Kit simultaneously used for aedes classification monitoring and dengue virus detection
阅读说明：本技术 一种同时用于伊蚊分类监测和登革病毒检测的试剂盒 (Kit simultaneously used for aedes classification monitoring and dengue virus detection ) 是由 黄夏宁 于 2021-09-03 设计创作，主要内容包括：本发明提供了一种同时用于伊蚊分类监测和登革病毒检测的试剂盒,所述试剂盒包括如下试剂：RT-qPCR预混液,RT-qPCR酶,阳性质控品,阴性质控品。其中,RT-qPCR预混液由一步反应RT-qPCR缓冲液,以及登革病毒非编码区高度保守序列正向特异性引物、登革病毒非编码区高度保守序列反向特异性引物、登革病毒探针；埃及伊蚊核糖体RNA正向特异性引物、埃及伊蚊核糖体RNA反向特异性引物、埃及伊蚊核糖体RNA探针；白纹伊蚊核糖体RNA正向特异性引物、白纹伊蚊核糖体RNA反向特异性引物、白纹伊蚊核糖体RNA探针组成。该试剂盒具有灵敏、精准、高效的优点。(The invention provides a kit for simultaneously carrying out classification monitoring on aedes and dengue virus detection, which comprises the following reagents: RT-qPCR premixed liquid, RT-qPCR enzyme, positive quality control product and negative quality control product. The RT-qPCR premix solution comprises a one-step reaction RT-qPCR buffer solution, a dengue virus non-coding region highly conserved sequence forward specific primer, a dengue virus non-coding region highly conserved sequence reverse specific primer and a dengue virus probe; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; the primer comprises an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe. The kit has the advantages of sensitivity, accuracy and high efficiency.)
1. A kit for simultaneously carrying out aedes classification monitoring and dengue virus detection is characterized by comprising the following reagents: RT-qPCR premixed liquid, RT-qPCR enzyme, positive quality control product and negative quality control product.
The RT-qPCR premix solution comprises a one-step reaction RT-qPCR buffer solution, a dengue virus non-coding region highly conserved sequence forward specific primer, a dengue virus non-coding region highly conserved sequence reverse specific primer and a dengue virus probe; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; the primer comprises an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe.
2. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claim 1, wherein the kit comprises:
the Sequence of the dengue virus forward specific primer is Sequence ID No.1 and is CAGGTGGAAGGGCGTACAAC;
the Sequence of the dengue virus reverse specific primer is Sequence ID No.2 and is CTCCCGTGACTGTAGCCAGA;
the Sequence of the dengue virus probe is Sequence ID No.3, and is FAM-ACTGCCGGAGACCCTGGAGACATTGCT-BHQ 1.
3. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claim 1, wherein the kit comprises:
the Sequence of the Aedes aegypti forward specific primer is Sequence ID No.4 and is TCCGCCAAAAGCAGAACCTG;
the Sequence of the Aedes aegypti reverse specific primer is Sequence ID No.5 and is TCGGCCGGGATGTAGATGTT;
the Sequence of the Aedes aegypti probe is Sequence ID No.6 and is VIC-TCCGTGCGGCCAAGTATGCCAAGAAGT-BHQ 1.
4. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claim 1, wherein the kit comprises:
the Sequence of the forward specific primer of the Aedes albopictus is Sequence ID No.7 and is TCCAGAATGCGTTACGTGGC;
the Sequence of the Aedes albopictus reverse specific primer is Sequence ID No.8 and is CCTTCAGCTCGTTGACCACC;
the Sequence of the Aedes albopictus probe is Sequence ID No.9, and is Cy5-ACGCCAGCCCATCGAATGCCGACAT-BHQ 2.
5. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claim 1, wherein the RT-qPCR enzyme premix comprises reverse transcriptase and hot start Taq DNA polymerase.
6. The kit for simultaneously carrying out Classification monitoring and dengue virus detection on Aedes aegypti according to claim 1, wherein the positive quality control product is a synthetic plasmid mixture containing target gene fragments of dengue virus, Aedes aegypti and Aedes albopictus. The negative quality control product is normal saline.
7. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claims 1-6, wherein:
the initial buffer solution concentration of the one-step reaction RT-qPCR is 2 times concentration;
the concentration of the initial premix of the RT-qPCR enzyme is 25 times of the concentration;
the initial concentration of the dengue virus forward specific primer is 10 mu m/L, the initial concentration of the dengue virus reverse specific primer is 10 mu m/L, and the initial concentration of the dengue virus probe is 10 mu m/L;
the initial concentration of the Aedes aegypti forward specific primer is 10 mu m/L, the initial concentration of the Aedes aegypti reverse specific primer is 10 mu m/L, and the initial concentration of the Aedes aegypti probe is 10 mu m/L;
the initial concentration of the forward specific primer of the Aedes albopictus is 10 mu m/L, the initial concentration of the reverse specific primer of the Aedes albopictus is 10 mu m/L, and the initial concentration of the probe of the Aedes albopictus is 10 mu m/L.
8. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claims 1-7, wherein:
the application concentration of the one-step reaction RT-qPCR buffer solution is 1-fold concentration;
the application concentration of the RT-qPCR enzyme premix is 1 time concentration;
the application concentration of the dengue virus forward specific primer is 0.2 mu m/L, the application concentration of the dengue virus reverse specific primer is 0.2 mu m/L, and the application concentration of the dengue virus probe is 0.1 mu m/L;
the application concentration of the forward specific primer of the Aedes aegypti is 0.2 mu m/L, the application concentration of the reverse specific primer of the Aedes aegypti is 0.2 mu m/L, and the application concentration of the probe of the Aedes aegypti is 0.1 mu m/L;
the application concentration of the forward specific primer of the Aedes albopictus is 0.2 mu m/L, the application concentration of the reverse specific primer of the Aedes albopictus is 0.2 mu m/L, and the application concentration of the probe of the Aedes albopictus is 0.1 mu m/L.
9. The kit for simultaneously performing aedes classification monitoring and dengue virus detection according to claim 7, wherein the kit comprises:
the preparation adding amount of a reaction system of the initial buffer solution for the one-step RT-qPCR is 25 mu l;
the preparation adding amount of a reaction system of the initial premixed solution of the RT-qPCR enzyme is 2 mul;
the reaction system preparation adding amount of the dengue virus forward specific primer is 1 mu l, the reaction system preparation adding amount of the dengue virus reverse specific primer is 1 mu l, and the reaction system preparation adding amount of the dengue virus probe is 0.5 mu l;
the reaction system preparation adding amount of the Aedes aegypti forward specific primer is 1 mul, the reaction system preparation adding amount of the Aedes aegypti reverse specific primer is 1 mul, and the reaction system preparation adding amount of the Aedes aegypti probe is 0.5 mul;
the reaction system preparation adding amount of the Aedes albopictus forward specific primer is 1 mu l, the reaction system preparation adding amount of the Aedes albopictus reverse specific primer is 1 mu l, and the reaction system preparation adding amount of the Aedes albopictus probe is 0.5 mu l.
Technical Field
The invention relates to the field of biomedicine, in particular to a kit simultaneously used for aedes classification monitoring and dengue virus detection.
Technical Field
Dengue viruses (dengue viruses) are single-stranded positive-strand RNA viruses belonging to the flaviviridae family of flaviviridae genera, a group of viruses that are highly conserved at both the viral structure and genomic level. Dengue virus is transmitted by mosquito vectors, the main vectors being aedes aegypti and aedes albopictus, causing dengue fever and dengue shock syndrome with high morbidity and mortality. Morphologically, dengue virus is an enveloped spherical virus with a diameter of about 50nm, and since dengue virus E proteins form dimers in an end-to-end fashion regularly arranged on the virus surface, they assume a 20-hedral symmetric conformation. The genome RNA of the dengue virus contains about 11000 nucleotides, the genome has only one open reading frame, and both the 5 'end and the 3' end have a non-coding region. The 5' end of the virus is of a type I cap structure, and one quarter of the virus encodes 3 structural proteins (C, PrM and E); the 3' end of the virus lacks a poly (A) tail, and three quarters encode 7 nonstructural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS 5). These proteins are formed by the translational synthesis of polymeric proteins followed by cleavage by host proteases. At present, the dengue virus detection method mainly comprises a virus isolation culture method, an immunological method, a common RT-PCR and the like. The experiment of the virus isolation culture method is high in requirement and long in cycle, and the virus cannot be rapidly detected; although the immunological method has high sensitivity, the problems of high false positive, cross reaction and the like exist, and the immunological method is not suitable for virus species identification; the common RT-PCR method has the problems of easy pollution of amplification reaction products, insufficient sensitivity and the like.
