阅读说明：本技术 一种粪便样本核酸保存液及其制备方法 (Fecal sample nucleic acid preservation solution and preparation method thereof ) 是由 殷剑峰 龚波 王春香 于 2021-07-09 设计创作，主要内容包括：本发明提供了一种粪便样本核酸保存液及其制备方法,具体地,本发明提供了一种粪便样本核酸保存液,所述保存液含有变性剂、螯合剂、离子强度维持剂、抑菌剂和除味剂。用本发明的保存液处理粪便样本,可有效(a)保持粪便样本中的DNA核酸稳定；和/或(ii)灭活粪便样本中的细菌。(The invention provides a fecal sample nucleic acid preserving fluid and a preparation method thereof, and particularly provides a fecal sample nucleic acid preserving fluid which contains a denaturant, a chelating agent, an ionic strength maintaining agent, a bacteriostatic agent and a deodorant. When the preservation solution is used for treating the excrement sample, DNA nucleic acid in the excrement sample can be effectively kept stable (a); and/or (ii) inactivating bacteria in the fecal sample.)

1. A fecal sample nucleic acid preservation solution, characterized in that the preservation solution contains denaturant, chelating agent, ionic strength maintaining agent, bacteriostatic agent and deodorant; preferably, the pH of the preservation solution is 9.0-11.0.

2. The fecal specimen nucleic acid preservation solution of claim 1, wherein the denaturant includes a guanidinium salt and an ionic surfactant.

3. The fecal sample nucleic acid preservation solution of claim 1, wherein the chelating agent is selected from the group consisting of: ethylenediaminetetraacetic acid (EDTA), citric acid, ethylene glycol diethyl ether diamine tetraacetic acid (EGTA), nitrilotriacetic acid trisodium salt monohydrate (NTA), or combinations thereof.

4. The fecal sample nucleic acid preservation solution according to claim 1, wherein the ionic strength maintaining agent is selected from the group consisting of organic buffer solutions and/or inorganic buffer solutions.

5. The fecal sample nucleic acid preservation solution of claim 1, wherein the bacteriostatic agent is selected from the group consisting of: proclin300, beta-propiolactone (BPL), or a combination thereof, preferably Proclin 300.

6. The fecal specimen nucleic acid preservation solution according to claim 1, wherein the odor eliminating agent comprises activated carbon, preferably powdered or granular activated carbon.

7. Use of the fecal sample nucleic acid preservative solution of claim 1 for (a) keeping DNA nucleic acid in fecal samples stable; and/or (ii) inactivating bacteria in the fecal sample.

8. A fecal specimen nucleic acid treatment kit comprising the fecal specimen nucleic acid preservation solution according to claim 1; and

a label or instructions indicating that the kit is for use in (a) keeping DNA nucleic acid in a stool sample stable; and/or (ii) inactivating bacteria in the fecal sample.

9. One of (a) keeping DNA nucleic acid in a fecal sample stable; and/or (ii) inactivating bacteria in a fecal sample, comprising the steps of:

a fecal specimen is treated in the presence of the fecal specimen nucleic acid preservation solution of claim 1.

10. A method for preparing the stool preservation solution according to claim 1, comprising the steps of:

(1) mixing the components except for the active carbon, adjusting the pH value with sodium hydroxide, and fixing the volume with deionized water; and

(2) filtering for sterilization, and then adding active carbon and mixing uniformly to obtain the preservation solution.

Technical Field

The invention relates to the field of biological detection, in particular to a fecal sample nucleic acid preservation solution and a preparation method thereof.

Background

The intestinal tract is the second brain of the human body, the largest 'gas station' of the human body is also the largest toxin expelling organ and immune organ in the human body, about 99% of nutrients of the human body are absorbed by the intestinal tract, more than 80% of toxins are expelled out of the body by the intestinal tract, and 60-70% of immune cells are concentrated in the intestinal tract to resist the invasion of foreign bacteria and toxins, including macrophages, T cells, NK cells, B cells and the like. In the daily diet, most nutrients are absorbed in the small intestine, and food residues which are difficult to digest and absorb enter the large intestine, finally form feces which move down to the rectum to be discharged. With the improvement of living standard, the problems of the increase of the proportion of meat and food eaten by human, high living pressure, irregular diet and more prominent digestive tract. The social investigation results about the intestinal health conditions of China show that more than 90% of people have the intestinal health problems. In 2009, intestinal cancer jumped the first ten large cancers among people living in China, 288 people died from large intestinal cancer almost every day, and on average 12 people died from intestinal cancer every hour. The intestinal tract is also the largest bacterial bank of human body, and the microbial population in the intestinal tract reaches more than 500 species, and the number is more than 10 trillion. The intestinal microorganisms are important participants of human metabolic reactions and can help the human body to complete various physiological and biochemical reactions, and the disorder of the intestinal microorganisms is closely related to the occurrence and development of various diseases, such as intestinal tumors, Irritable Bowel Syndrome (IBS), obesity, diabetes and the like.

