dr. The PCR technique has three basic steps, namely: denaturation, annealing and extension, which require repeated heating and cooling processes for PCR amplification, have severe requirements on instruments and equipment, and the PCR technology requires skilled professionals in laboratories, which limits the wide application of the PCR technology. The isothermal nucleic acid amplification technology developed in recent years overcomes some defects of the PCR technology, such as the fact that repeated temperature rise and fall are not needed, the requirements on instruments and equipment are reduced, and the reaction time is shortened. At present, various Isothermal nucleic acid Amplification techniques have been reported at home and abroad, and are represented by Recombinase Polymerase Amplification (RPA), Helicase-dependent Isothermal DNA Amplification (HDA), Loop-mediated Isothermal Amplification (LAMP), Rolling Circle Amplification (RCA), and Exponential Amplification reaction (EXPAR). However, these isothermal nucleic acid amplification techniques also have problems in that the amplification rate is slow, the amplified fragments are short, the cost is high, and the operation is not easy enough.

Disclosure of Invention

In order to overcome the above problems, in one aspect, the present disclosure provides a nucleic acid amplification method comprising adding the following components to an amplification reaction system:

1) a target nucleic acid comprising a target fragment to be amplified, the target fragment to be amplified comprising, in order from the 5 'end to the 3' end, a 5 'end sequence, a middle sequence, and a 3' end sequence;

2) a nicking endonuclease;

3) a DNA polymerase having strand displacement activity, lacking 5 '→ 3' exonuclease activity; and

4) a core primer pair, the core primer pair comprising:

a) a forward core primer comprising, in order from the 5 'end to the 3' end, a forward core primer first sequence, a forward core primer second sequence, and a forward core primer third sequence, wherein the junction of the forward core primer first sequence and the forward core primer second sequence is designed as a cleavage site for the nicking endonuclease; the nucleotide sequence of the third sequence of the forward core primer is the same as the 5' end sequence of the fragment to be amplified; and

b) a reverse core primer comprising, in order from 5 ' to 3 ', a reverse core primer first sequence and a reverse core primer second sequence, the reverse core primer first sequence having a nucleotide sequence that is the same as or part of the 3 ' sequence of the forward core primer second sequence; the nucleotide sequence of the second sequence of the reverse core primer is reverse complementary to the 3' terminal sequence of the fragment to be amplified.

In some embodiments, the method further comprises adding to the amplification reaction system a pair of displacement primers comprising:

a) a forward displacement primer having a nucleotide sequence identical to a portion of the sequence upstream of the target fragment to be amplified in the target nucleic acid; and

b) a reverse displacement primer whose nucleotide sequence is reverse complementary to a portion of the sequence downstream of the target fragment to be amplified in the target nucleic acid.

In some embodiments, the method is performed at constant temperature.

In some embodiments, the target fragment to be amplified is 20 to 1000 bases in length. Preferably, the target fragment to be amplified is 40 to 400 bases in length.

In some embodiments, the method produces an amplification product comprising a double stranded DNA molecule and a stem-loop structured DNA molecule.

In some embodiments, one strand of the double-stranded DNA molecule comprises, in order from the 5 'end to the 3' end:

the forward core primer second sequence;

the target fragment to be amplified; and

the reverse complement of the second sequence of the forward core primer.

In some embodiments, the stem-loop structured DNA molecule comprises:

the forward core primer second sequence;

The target fragment to be amplified or a complementary sequence thereof; and

a reverse complement of the second sequence of the forward core primer;

wherein the forward core primer second sequence and the reverse complement of the forward core primer second sequence form a stem portion and the target fragment to be amplified or its complement forms a loop portion.

In some embodiments, the stem-loop structure DNA molecule has a Tm value not lower than the reaction temperature of the amplification reaction system.

In some embodiments, the Tm value of the duplex formed by the forward core primer binding to the complementary strand of the target nucleic acid is no less than the Tm value of the duplex formed by the forward displacement primer binding to the complementary strand of the target nucleic acid, and the Tm value of the duplex formed by the reverse core primer binding to the target nucleic acid strand is no less than the Tm value of the duplex formed by the reverse displacement primer binding to the target nucleic acid strand.