Dengue fever is one of serious mosquito-borne infectious diseases in the world and China, the prevention and control situation and the challenge are increasingly serious, and the serious threat is caused to the health of people in China and the national biological safety. Studies have shown that aedes aegypti and aedes albopictus carrying dengue virus can transmit dengue virus to the next generation by vertical infection, which is one of the important mechanisms by which dengue virus persists in the environment. In the dengue fever epidemic, carry out the monitoring of aedes and dengue fever virus simultaneously and detect, can in time assess and guide kill mosquito work to the aedes virus condition of carrying to reduce the risk that the epidemic spread.
Mosquitoes are one of the serious pathogenic organisms. Mosquitoes not only can bite people to influence the work and rest of people, but also can cause allergic reaction to cause extreme itching and red swelling after the skin of the person bitten by the mosquitoes becomes wrapped and itchy; and various infectious diseases with high pathogenicity and high fatality rate, such as dengue fever, epidemic encephalitis B, malaria and the like are related to mosquito bites and belong to mosquito-borne infectious diseases. The aedes is a mosquito of aedes genus of culex subfamily of the family mosquitidae, is the biggest genus of the family mosquitidae, and is especially a fierce sting blood sucking mosquito, the distribution range is wide, and the distribution is available in various provinces (regions) of China. The work of aedes monitoring and population classification is the basis for preventing and controlling mosquito-borne infectious diseases such as dengue fever. At present, mosquito classification and identification work is mainly based on the external forms of mosquito eggs, pupae, larvae and adults. However, in the actual sampling and monitoring work, the traditional morphological classification method is adopted, so that the correct identification of the mosquito eggs, pupae and larvae needs to be fed to eclosion to adult mosquitoes, and the time is long; various populations with similar forms exist in mosquitoes, and the need of distinguishing mosquito complexes, closely related species and the like cannot be met by applying a morphological classification method; adult mosquitoes are affected by a collecting method, a collecting tool, sanitation and disinfection and the like, and are often subjected to falling and damage of important physical signs such as abdominal scales or wings, and are difficult to classify by using a morphological method.
Multiplex PCR reactions refer to the specific amplification and detection of multiple gene sequences in the same reaction. The method is characterized in that a fluorescence detection technology is applied, probes with different fluorescence labels are added into a multiplex PCR reaction system which is optimally designed, a pair of primers corresponds to a specific fluorescence probe, the probes for detecting different targets carry fluorescent groups with different spectral ranges, the nucleic acid amplification, the spectral analysis and the real-time detection technology are skillfully combined, and the progress of the PCR reaction is monitored by utilizing the accumulation of fluorescence signals. The multiplex fluorescence PCR technology can detect various target fragments simultaneously, greatly improves the working efficiency, has the characteristics of sensitivity, accuracy, rapidness and the like, has irreplaceable effects on mosquito medium monitoring and pathogenic microorganism rapid detection, and has wide application prospect.
The main transmission vectors of dengue virus are aedes aegypti and aedes albopictus. Dengue virus can be separated from wild aedes larvae, which shows that the phenomenon that aedes transmit the dengue virus through mosquito eggs exists naturally; experimental studies prove that aedes parents can transmit dengue virus to offspring through mosquito eggs, and the virus virulence has a gradually increasing trend in the transmission process. The two species of aedes aegypti and aedes albopictus can coexist in the same ecological niche and have common characteristics. Due to the influence of various factors such as ecology, drug resistance, flying distance of mosquitoes, population density and the like, infectious diseases caused by the mosquitoes are difficult to discover in the early stage of epidemic. Therefore, a rapid, accurate and high-flux multiplex fluorescence RT-PCR method capable of classifying and identifying eggs, pupae, larvae and adults of Aedes aegypti and Aedes albopictus at different development stages and screening mosquito-borne dengue viruses is needed to be established so as to improve the efficiency and accuracy of mosquito-borne population classification and virus monitoring.
Disclosure of Invention
The invention aims to provide a kit for simultaneously carrying out aedes classification monitoring and dengue virus detection, and aims to solve the problems that in the prior art, the time for classification and identification of mosquito eggs, pupae and larvae is long, important physical signs such as mosquito complexes, kindred species, adult mosquito abdominal scales or wings are fallen off and damaged, classification and identification cannot be carried out, and dengue virus cannot be detected while mosquito-borne classification and identification are carried out.