In recent years, with the increasing development of molecular biology and nucleic acid detection technology, a powerful detection and analysis means is provided for researching the relationship between intestinal tract and human health diseases. Stool samples are an important sample source for intestinal disease research and intestinal clinical examination. The excrement contains host exfoliated cells which often contain canceration signals, and the detection of the exfoliated cells in the excrement is usually used for the initial screening and general investigation of digestive tract diseases such as colorectal cancer due to the characteristics of no wound, no pain, high detection specificity and the like, so that the aims of early discovery, early diagnosis and early treatment can be better achieved, and the method is the method for reducing the morbidity and mortality of intestinal cancer (colorectal cancer) with the most effective and cost-saving effect. The main sample for intestinal microorganism research is also a stool sample, which can reflect the symbiotic state of microorganisms in human intestinal tracts. However, when feces are excreted from a human body, the living environment of microorganisms in a sample is greatly changed, the source for obtaining nutrients from intestinal tracts is lost, anaerobic bacteria in the sample are rapidly killed when the anaerobic environment is changed into the aerobic environment, non-anaerobic bacteria can continue to metabolize and grow, the variety and abundance of the microorganisms are changed, and the real state in a human body cannot be well reflected. In addition, the components of the fecal sample are complex and contain a large amount of protease, nuclease and various PCR inhibitors (such as bile salts, bilirubin, humus and pigments), so that cells and nucleic acids in the fecal sample are extremely easy to damage and degrade. Therefore, protective measures are required to be taken on the fecal sample, so that the microbial composition is fixed in the isolated state, and the composition of intestinal microorganisms is truly reflected. The fecal sample is preserved at the traditional temperature of-20 ℃ to-80 ℃, the low-temperature cryopreservation can reduce the activity of various enzymes in the sample, reduce the damage and degradation of cells (including human exfoliative cells and various microbial somatic cells) and nucleic acid in the sample, reduce the metabolism and the propagation of flora at the low temperature, and better maintain the inherent state of the flora within a certain time. But the sample preserved by freezing has short preservation time, low sample reuse qualification rate, rigorous preservation conditions and high cost, and the transportation and preservation of the sample need the support of ultralow temperature equipment and instruments. If the examinee cannot be stored at low temperature immediately after collecting the sample, the total amount, the composition and the relative abundance of the exfoliated cells, the nucleic acids and the microorganisms in the excrement sample can be changed, the subsequent detection result is influenced, and the real condition of the intestinal tract of the examinee cannot be accurately reflected. Therefore, there is a need for a fecal sample nucleic acid preservation solution that can effectively preserve a fecal sample at room temperature for a long period of time. In addition, the excrement sample has a large amount of bacteria and unpleasant odor, so that the acceptance willingness of experimental operators and clinical testers to the excrement sample is poor, and the problem of the excrement sample type in the clinical popularization and application process is also solved.

In addition, some manufacturers at home and abroad currently provide excrement storage liquid which can be used for storing and transporting excrement samples at normal temperature, but most products contain volatile or combustible components such as alcohols (such as methanol, ethanol, ethylene glycol, propanol, chlorobutanol and the like) or dimethyl sulfoxide and the like, so that the stability of the products is poor, and the stability of microbial DNA in the samples cannot be guaranteed. The excrement storage liquid provided by Chinese patents CN111183974A, CN107980763A and CN111197042A mainly effectively protects exfoliated cells in excrement, prevents the exfoliated cells from degrading, and provides favorable conditions for detection of the exfoliated cells in the excrement, but if the form of the exfoliated cells in a sample is to be maintained stable, the storage liquid inevitably weakens the inhibition capacity on the activity of microorganisms, so that the inhibition capacity on the activity of the microorganisms in the sample is slightly insufficient, the total amount of nucleic acid of the sample cannot be fixed in time, and the excrement storage liquid is not suitable for research and detection of intestinal microorganisms; patent CN106255753A provides a composition for stabilizing DNA nucleic acid in biological samples (including feces), patent CN110004212A, CN107988076A and CN107312717A provide feces preservation solution which is beneficial to protect the abundance of microbial flora and the stability of genetic materials in samples, patent CN111004831A and CN109122667A provide feces preservation solution which is beneficial to keep microorganisms and cells stable, but these compositions or fixation/bacteriostat in preservation solution mostly adopt alcohols such as methanol, ethanol, propanol or chlorobutanol or dimethyl sulfoxide (DMSO), and these components are volatile and flammable, therefore, the shelf life and stability of products are easily affected, and products containing flammable components are also subject to some limitations in terms of shipping/transportation, generally require special packaging compulsorily, and increase the complexity and cost of transportation of products. Chinese patent CN108998446A provides a stable liquid for feces with deodorizing effect, which can cover odor by adding green tea extract, honeysuckle extract and microorganism enzyme, but the addition of green tea, honeysuckle extract or microorganism enzyme introduces polyphenol (catechin), caffeine, chlorogenic acid and other components and exogenous animal, plant and microorganism nucleic acid substances, the residue of phenols and plant acids in the extraction process may cause adverse effect on the subsequent nucleic acid molecule detection, and the introduction of exogenous nucleic acid also causes the genome background increase in the detection process, and also causes adverse effect on the detection.