In some embodiments, the Tm value of the duplex formed by the forward core primer first sequence and its complementary strand is not less than the Tm value of the duplex formed by the forward core primer second sequence and its complementary strand, and neither is not less than the reaction temperature of the amplification reaction system.

In some embodiments, the method further comprises adding a nucleic acid dye or fluorescent probe to the reaction system for monitoring the progress of the amplification reaction.

In some embodiments, the fluorescent probe is a DNA molecular beacon, a PNA molecular beacon, or a double-stranded probe.

In some embodiments, the double-stranded probe comprises a long DNA strand and a short DNA strand, wherein the short DNA strand is complementary to a 3 'end sequence or a 5' end sequence of the long DNA strand, and a fluorescent molecule and a quencher molecule are respectively attached to the complementary ends of the long DNA strand and the short DNA strand.

In some embodiments, the fluorescent probe comprises a sequence complementary to a loop portion of the stem-loop structure product DNA molecule.

In some embodiments, the target nucleic acid has a recognition site for the nicking endonuclease upstream of the target fragment to be amplified.

In some embodiments, the target nucleic acid is single-stranded or double-stranded DNA.

In some embodiments, the target nucleic acid is RNA and the DNA polymerase has reverse transcriptase activity.

In another aspect, the present disclosure provides a method of detecting the presence or absence of a target nucleic acid in a sample comprising amplifying a specific nucleotide sequence of the target nucleic acid with the methods of the present disclosure, wherein an amplification product from which the specific nucleotide sequence is obtained indicates the presence of the target nucleic acid in the sample.

In another aspect, the present disclosure provides a method of detecting the presence or absence of a bacterium or virus in a sample, comprising:

1) extracting nucleic acids from the sample; and

2) amplifying the specific nucleotide sequence of the bacteria or viruses by the method of the present disclosure,

wherein an amplification product from which said specific nucleotide sequence is obtainable indicates the presence of said bacterium or virus in said sample.

The nucleic acid amplification method provided by the invention can realize exponential amplification of the target nucleic acid under the constant temperature condition by utilizing the specially designed primer pair and combining the DNA polymerase and the nicking endonuclease, and has the advantages of simple and convenient operation, quick reaction and high sensitivity. The amplification product is a double-stranded DNA molecule comprising the segment to be amplified and a single-stranded stem-loop structure DNA molecule, can be used in combination with various detection modes, and is conveniently applied to disease diagnosis or pathogen detection.

Drawings

FIG. 1 is a schematic diagram illustrating the amplification principle of a preferred embodiment of the nucleic acid amplification method of the present invention.

FIG. 2 is a graph showing the amplification process of one example of amplifying a Mycoplasma pneumoniae nucleic acid fragment using the amplification method of the invention.

FIG. 3 is a graph showing the amplification process of another example of amplifying a Mycoplasma pneumoniae nucleic acid fragment by the amplification method of the present invention. This example does not use a displacement primer.

FIG. 4 is a graph showing the amplification process of another example of amplifying a Mycoplasma pneumoniae nucleic acid fragment by the amplification method of the present invention. This example uses a double-stranded DNA probe for monitoring the amplification process.

FIG. 5 is a graph showing the amplification process of one example of amplifying hepatitis B virus nucleic acid by the amplification method of the present invention.

FIG. 6 is a graph showing the amplification process of one example of amplifying influenza A H1N1 virus nucleic acid using the amplification method of the present invention.

FIG. 7 is a schematic diagram of the secondary structure predicted by software for a particular sequence.

Detailed Description

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, molecular biology, genetic engineering, and the like, as used herein, are generally conventional biological techniques well known to those skilled in the art. Unless otherwise indicated, test materials for use in the present invention are commercially available from general Biochemical Agents.