In order to achieve the purpose, the invention adopts the following technical scheme:
a kit for simultaneously performing aedes classification monitoring and dengue virus detection, the kit comprising the following reagents: RT-qPCR premixed liquid, RT-qPCR enzyme, positive quality control product and negative quality control product.
The RT-qPCR premix solution comprises a one-step reaction RT-qPCR buffer solution, a dengue virus non-coding region highly conserved sequence forward specific primer, a dengue virus non-coding region highly conserved sequence reverse specific primer and a dengue virus probe; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe.
Preferably, the Sequence of the dengue virus forward specific primer is Sequence ID No.1 and CAGGTGGAAGGGCGTACAAC; preferably, the Sequence of the dengue virus reverse specific primer is Sequence ID No.2, CTCCCGTGACTGTAGCCAGA; the Sequence of the dengue virus probe is Sequence ID No.3, and is FAM-ACTGCCGGAGACCCTGGAGACATTGCT-BHQ 1.
Further, the Sequence of the Aedes aegypti forward specific primer is Sequence ID No.4, which is TCCGCCAAAAGCAGAACCTG; the Sequence of the Aedes aegypti reverse specific primer is Sequence ID No.5 and is TCGGCCGGGATGTAGATGTT; the Sequence of the Aedes aegypti probe is Sequence ID No.6 and is VIC-TCCGTGCGGCCAAGTATGCCAAGAAGT-BHQ 1.
Preferably, the Sequence of the Aedes albopictus forward specific primer is Sequence ID No.7 and is TCCAGAATGCGTTACGTGGC; the Sequence of the Aedes albopictus reverse specific primer is Sequence ID No.8 and is CCTTCAGCTCGTTGACCACC; the Sequence of the Aedes albopictus probe is Sequence ID No.9, and is Cy5-ACGCCAGCCCATCGAATGCCGACAT-BHQ 2.
Preferably, the RT-qPCR enzyme premix comprises reverse transcriptase and hot start Taq DNA polymerase.
Preferably, the positive quality control product is a synthetic plasmid mixture containing target gene fragments of dengue virus, aedes aegypti and aedes albopictus. The negative quality control product is normal saline.
Preferably, the initial buffer concentration of the one-step reaction RT-qPCR is 2-fold concentration;
the concentration of the initial premix of the RT-qPCR enzyme is 25 times of the concentration;
the initial concentration of the dengue virus forward specific primer is 10 mu m/L, the initial concentration of the dengue virus reverse specific primer is 10 mu m/L, and the initial concentration of the dengue virus probe is 10 mu m/L;
the initial concentration of the Aedes aegypti forward specific primer is 10 mu m/L, the initial concentration of the Aedes aegypti reverse specific primer is 10 mu m/L, and the initial concentration of the Aedes aegypti probe is 10 mu m/L;
the initial concentration of the forward specific primer of the Aedes albopictus is 10 mu m/L, the initial concentration of the reverse specific primer of the Aedes albopictus is 10 mu m/L, and the initial concentration of the probe of the Aedes albopictus is 10 mu m/L.
Preferably, the application concentration of the one-step reaction RT-qPCR buffer solution is 1-fold concentration;
the application concentration of the RT-qPCR enzyme premix is 1 time concentration;
the application concentration of the dengue virus forward specific primer is 0.2 mu m/L, the application concentration of the dengue virus reverse specific primer is 0.2 mu m/L, and the application concentration of the dengue virus probe is 0.1 mu m/L;
the application concentration of the forward specific primer of the Aedes aegypti is 0.2 mu m/L, the application concentration of the reverse specific primer of the Aedes aegypti is 0.2 mu m/L, and the application concentration of the probe of the Aedes aegypti is 0.1 mu m/L;
the application concentration of the forward specific primer of the Aedes albopictus is 0.2 mu m/L, the application concentration of the reverse specific primer of the Aedes albopictus is 0.2 mu m/L, and the application concentration of the probe of the Aedes albopictus is 0.1 mu m/L.