Therefore, there is an urgent need in the art to develop a fecal sample nucleic acid preservation solution that can effectively preserve a fecal sample at normal temperature for a long period of time and is convenient to use.

Disclosure of Invention

The invention aims to provide a feces sample nucleic acid preservation solution capable of effectively preserving a feces sample at normal temperature for a long time.

In a first aspect of the present invention, there is provided a preservation solution for nucleic acid in a stool sample, which contains a denaturing agent, a chelating agent, an ionic strength-maintaining agent, a bacteriostatic agent and a deodorant.

In another preferred example, the pH of the preservation solution is 9.0-11.0.

In another preferred embodiment, the denaturant includes a guanidine salt and an ionic surfactant.

In another preferred embodiment, the guanidinium salt is selected from the group consisting of: guanidine hydrochloride, guanidine isothiocyanate, or a combination thereof.

In another preferred embodiment, the ionic surfactant is selected from the group consisting of: sodium lauryl sulfate, Triton X-100 (polyethylene glycol octylphenyl ether), ammonium lauryl sulfate, lithium lauryl sulfate, sodium decyl sulfate, sodium octyl sulfate, sodium laureth sulfate, sulfated castor oil, diethanolamine lauryl sulfate, triethanolamine lauryl sulfate, potassium lauryl sulfate, triethanolamine lauryl sulfate, monoethanolamine lauryl sulfate, magnesium lauryl sulfate, or combinations thereof.

In another preferred embodiment, the ionic surfactant comprises Triton X-100.

In another preferred embodiment, the chelating agent is selected from the group consisting of: ethylenediaminetetraacetic acid (EDTA), citric acid, ethylene glycol diethylether diaminetetraacetic acid (EGTA), nitrilotriacetic acid trisodium salt monohydrate (NTA), or combinations thereof.

In another preferred embodiment, the chelating agent comprises EDTA.

In another preferred embodiment, the ionic strength maintaining agent comprises an organic buffer solution and/or an inorganic buffer solution.

In another preferred embodiment, the organic buffer solution is selected from Tris, ethanolamine, triethanolamine, glycine, alanine, mannose and trisodium citrate, preferably glycine.

In another preferred embodiment, the inorganic buffer solution is selected from the group consisting of carbonate, bicarbonate, phosphate, hydrogen phosphate and borate, preferably sodium carbonate, bicarbonate or hydrogen phosphate.

In another preferred embodiment, the bacteriostatic agent is selected from the group consisting of: proclin300, beta-propiolactone (BPL), or a combination thereof, preferably Proclin 300.

In another preferred embodiment, the odor eliminating agent comprises activated carbon, preferably powdered or granular activated carbon.

In another preferred embodiment, the content of guanidine salt is 0.1 to 30M, preferably 0.5 to 20M, more preferably 0.8 to 10M, still more preferably 1 to 4M, based on the total amount of the fecal sample nucleic acid preservation solution.

In another preferred embodiment, the ionic surfactant is contained in an amount of 0.5 to 10% by weight, preferably 1 to 4% by weight, based on the total amount of the fecal specimen nucleic acid preservation solution.

In another preferred embodiment, the chelating agent is contained in an amount of 0.01 to 5M, preferably 0.08 to 2M, more preferably 0.1 to 0.5M, based on the total amount of the fecal sample nucleic acid preservation solution.

In another preferred embodiment, the ionic strength maintaining agent is contained in an amount of 5 to 500mM, preferably 10 to 200mM, based on the total amount of the fecal sample nucleic acid preservation solution.

In another preferred embodiment, the content of the bacteriostatic agent is 1-50 ppm, preferably 5-20ppm, based on the total amount of the fecal sample nucleic acid preservation solution.

In another preferred embodiment, the content of the deodorant is 1 to 50g/L, preferably 5 to 30g/L, based on the total amount of the fecal specimen nucleic acid preservation solution.

In a second aspect of the present invention, there is provided the use of the fecal specimen nucleic acid preservation solution according to the first aspect of the present invention for (a) keeping DNA nucleic acid in a fecal specimen stable; and/or (ii) inactivating bacteria in the fecal sample.

In another preferred embodiment, the stool is derived from a human or non-human mammal.

In another preferred embodiment, the DNA comprises microbial DNA or genomic DNA of human exfoliated cells (e.g., leukocytes).

In a third aspect of the present invention, there is provided a nucleic acid treatment kit for a fecal sample, the kit comprising the nucleic acid preservation solution for a fecal sample according to the first aspect of the present invention; and

a label or instructions indicating that the kit is for use in (a) keeping DNA nucleic acid in a stool sample stable; and/or (ii) inactivating bacteria in the fecal sample.

In another preferred embodiment, the components of the nucleic acid preservation solution for fecal samples are respectively located in different containers.

In another preferred embodiment, the components of the nucleic acid preservation solution for a fecal sample are located in the same container.

In a fourth aspect of the invention, there is provided a use of the kit according to the third aspect of the invention for (a) keeping DNA nucleic acid in a fecal sample stable; and/or (ii) inactivating bacteria in the fecal sample.