As used herein, the term "target fragment to be amplified" refers to a nucleotide sequence of interest, which is typically a portion of a longer nucleic acid molecule (i.e., a target nucleic acid), that is ready for amplification using the amplification methods provided by the present disclosure. The target nucleic acid can be a double-stranded DNA molecule, a single-stranded DNA molecule, or a single-stranded RNA molecule. For the purpose of facilitating the description of the amplification reaction, one strand of a double-stranded DNA molecule (e.g., the upper strand of the double-stranded molecule in FIG. 1) is hereinafter referred to as the target nucleic acid, and the other strand to which it complementarily binds is referred to as the complementary strand thereof. For single-stranded DNA and RNA molecules, the target nucleic acid can be the single-stranded DNA and RNA molecules themselves, or the complementary strands thereof. Also for the purpose of convenient description, the target fragment to be amplified is also divided into three segments from the 5 'end to the 3' end: 5 'terminal sequence, intermediate sequence and 3' terminal sequence, wherein the 5 'terminal sequence and the 3' terminal sequence or their complementary strand can be combined with the amplification primer. The length of the intermediate sequence may be several to several kilobases in length. Or in some cases, the 5 'and 3' terminal sequences are directly linked, i.e., no intervening sequences are present.

As used herein, the term "upstream sequence" refers to a nucleotide sequence in a nucleic acid strand located in the direction of the 5' end of a particular nucleotide sequence, which is used to indicate the relative positional relationship of the nucleotide sequence in the nucleic acid strand. For example, when referring to an "upstream sequence" of a target fragment to be amplified, it is meant that the upstream sequence is between the 5 'end of the target nucleic acid and the 5' end of the target fragment to be amplified in the target nucleic acid. Accordingly, a nucleotide sequence located in the 3' direction of a particular nucleotide sequence in a nucleic acid strand is referred to as a "downstream sequence".

As used herein, the term "nicking endonuclease" refers to an endonuclease that, unlike commonly used endonucleases, nicks on both strands of a DNA molecule, nicks only on one strand of a double-stranded DNA molecule in the vicinity of the recognition site. These enzymes are commercially available from commercial suppliers.

As used herein, the term "core primer" refers to a nucleotide fragment that is used to complementarily bind to a target fragment to be amplified. The core primers are used in pairs, wherein the core primer capable of binding to the 3 '-terminal sequence of the complementary strand of the target fragment to be amplified is referred to as "forward core primer" having the same nucleotide sequence as the 5' -terminal sequence of the fragment to be amplified; the core primer capable of binding to the 3 '-terminal sequence of the target fragment to be amplified is referred to as "reverse core primer", which has the same nucleotide sequence as the 5' -terminal sequence of the complementary strand of the fragment to be amplified. The forward core primer used in the present disclosure includes, in order from 5 ' end to 3 ' end, a forward core primer first sequence, a forward core primer second sequence and a forward core primer third sequence, wherein the forward core primer third sequence is for binding to the 3 ' end sequence of the complementary strand of the target fragment to be amplified, and the forward core primer first sequence and the forward core primer second sequence are designed such that their junction is a cleavage site of a certain nicking endonuclease. When the forward core primer first sequence and the forward core primer second sequence are in the form of a double-stranded DNA molecule bound to their complementary strands, the nicking enzyme can recognize a nicking enzyme recognition site within the forward core primer first sequence, within the forward core primer second sequence, or a combination thereof, and nick at the junction of the forward core primer first sequence and the forward core primer second sequence. The reverse core primer used in the present disclosure includes, in order from the 5 'end to the 3' end, a reverse core primer first sequence and a reverse core primer second sequence, wherein the reverse core primer second sequence is for binding to the 3 'end sequence of the target fragment to be amplified, and the nucleotide sequence of the reverse core primer first sequence is designed to be identical to or a part of the 3' end sequence of the forward core primer second sequence.

As used herein, the term "replacement primer" refers to a primer that is capable of binding to a portion of the sequence upstream of the target fragment to be amplified or its complementary strand in the target nucleic acid. The replacement primers are generally used in pairs, wherein the replacement primer for binding to a portion of the sequence downstream of the complementary strand of the target fragment to be amplified in the target nucleic acid is referred to as a forward replacement primer having the same nucleotide sequence as a portion of the sequence upstream of the target fragment to be amplified in the target nucleic acid; the replacement primer for binding to a part of the sequence downstream of the target fragment to be amplified in the target nucleic acid is referred to as a reverse replacement primer, which has the same nucleotide sequence as a part of the sequence upstream of the complementary strand of the target fragment to be amplified in the target nucleic acid. In the amplification methods of the present disclosure, the use of the displacement primer facilitates detachment of the extended strand amplified by the core primer from the template strand at the early stage of the amplification reaction. In some embodiments, the replacement primer may not be used, but this may extend the amplification reaction time. In addition to this, it is also conceivable to use only a forward displacement primer or a reverse displacement primer.

As used herein, the term "complementary" refers to paired binding between nucleotides, including binding of nucleotides a to T (or U) and C to G. "complementary strand" refers to a strand that is given by this pairing on the basis of one nucleic acid strand.

The term "specific nucleotide sequence" when referring to a target nucleic acid, bacterial or viral nucleic acid, refers to a nucleotide sequence that can be used to distinguish the target nucleic acid, bacterial or viral nucleic acid from other nucleic acid molecules, particularly sequences contemplated therein for binding to a core primer. In general, the target nucleic acid, or a sequence unique to a bacterial or viral nucleic acid, can be selected as the "specific nucleotide sequence".

The term "stem-loop structure" when referring to a nucleic acid strand refers to a secondary structure formed by the reverse complementary pairing of a 5 'terminal base and a 3' terminal base of a single-stranded DNA itself. The double-stranded portion formed by base pairing is a "stem", and the sequence between the paired bases forms a "loop". In some cases, the stem-loop structure may also have a terminal protrusion.

As used herein, the term "Tm value" refers to the temperature at which the double helix structure of a DNA molecule dissociates by half. With respect to binding of a primer to a template, the Tm value generally refers to the temperature at which 50% of the primers bind to the template pair in the presence of excess template, while the other 50% of the primers are in a dissociated state. For single-stranded DNA molecules of stem-and-loop structure, the Tm value refers to the temperature at which 50% of the single-stranded DNA molecules are in the form of stem-and-loop structure and the other 50% of the single-stranded DNA molecules are in linear form. Generally, the higher the GC content, the larger the Tm value. The Tm value also relates to the ionic strength in a solution, pH, the presence or absence of a denaturing agent, the length of a DNA molecule, and the like. The Tm values of the core and replacement primers and stem-loop structures used in the present disclosure can be estimated by secondary structure simulation and Tm value using NUPACK (http:// www.nupack.org/partition/new), and by using Quikfold (http:// unaf. The preferred form of stem-loop structure referred to in this disclosure is one in which only one steady state exists and the Tm value is above the reaction temperature. For example, for the following sequences (intermediates generated by the amplification process in example 1 below (corresponding to stem-loop structure V in fig. 1)): 5'-CGTAGTGTAGAGAGTCACATACGCATTCATCGAGTGTCTGCTACACCTTTGCGTTACGCCGGTATGACCTCGCCGGGCGCGCCTTATACGACCTCGATTTTTCGAAGTTAAACCCGCAAACGCCCACGTAGCAGACACTCGATG-3' (SEQ ID NO:1), which were subjected to secondary structure simulation and Tm estimation using Quikfold, under Na ⁺Ion concentration 100mM, Mg²⁺Under conditions of an ion concentration of 4mM and a reaction temperature of 65 ℃, only one structural state was obtained by the test (see fig. 7), and its Tm was 72.9 ℃ higher than the reaction temperature of 65 ℃.

Principle of nucleic acid amplification reaction of the present invention

The isothermal amplification method of the present invention will now be described in detail with reference to FIG. 1. For convenience of illustration, single-stranded nucleic acid sequences are represented in the figures by Arabic numerals and lowercase letters, and complementary sequences are represented by prime (') and non-prime corresponding numerals or letters, e.g., sequence 1 ' is the complementary sequence of sequence 1 and sequence a is the complementary sequence of sequence a '. The plus strand (II) stretches of the target nucleic acid (I) are denoted by 1, 2, 3, 4, and 5, respectively, while the prime numbers 1 ', 2 ', 3 ', 4 ', and 5 ' denote the corresponding complementary minus strand (III) stretches, respectively. The target fragments to be amplified in the target nucleic acid are sequences 2, 3 and 4 (or sequences 2 ', 3 ' and 4 ').