In a fifth aspect of the present invention, there is provided a method for (a) stabilizing DNA nucleic acid in a stool sample; and/or (ii) a method of inactivating bacteria in a fecal sample comprising the steps of:

the fecal specimen is treated in the presence of the fecal specimen nucleic acid preservation solution according to the first aspect of the present invention.

In another preferred embodiment, the stool is derived from a human or non-human mammal.

In a sixth aspect of the present invention, there is provided a method for producing a feces preservation solution according to the first aspect of the present invention, comprising the steps of:

(1) mixing the components except for the active carbon, adjusting the pH value with sodium hydroxide, and fixing the volume with deionized water;

(2) filtering for sterilization, and then adding active carbon and mixing uniformly to obtain the preservation solution.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features described in detail below (e.g., examples) can be combined with each other to constitute a new or preferred technical solution. Not to be reiterated herein, but to the extent of space.

Drawings

Fig. 1 shows the results of the liquid bacteriostatic performance study.

FIG. 2 shows the results of the qPCR assay for the No. 1 preservative solution and control.

FIG. 3 shows the results of the qPCR assay for the No. 2 preservative solution and control.

Fig. 4 shows the results of the No. 3 preservation solution and the control qPCR assay.

FIG. 5 shows agarose gel electrophoresis to detect extracted DNA nucleic acids.

FIG. 6 shows the results of the test of the sample of volunteer 1.

FIG. 7 shows the results of the test of the sample of volunteer 2.

FIG. 8 shows the results of the test of the sample of volunteer 3.

FIG. 9 shows the results of high throughput sequencing of samples from volunteer 1.

FIG. 10 shows the results of high throughput sequencing of samples from volunteer 2.

Detailed Description

The inventor of the invention has conducted extensive and intensive research for a long time, and through a large number of screening and testing, surprisingly found for the first time that the denaturant, the chelating agent, the ionic strength maintaining agent, the bacteriostatic agent and the deodorant are proportioned at a certain concentration, and the pH of the prepared preservation solution is 9.0-11.0, so that (a) the DNA nucleic acid in the fecal sample can be effectively kept stable; and/or (ii) inactivating bacteria in the fecal sample. On this basis, the present inventors have completed the present invention.

Sample(s)

As used herein, the terms "sample", "specimen" and "specimen" are used interchangeably. In the present invention, the source of the sample is not particularly limited, and may be collected from an organism, and in a preferred embodiment, the "sample" is derived from a stool sample. The method for collecting the sample is not particularly limited, and the collection can be performed by a conventional method.

Feces sample nucleic acid preservation solution

The invention provides a fecal sample nucleic acid preservation solution, which comprises the following components: denaturants, chelating agents, ionic strength maintenance agents, bacteriostats and odor removing agents; wherein the pH value of the preservation solution is 9.0-11.0.

In the present invention, the denaturant and the concentration thereof are not particularly limited, and the denaturant includes a guanidine salt and an ionic surfactant; the guanidine salt is preferably at least one of guanidine hydrochloride and guanidine isothiocyanate; the surfactant is at least one of sodium dodecyl sulfate, Triton X-100 (polyethylene glycol octyl phenyl ether), ammonium dodecyl sulfate, lithium dodecyl sulfate, sodium decyl sulfate, sodium octyl sulfate, sodium polyoxyethylene lauryl sulfate, sulfated castor oil, diethanolamine lauryl sulfate, triethanolamine lauryl sulfate, potassium lauryl sulfate, triethanolamine lauryl sulfate, monoethanolamine lauryl sulfate, and magnesium lauryl sulfate, preferably Triton X-100. One preferred denaturant is guanidinium isothiocyanate and Triton X-100. A preferred content of guanidine salt is 0.1-30M, preferably 0.5-20M, more preferably 0.8-10M, more preferably 1-4M. A preferred ionic surfactant is present in an amount of 0.5 to 10%, preferably 1 to 4%.

In the present invention, the chelating agent is one or more of ethylenediaminetetraacetic acid (EDTA), citric acid, ethylene glycol diethylenediaminetetraacetic acid (EGTA) and nitrilotriacetic acid trisodium salt monohydrate (NTA), preferably EDTA. EDTA is commonly used Mg²⁺、Ca²⁺、Mn²⁺、Fe²⁺The isodivalent metal ion chelating agent can effectively remove divalent metal ions in the sample and inhibit most of the divalent metal ions from depending on Mg²⁺The activity of the acting nuclease reduces the risk of the nuclease on the degradation of nucleic acid, and is beneficial to keeping the stability of the nucleic acid.

A preferred chelating agent is present in an amount of 0.01-5M, preferably 0.08-2M, more preferably 0.1-0.5M.

The ionic strength maintaining agent (zwitterionic buffer) can be an organic buffer solution and/or an inorganic buffer solution, wherein the organic solution can be Tris, ethanolamine, triethanolamine, glycine, alanine, mannose or trisodium citrate, and the like, and the inorganic solution can be carbonate, bicarbonate, phosphate, hydrogen phosphate or borate. The present invention preferably uses at least one of an organic buffer glycine and an inorganic buffer sodium carbonate, sodium bicarbonate or hydrogen phosphate. The glycine is zwitterion with amino and carboxyl, has strong buffering performance, can provide alkaline buffering environment with pH of 8.6-10.6, maintains the stability of DNA nucleic acid, and has certain inhibition effect on the propagation of colibacillus and other bacteria. The sodium carbonate-sodium bicarbonate buffer can provide an alkaline buffering environment at a pH of 9.16-10.83, the sodium carbonate-sodium hydroxide buffer can provide an alkaline buffering environment at a pH of 9.6-11.0, and the disodium hydrogen phosphate-sodium hydroxide buffer can provide a strongly alkaline buffering environment at a pH of 10.9-12.0.

The bacteriostatic agent comprises at least one of Proclin300 or Beta Propiolactone (BPL), preferably Proclin 300. The ProClin biological inactivator has broad-spectrum antibacterial property, small dosage and high action speed, can quickly penetrate cell membranes and inhibit specific enzymes vital to cell respiration, so that cell activity can be immediately inhibited when the ProClin biological inactivator is contacted with microbial organisms, and the aim of inhibiting bacteria can be achieved by 5-20ppm of ProClin 300. In addition, ProClin is safe, has far lower toxicity than similar products, has good compatibility of enzyme and diagnostic factor, and does not influence the related reaction with enzyme or antibody in the subsequent reaction process.

A preferred level of bacteriostatic agent is 1-50 ppm, preferably 5-20 ppm.

The deodorant is activated carbon, preferably powdered or granular activated carbon, is non-toxic and odorless, has developed pores, has a large specific surface area and a proper pore structure, does not contain a solute which has adverse effects on a liquid phase, has the advantages of strong adsorption capacity, good decoloring and deodorizing effects and the like, is widely applied to deep purification, decoloring, dechlorination, deodorizing and degreasing of drinking water and industrial feed water, deep purification treatment of sewage, preparation of ultrapure water in the electronic industry, purification of water for the food industry, removal of organic substances, colored molecules and the like in the liquid phase, and particularly has excellent effects on decoloring, deodorizing, COD (chemical oxygen demand) reduction and the like of the sewage.

A preferred deodorant is present in an amount of 1 to 50g/L, preferably 5 to 30 g/L.

In some embodiments, the stool preservation solution may comprise the following ingredients (in total solution): 1-4M of guanidinium isothiocyanate, 1-4% of Triton X-100, 0.1-0.5M of EDTA, 10-200 mM of glycine, sodium carbonate, sodium bicarbonate or disodium hydrogen phosphate, 5-20ppm of ProClin300, 5-30g/L of activated carbon, and the pH value of a preservation solution is 9-11. The guanidine salt serving as a strong protein denaturant can denature organic substances such as mucin, globulin and the like in a fecal sample and degrading enzymes such as protease, DNases (DNases) and RNase (RNases), and meanwhile, exfoliative cells and microbial somatic cells in a sample are cracked and release nucleic acid, so that microorganisms are not easy to breed; glycine, sodium carbonate, sodium bicarbonate or disodium hydrogen phosphate can maintain the stability of the total ionic strength of the buffer solution, maintain a slightly alkaline buffer environment and provide a high-salt environment, so that the released DNA is fully dissolved in a liquid phase, and the nucleic acid is kept stable; EDTA chelates divalent metal ions in the sample, and acts as a nuclease inhibitor to protect sample nucleic acid from degradation; proclin300 serving as a bacteriostatic agent can inhibit the activity of microorganisms in a sample and prevent the abundance of the microorganisms from changing; the preservation solution is added with the activated carbon, which is beneficial to adsorbing and removing impurities and peculiar smell of the fecal sample, and does not generate adverse effects on sample nucleic acid preservation and subsequent nucleic acid extraction and detection.

In conclusion, the invention provides the excrement storage solution which is odorless and can be transported and stored at the normal temperature for storing the nucleic acid of the excrement sample, the excrement storage solution can effectively inactivate and crack host cells and microbial somatic cells in the excrement sample, release the nucleic acid, effectively keep the stability of the nucleic acid in the normal-temperature storage and transportation process, prevent the degradation of the nucleic acid and prolong the storage time of the sample.

In addition, in a preferred embodiment, the present invention provides a method for preparing the feces preservation solution, which comprises the following specific steps: mixing the components except for the active carbon, adjusting the pH value with sodium hydroxide, fixing the volume with deionized water, filtering and sterilizing with a 0.22 mu m filter membrane, adding a proper amount of active carbon, and uniformly mixing to obtain the preservation solution. The chemical change of the preserving fluid can not be caused by filtering and sterilizing, and the preservation fluid is beneficial to maintaining the accurate and stable physicochemical property.

In a preferred embodiment, the invention provides application of the feces preservation solution in feces preservation, which comprises the specific steps of taking 0.5-1g of feces sample in 5ml of the feces preservation solution and uniformly mixing. The feces preservation solution with the specification of 30ml can preserve 2.5g-5g of feces samples.