Two sets of primers are used in the nucleic acid amplification method of the present invention. One set is a core primer, which includes a forward core primer and a reverse core primer. As shown in FIG. 1, the 3 'end of the forward core primer is sequence 2, which is complementary to the 2' sequence of the negative strand (III) on the double-stranded DNA molecule (I); the 5' end is a sequence b; between sequence b and sequence 2 is sequence a, and the contiguous region of sequence b and sequence a forms a nicking endonuclease recognition sequence in the double-stranded case, such that the nicking endonuclease can make a nick at the junction of sequence b and sequence a. The negative core primer comprises a sequence a and a sequence 4 'from the 5' end to the 3 'end, and the sequence 4' is complementary with the sequence 4 of the positive strand (II) on the double-stranded DNA molecule (I). The other set of primers are displacement primers, which comprise a forward displacement primer and a reverse displacement primer. The forward displacement primer comprises the sequence 1 and the reverse displacement primer comprises the sequence 5'.

The initial step in the amplification reaction is the binding of various primers to complementary sequences on the target nucleic acid. The double-stranded DNA of the local target nucleotide sequence is opened by adjusting the reaction temperature, using helicase or recombinase, or using DNA respiration, thereby allowing the primer to bind to a complementary sequence on the target nucleic acid, followed by polymerase extension by a DNA polymerase having strand displacement activity to produce a double-stranded DNA molecule. Next, the case where the reverse core primer is bound to the target nucleic acid plus strand (II) and extended by polymerization is described. The reverse core primer is combined with the sequence 4 of the target nucleic acid plus strand (II) through the sequence 4', and is polymerized and extended under the action of DNA polymerase. The reverse displacement primer binds to sequence 5 of the target nucleic acid plus strand (II) and is extended by DNA polymerase polymerization. In the case of the polymerase extension reaction of the reverse core primer and the reverse displacement primer, the binding sequence of the reverse displacement primer (SEQ ID NO: 5) is upstream of the binding sequence of the reverse core primer (SEQ ID NO: 4), so that the polymerase extension of the reverse displacement primer displaces the single strand formed by the polymerase extension of the reverse core primer. The displaced single strand (IV) comprises the sequence a-4 '-3' -2 '-1' … (from the 5 'end to the 3' end) and can participate in the reaction steps described later (see the right side and the following part of the cross-headed arrow in FIG. 1). The forward core primer is bound to the sequence 2' of the detached single strand (IV) via sequence 2 and is extended by DNA polymerase polymerization. The forward displacement primer is bonded to the sequence 1 'of the detached single strand (IV), and is extended by DNA polymerase polymerization, whereby the single strand (b-a-2-3-4-a' (from the 5 'end to the 3' end)) formed by the extended forward core primer polymerization is displaced. The 3 '-end sequence a' of the replaced single strand is complementary to the sequence a near the 5 '-end, and a stem-loop structure (V) with a 5' -end overhang (i.e., sequence b) can be formed. The 3' end of the stem-loop structure (V) can be extended and filled up by using the sequence b as a template under the action of DNA polymerase to form a double strand capable of being recognized by the nicking endonuclease. Subsequently, the nicking endonuclease generates a nick between the sequence b and the sequence a of the stem-loop structure (V), and the 3 'end of the sequence b is extended by using the sequence a' of the stem part, the sequences 4, 3 and 2 of the loop part, and the sequence a of the stem part as templates in sequence under the action of DNA polymerase, so as to form a double-stranded DNA molecule (VI). The nicking enzyme recognition sequence formed on the double-stranded DNA molecule (VI) can be recognized by the nicking enzyme. Then, under the action of nicking enzyme and DNA polymerase, nicks are repeatedly generated between the sequence b and the sequence a of the double-stranded DNA molecule (VI), and a new extended strand is formed by extension at the 3' -end of the nicks, continuously replacing the old strand (with respect to the extended strand being synthesized) on the double-stranded DNA molecule. The displaced single-stranded DNA has a sequence a-4 ' -3 ' -2 ' -a ' (from the 5 ' end to the 3 ' end), and the sequence a ' at the end can be complementarily paired in the opposite direction to form a stem-loop structure (VII). The stem-loop structure (VII) can be complementarily paired with the forward core primer, and can be polymerized and extended by taking the sequence of the stem-loop structure (VII) as a template under the action of DNA polymerase, and meanwhile, the 3' end of the stem-loop structure (VII) can also be polymerized and extended by taking the sequence b of the forward core primer as a template under the action of polymerase. The double-stranded DNA molecule (X) thus formed also has a nicking enzyme recognition sequence, and the newly synthesized extended strand at the nick continuously displaces the old strand on the double strand by the action of nicking enzyme and DNA polymerase. The old strand which is displaced has a sequence a-2-3-4-a '(from the 5' end to the 3 'end), which forms a stem-loop structure (XI) by reverse complementation of the terminal sequence a and the sequence a'. The stem-loop structure (XI) can be complementarily paired with a reverse core primer to form a double-stranded DNA molecule (XII) under the action of DNA polymerase. In the amplification reaction system, the stem-loop structure (VII) can be complementarily paired with the stem-loop structure (XI) to form the amplification product double-stranded DNA molecule (XII). Under the amplification reaction conditions, the stem-loop structures (VII) and (XI) are generally in dynamic equilibrium with the amplification product, double-stranded DNA molecule (XII).