The excrement nucleic acid preservation solution capable of preserving and transporting the excrement sample at normal temperature, which is provided by the invention, can rapidly permeate cast-off cells and microbial cells in excrement after being mixed with the excrement sample, so that the cells in the excrement are cracked and inactivated, nucleic acid is released, meanwhile, the activity of degrading enzyme in the sample is inhibited, the state of stably preserving DNA is achieved, and the stability of the excrement sample nucleic acid can be preserved for a long time at normal temperature. The preservation solution provided by the invention does not contain volatile components such as ethanol and the like, has the advantages of long product quality guarantee period, stable performance, simple and convenient use and low transportation cost, and can be widely used for collecting, transporting and preserving the excrement samples under normal temperature conditions of hospitals, scientific research institutions, families and the like. The DNA in the fecal sample can be stored for at least 7 days at room temperature (15-25 ℃) after being stabilized by the fecal storage solution so as to avoid degradation, and the fecal sample stabilized by the fecal storage solution can be matched with a fecal DNA purification kit commonly used in the market to extract the fecal DNA. In addition, the preservation solution removes the peculiar smell of the sample by adopting an activated carbon physical adsorption mode, so that the acceptance of experimental operators to the excrement sample is greatly increased, and the clinical popularization and application of the sample are facilitated.

Fecal sample nucleic acid treatment kit

The present invention also provides a method for (a) stabilizing DNA nucleic acid in a stool sample; and/or (ii) a fecal sample nucleic acid treatment kit for inactivating bacteria in a fecal sample.

In the invention, the kit of the invention contains the nucleic acid preservation solution of the fecal sample, which comprises the following components:

denaturants, chelating agents, ionic strength maintenance agents, bacteriostats and odor eliminating agents.

In a preferred embodiment, the pH of the preservation solution is between 9.0 and 11.0.

In the present invention, the ratio between the respective components in the kit of the present invention, and the content of the respective components may not be particularly limited.

The components of the kit of the present invention may be obtained commercially or prepared by conventional methods.

In the present invention, the components of the preservation solution may be located in different containers or in the same container.

The kit of the invention can effectively (a) keep the DNA nucleic acid in the fecal sample stable; and/or (ii) inactivating bacteria in the fecal sample.

The main advantages of the invention include:

(1) the preservation solution of the invention can effectively (a) keep the stability of DNA nucleic acid in the fecal sample; and/or (ii) inactivating bacteria in the fecal sample.

(2) And (3) transporting and storing at room temperature: the excrement storage solution provided by the invention can effectively release and store nucleic acid of exfoliated cells and microbial cells in an excrement sample at room temperature, effectively prevent nucleic acid degradation in the normal-temperature transportation and storage processes of the sample, store the sample at 15-37 ℃ for at least 30 days, reduce the possibility of nucleic acid degradation caused by improper transportation or storage, solve the problem that the traditional excrement cryopreservation method requires low-temperature storage, reduce the dependence on refrigeration equipment or instruments, and reduce the cost of sample transportation and storage.

(3) Inactivating pathogenic microorganisms: the excrement storage solution provided by the invention is an inactivation type storage solution, can quickly inactivate microorganisms in an excrement sample and is no longer active, is very safe to operators and the environment, and reduces adverse effects on the environment; in addition, the preservation solution rapidly permeates into cells, so that the cells are cracked to release nucleic acid, the variety, abundance and total amount of the nucleic acid of microorganisms in the sample are prevented from changing, and the sample can truly reflect the real state in the host body.

(4) Physical adsorption: the excrement storage solution provided by the invention adopts an activated carbon physical adsorption odor removal mode, so that the peculiar smell of the sample is effectively eliminated, and adverse effects on sample nucleic acid storage and subsequent nucleic acid extraction and detection are avoided. In addition, the inventor unexpectedly finds that the DNA preservation effect can be obviously improved after the activated carbon is added into the preservation solution, and the long-term stability of the DNA in the sample is very facilitated.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

The materials and cell lines used in the present invention are commercially available products unless otherwise specified.

Example 1 feces preservation solution formulation

The formula of the excrement sample preservation solution mainly comprises the following components: 1-4M guanidinium isothiocyanate, 1-4% Triton X-100, 0.1-0.5M EDTA, 10-200 mM glycine, sodium carbonate, sodium bicarbonate or disodium hydrogen phosphate, 5-20ppm ProClin300 and 0.1-3% activated carbon, wherein the pH value of the preservation solution is 9-11, preferably 9.5-10.5.

TABLE 1 formula of feces preservation solution

Example 2 study of bacteriostatic Properties of feces preservation solution

Experimental materials: escherichia coli strain with ampicillin resistance plasmid

Experimental group preservation solution: feces preservation solution No. 1 to 3 in example 1

Control group: sterile water

The experimental method comprises the following steps: and (2) carrying out overnight culture on escherichia coli, adding 10 mu l of overnight-cultured escherichia coli liquid into 30ml of sterile water and No. 1-3 preservation liquid respectively, carrying out vortex mixing, dividing each sample into 3 parts in equal parts, standing at room temperature for 0 day and 30 days respectively, after the samples are mixed uniformly, coating 100 mu l of preservation liquid on an LB solid culture medium (added with ampicillin), placing in an incubator at 37 ℃ for overnight culture for 12-16 hours, and observing and recording the growth condition of the thalli.

The experimental results are as follows: as a result, as shown in FIG. 1, the Escherichia coli suspension was stored in3 kinds of storage solutions for 0 day and 30 days and then applied to the medium without bacterial growth, while the suspension stored in sterile water showed a large amount of bacterial growth after 0 day of culture. This indicates that the preservation solutions 1, 2, 3 have bacteriostatic effects and prevent bacterial growth.

Example 3 nucleic acid storage Capacity study of feces storage solution

Experimental materials: feces stocks No. 1, 2 and 3 in example 1, human leukocyte genomic DNA (stored in a refrigerator at-80 ℃), and fresh feces of volunteers.

The experimental method comprises the following steps: adding an equal amount (about 1 g) of fresh feces into 5ml of feces storage solutions 1, 2 and 3 prepared in example 1, respectively, adding an equal amount of human leukocyte genomic DNA, and mixing by inversion; after each part of preservation solution is equally divided into two parts and respectively preserved for 0 day and 30 days at room temperature, 300 mu L of preservation solution sample is taken for each part, and a fecal genomic DNA extraction kit (Kangji, product number CW2092) is adopted for DNA extraction, the specific operation steps are detailed in a product instruction, the sample is eluted in 70 mu L of eluent, and 5 mu L of each sample is taken as a template for carrying out fluorescence quantitative qPCR detection on the human internal reference gene.

And (3) carrying out fluorescence quantitative PCR detection on the extracted DNA nucleic acid sample by using a Kwangsi century qPCR detection reagent (the product number is CW0957), wherein the used primers are human reference gene GAPDH primers, and the sequence information of the primers is GAPDH-F: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO. 1), GAPDH-R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 2). The DNA nucleic acid extracted by adding feces and human leukocyte genome DNA samples in sterile water is used as a negative control, and the specific operation refers to the instruction. The reaction system used 25. mu.l of PCR reaction system (including 12.5. mu.l of UltraSYBR mix, 0.5. mu.l of GAPDH-F (10. mu.M), 0.5. mu.l of GAPDH-R (10. mu.M), 6.5. mu.l of nuclease-free water) + 5. mu.l of extracted DNA sample template. Detecting human internal reference gene actin nucleic acid on a Berle CFX96 type fluorescent quantitative PCR instrument under the following reaction conditions: 95 ℃ 5min → 95 ℃ 10s,60 ℃ 30s (40 cycles), SYBR channel. All assays were performed in3 replicates and the average cycle threshold (Ct) was calculated.

The experimental results are as follows: the results are shown in table 2, compared with the Ct of the control group at day 0, the Ct differences detected after the samples preserved by the preservation solutions No. 1, No. 2 and No. 3 are preserved at room temperature for 30 days are basically within 1, most differences are not significant (p is greater than 0.05), which indicates that the three preservation solutions can effectively keep the stability of the DNA nucleic acid at room temperature, and can ensure that the nucleic acid can be effectively detected after the samples are preserved for 30 days.

TABLE 2 qPCR examination of the preservation Effect of feces preservation solution on DNA nucleic acids

Example 4 study of nucleic acid preservation of stool samples with stool preservation solution

Experimental group preservation solution: the feces preservation solution No. 1 in the above example 1 was used;

comparative group preservation solution: referring to patent CN104073564A, a feces sample preservation solution (containing EDTA-disodium 0.24% (w/v), Tris-HCl 10mM, NaCl 0.75% (w/v), guanidine thiocyanate 0.05M, and the balance deionized water, adjusted to pH 7.5, and sterilized) was prepared as a comparative example.

Collecting a fecal sample and extracting DNA: collecting fecal samples of 3 volunteers, respectively performing 4 different treatments, wherein each treatment is set to be 3 repeated, and the specific treatment comprises the following steps:

(1) direct extraction of the groups: 3 fecal samples, 0.5g each, were weighed and immediately subjected to DNA extraction, and the extracted nucleic acids were stored at-80 ℃ for future use.

(2) Freezing and storing at-80 ℃ for 30 days: 3 fecal samples, each 0.5g, were weighed and stored in a sealed environment at-80 ℃ for 30 days, and then DNA extraction was performed for future use.

(3) The experimental group preservation solution is preserved for 30 days: weighing 3 parts of excrement sample, each 1g of the excrement sample, respectively putting the excrement sample into 5ml of No. 1 excrement preservation solution, uniformly mixing, sealing and preserving at room temperature (18-25 ℃) for 30 days, and then taking 2.5ml of excrement preservation solution sample (containing about 0.5g of excrement sample) for DNA extraction for later use.

(4) The comparative group preservative fluid was preserved for 30 days: weighing 3 parts of excrement sample, each 1g of the excrement sample, respectively putting the excrement sample into 5ml of comparative group preservation solution, uniformly mixing, sealing and preserving at room temperature (18-25 ℃) for 30 days, and then taking 2.5ml of excrement preservation solution sample (containing about 0.5g of excrement sample) for DNA extraction for later use.

Extracting DNA by using a fecal genome DNA extraction kit (Kangji century, product number CW2092), wherein the detailed operation steps are shown in the product specification, and finally, eluting DNA nucleic acid by using 70 mu L of eluent.