For the case where the forward core primer binds to the minus strand (III) and is extended by polymerization, the following is described. The forward core primer is coupled to the sequence 2' of the minus strand (III) via sequence 2, and is extended by DNA polymerase polymerization. The forward displacement primer binds to the sequence 1' of the negative strand (III) and is extended by DNA polymerase polymerization. The polymerization extension of the forward displacement primer can displace the single strand formed by the polymerization extension of the forward core primer. The displaced single strand (VIII) comprises the sequence b-a-2-3-4-5 … (from 5 'end to 3' end) and may participate in the steps described hereinafter (see left side and following part of the cross-headed arrow in FIG. 1). The reverse core primer is combined with the replaced single strand (VIII) sequence 4 through the sequence 4' and is polymerized and extended under the action of DNA polymerase to form an incompletely complementary double-stranded product (IX), wherein the double strand has a nicking enzyme recognition site, and a nick is generated between the sequence b and the sequence a under the action of the nicking enzyme. And (b) performing polymerization extension on the 3' end of the sequence b under the action of DNA polymerase, and stripping off the old strand a-2-3-4-5 … to generate the double-stranded DNA molecule (X) with a completely complementary sequence. The double stranded DNA molecule (X) may then participate in the remaining amplification process described above.

Since the stem-loop structures (XI) and (VII) can be continuously generated from the double-stranded DNA molecule (X) and the double-stranded DNA molecule (VI), respectively, during the reaction process, and the amplification reaction product (XII) is also in dynamic equilibrium with the stem-loop structures (XI) and (VII), more and more template strands actually exist in the reaction system, thereby realizing efficient and rapid amplification of the target nucleic acid.

In some embodiments, a replacement primer may not be used. The replacement primer participates in the reaction process in the initial stage of the nucleic acid amplification method of the present invention. Under some reaction conditions, for example, by adjusting the ionic strength of the reaction system, the reaction temperature, adding a protein capable of stabilizing a single-stranded DNA molecule to the reaction system, etc., the extended strand of the core primer can be relatively easily detached from the template strand, thereby participating in the subsequent amplification step of the amplification reaction of the present invention.

In some embodiments, the sequence a of the negative core primer may be a portion of the sequence a of the positive core primer, i.e., the two fragments are not necessarily of equal length, e.g., the sequence a of the negative core primer may be only the 3' -terminal portion of the sequence a of the positive nucleic acid primer, so long as it is capable of forming a stem-loop structure (V, VII and XI) in the amplification reaction system. This is because the DNA polymerase present in the reaction system can fill up the deficient portion using the sequence a of the forward core primer as a template.

In some preferred embodiments, the Tm value of the stem-loop structure is not less than the reaction temperature, thereby ensuring smooth formation of the stem-loop structure during the reaction. When the sequence a of the negative core primer may be only the 3' -terminal part of the sequence a of the positive core primer, it is considered that the Tm value of the stem-loop structure with the protruding end formed is not less than the reaction temperature either.

In some preferred embodiments, the Tm value of the duplex formed by the forward core primer bound to the complementary strand of the target nucleic acid is no less than the Tm value of the duplex formed by the forward displacement primer bound to the complementary strand of the target nucleic acid, and the Tm value of the duplex formed by the reverse core primer bound to the target nucleic acid is no less than the Tm value of the duplex formed by the reverse displacement primer bound to the target nucleic acid, thereby allowing amplification extension of the core primer prior to binding of the displacement primer to the template sequence.