Quality detection and result analysis of extracted DNA nucleic acid:

and (3) detecting the concentration and purity of nucleic acid: the concentration of the extracted DNA nucleic acid was measured by using a Qubit, and the DNA purity was measured by using a Nanodrop, and the results are shown in Table 3, in comparison with the direct extraction group (0 day), the concentration and purity of the frozen group (-80 ℃, 30 days) and the experimental group (room temperature, 30 days) after 30 days of storage did not change significantly, and the concentration of the frozen group was higher than that of the comparative group (room temperature, 30 days), indicating that the storage solution can effectively maintain the stability of the DNA nucleic acid when placed at room temperature for 30 days.

TABLE 3 quality test of DNA nucleic acid extracted from fecal samples of different treatment groups

And respectively mixing the DNAs extracted from the three repeated samples of each treatment group, and sequentially carrying out electrophoresis detection, fluorescent quantitative PCR detection and second-generation sequencing detection on the DNA nucleic acids extracted from each group.

And (3) agarose gel electrophoresis detection: 5 μ L of each sample was subjected to 1% agarose gel electrophoresis, and the results are shown in FIG. 5 (lane 1: volunteer 1-direct extraction group, lane 2: volunteer 1-frozen group, lane 3: volunteer 1-experimental group, lane 4: volunteer 1-comparative group, lane 5: volunteer 2-direct extraction group, lane 6: volunteer 2-frozen group, lane 7: volunteer 2-experimental group, lane 8: volunteer 2-comparative group, lane 9: volunteer 3-direct extraction group, lane 10: volunteer 3-frozen group, lane 11: volunteer 3-experimental group, lane 12: volunteer 3-comparative group), each electrophoresis brightness was consistent with the nucleic acid concentration of the lanes measured by qubit, and the feces liquid had a protective effect on the feces sample nucleic acid, preventing degradation of nucleic acids.

Example 5 fluorescent quantitative PCR detection of host Gene nucleic acid stability

The human reference gene is detected by fluorescent quantitative PCR, and the preservation effect of the excrement preservation solution on host DNA nucleic acid is verified. The extracted nucleic acid sample is subjected to fluorescent quantitative PCR detection by using a Kwang century qPCR detection reagent (CW0957), and specific operation refers to the instruction. The primer is a human reference gene beta-actin primer, and the sequence information of the primer is beta-actin-F: GCGCCGTTCCGAAAGTT (SEQ ID NO. 3), beta-actin-R: CGGCGGATCGGCAAA (SEQ ID NO. 4). Sterile deionized water was used as a negative control, and the detailed procedures were referred to the manual. The reaction system used 25. mu.l of PCR reaction system (including 12.5. mu.l of UltraSYBR mix, 0.5. mu.l of beta-actin-F (10. mu.M), 0.5. mu.l of beta-actin-R (10. mu.M), 6.5. mu.l of nuclease-free water) + 5. mu.l of extracted DNA sample template. The nucleic acid detection of human reference gene beta-actin is carried out on ABI7500 (Thermofisiher company, USA) type fluorescent quantitative PCR instrument, and the reaction conditions are as follows: 95 ℃ 5min → 95 ℃ 10s,60 ℃ 30s (40 cycles), SYBR channel. All measurements were repeated 3 times and the average cycle threshold (Ct) was calculated.

As shown in Table 4, the difference in Ct values detected after 30 days of storage in the frozen group (80 ℃, 30 days) and the experimental group (30 days at room temperature) was substantially within 1 compared to the direct extraction group (0 days), and the Ct values were smaller than those in the control group (30 days at room temperature), indicating that the storage solution was effective in maintaining the stability of the host nucleic acid at room temperature.

TABLE 4 PCR detection of Ct values for reference genes

FIG. 6 shows the results of the test of the sample of volunteer 1; FIG. 7 shows the results of the test of the sample of volunteer 2; FIG. 8 shows the results of the test of the sample of volunteer 3.

Example 6 high throughput sequencing for detecting changes in microbial population structure and abundance

NGS library construction is carried out on the extracted partial sample DNA by adopting a Kangji century NGS library construction kit (product number CW3025), and machine sequencing is carried out. And after the sequencing data are obtained, performing bioinformatics analysis, counting information such as species population composition, diversity and relative abundance in the sample, and comparing the information of the species population composition, the diversity and the relative abundance in each treatment group.

The results are shown in fig. 9 and fig. 10, species population composition, diversity and relative abundance in the direct extraction group and the experimental group (30 days at room temperature) are not obviously changed, which indicates that the preservation solution can fix the microorganisms in the isolated state, and truly reflects the composition of the intestinal microorganisms.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it will be appreciated that various changes or modifications may be made by those skilled in the art after reading the above teachings of the invention, and such equivalents will fall within the scope of the invention as defined in the appended claims.

Sequence listing

<110> Jiangsukang was a century Biotechnology GmbH

<120> fecal sample nucleic acid preservation solution and preparation method thereof

<130> 035004

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

ggagcgagat ccctccaaaa t 21

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

ggctgttgtc atacttctca tgg 23

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gcgccgttcc gaaagtt 17

<210> 4

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

cggcggatcg gcaaa 15