In some preferred embodiments, the Tm value of the double-stranded DNA molecule formed by the sequences b and b 'is not less than the Tm value of the double-stranded DNA molecule formed by the sequences a and a', and both are higher than the reaction temperature of the amplification system. b and b' form a stable double-chain structure, after nicking is generated between the sequence b and the sequence a by nicking endonuclease, the sequence b is not easy to be dissociated and fall off from the paired chain, so that the subsequent chain extension can be carried out; the Tm value of the double-stranded DNA formed by a and a 'is lower than that formed by b and b' to favor strand displacement, and the Tm value is higher than the reaction temperature, mainly considering the stability of the stem-loop structure.

In some embodiments, a fluorescent dye or probe may be added to the amplification reaction system for monitoring the progress of the reaction. Examples of commonly used fluorescent dyes include SYBR Green and Evagreen nucleic acid dyes. The fluorescent probe used in the amplification method of the present invention may be, for example: a DNA Molecular beacon (Molecular beacon) or PNA (peptide nucleic acid) Molecular beacon, preferably wherein the loop portion comprises a fragment complementary to the loop portion (or a portion thereof) of the stem-loop structure of the nucleic acid amplification product; or a double-stranded DNA probe composed of two long and short complementary strands, wherein the long strand is completely complementary to the loop portion (or a part thereof) of the stem-loop structure of the amplification product, the short strand is complementary to the 3 'end or the 5' end sequence of the long strand, and a fluorescent molecule and a quencher molecule are respectively bound to the two complementary ends of the long strand and the short strand (as in the probe used in the examples). Compared with the molecular beacon, the double-stranded probe has improved sensitivity and specificity. In addition, the probe sequences can be conveniently hybridized with the ring single-chain of the stem-loop structure in the amplification product, and the sensitivity and the specificity of detection are improved.

The present disclosure also contemplates that if the target nucleic acid to be amplified also has a recognition site for the nicking endonuclease (e.g., by specifically introducing the recognition site for the nicking endonuclease), the nicking endonuclease will recognize and cut the target nucleic acid continuously at the beginning of the amplification reaction, and a single DNA strand including the target sequence to be amplified is continuously formed under the action of the DNA polymerase, and the single DNA strand can directly participate in the main process of the nucleic acid amplification of the present invention, so as to achieve the purpose of more efficiently and rapidly amplifying the nucleic acid.

As is apparent from the amplification process described above, the nucleic acid molecule serving as an amplification template may be single-stranded or double-stranded, and RNA may be used as the template strand in the case of a DNA polymerase having reverse transcription activity.

It will be apparent to those skilled in the art that other reagents commonly used in amplification reactions, such as dddNTPs, various metal ions, various additives, and the like, may also be included in the amplification reaction system. In addition, additives such as betaine, formamide, dimethyl sulfoxide, dithiothreitol, proline, polyethylene glycol, bovine serum albumin, etc. can be used to optimize the amplification conditions of the present invention, thereby improving the reaction speed, amplification efficiency, specificity, sensitivity, etc. of the nucleic acid amplification reaction. For example, betaine can improve the efficiency and specificity of amplification, protect enzyme activity; formamide can improve the specificity of the reaction; dimethyl sulfoxide can reduce non-specific amplification.

The nucleic acid amplification method of the present invention can select the reaction temperature, the DNA polymerase and the nicking endonuclease, and other components according to actual requirements. For example, at a reaction temperature of 65 ℃, the core primer can be bound to a denatured bubble formed in a complementary sequence region of the target nucleic acid by using DNA respiration, and then the target nucleic acid can be amplified by using DNA polymerase and nicking endonuclease; at 37 deg.C, the recombinase or helicase and single-stranded binding protein can be used to open double strands, to realize complementary binding and polymerization extension of the initial core primer and target nucleic acid, and then the DNA polymerase and nicking endonuclease are combined to realize rapid amplification of target nucleic acid.

The present invention will be explained in more detail with reference to specific examples, so that the objects, technical solutions and effects of the present invention will be more apparent. The following examples are given by way of illustration only and are not intended to limit the scope of the invention in any way.