Preferentially, the preparation adding amount of a reaction system of the initial buffer solution of the one-step reaction RT-qPCR is 25 mu l;
the preparation adding amount of a reaction system of the initial premixed solution of the RT-qPCR enzyme is 2 mul;
the reaction system preparation adding amount of the dengue virus forward specific primer is 1 mu l, the reaction system preparation adding amount of the dengue virus reverse specific primer is 1 mu l, and the reaction system preparation adding amount of the dengue virus probe is 0.5 mu l;
the reaction system preparation adding amount of the Aedes aegypti forward specific primer is 1 mul, the reaction system preparation adding amount of the Aedes aegypti reverse specific primer is 1 mul, and the reaction system preparation adding amount of the Aedes aegypti probe is 0.5 mul;
the reaction system preparation adding amount of the Aedes albopictus forward specific primer is 1 mu l, the reaction system preparation adding amount of the Aedes albopictus reverse specific primer is 1 mu l, and the reaction system preparation adding amount of the Aedes albopictus probe is 0.5 mu l.
The invention has the technical effects that:
the kit of the invention is added with 2 genes of Aedes albopictus and dengue virus, and simultaneously comprises forward and reverse specific primers and probes of the genes of Aedes albopictus, Aedes aegypti and dengue virus. The kit is a novel triple fluorescence RT-PCR nucleic acid detection kit capable of simultaneously carrying out aedes classification identification and dengue virus detection in the same reaction tube, and the RT-qPCR premixed solution, the RT-qPCR enzyme, the positive quality control product and the negative quality control product are mixed for carrying out multiple real-time fluorescence PCR detection. The kit provided by the invention is used for classifying and identifying aedes and detecting dengue viruses, so that the accuracy of monitoring, classifying and identifying aedes and the efficiency of quickly detecting dengue viruses are improved, the time is saved, and the identification efficiency of mosquito-borne classification monitoring and the speed of detecting dengue viruses are obviously improved.
Drawings
FIG. 1 is a graph of amplification curves of positive quality control products according to an embodiment of the present invention.
FIG. 2 is a graph of amplification curve of negative quality control product provided by the embodiment of the present invention.
FIG. 3 is a graph showing the amplification of Aedes aegypti samples according to one embodiment of the present invention.
FIG. 4 is a graph showing the amplification curve of an Aedes albopictus sample according to an embodiment of the present invention.
FIG. 5 is a graph showing the amplification of a mosquito-carrying dengue virus in a sample of Aedes aegypti according to an embodiment of the present invention.
FIG. 6 is a graph showing the amplification of dengue virus carried by Aedes albopictus samples in combination with a sample of Aedes albopictus.
Detailed Description
In order to make the purpose, technical solution and technical effect of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. Other embodiments, which can be derived by those skilled in the art from the description of the embodiments of the invention without any undue experimentation, are within the scope of the invention.
In the description of the present invention, it is to be understood that the terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically limited otherwise.
The embodiment of the invention provides a kit for simultaneously carrying out classification monitoring on aedes and dengue virus detection, which comprises the following reagents: RT-qPCR premixed liquid, RT-qPCR enzyme, positive quality control product and negative quality control product.
Specifically, the RT-qPCR premix solution comprises a one-step reaction RT-qPCR buffer solution, a dengue virus non-coding region highly conserved sequence forward specific primer, a dengue virus non-coding region highly conserved sequence reverse specific primer and a dengue virus probe; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe.
Preferably, the dengue virus, aedes aegypti and aedes albopictus are the latest dengue virus, aedes aegypti and aedes albopictus whole genome sequences known at the National Center for Biotechnology Information (NCBI). Preferably, the designed primers comprise a forward specific primer, a reverse specific primer and a TaqMan fluorescent probe. Wherein, a forward primer and a reverse primer are designed, and are mainly used for reverse transcription into cDNA under the action of reverse transcriptase by taking RNA as a template and adopting a random primer in the first step of RT-qPCR reaction; secondly, taking cDNA as a template, and carrying out complementary combination on the 5' ends of the forward primer and the reverse primer and the complementary strand thereof through bases during annealing; and during the third step of extension reaction, the DNA template and primer combination takes dNTPs as reaction raw materials and the target sequence as a template under the action of Taq enzyme, new basic groups are continuously added at the 3' ends of the forward primer and the reverse primer so as to continuously extend forwards, and a new semi-reserved replication chain which is complementary with the DNA chain of the template is synthesized according to the basic group pairing and semi-reserved replication principle. A TaqMan fluorescent probe is designed, and is an oligonucleotide probe, wherein the 5 'end of the TaqMan fluorescent probe carries a fluorescent group such as FAM, TET, VIC, HEX and the like, and the 3' end of the TaqMan fluorescent probe carries a quenching group such as TAMRA, BHQ and the like. During PCR amplification, a pair of primers is added, and a specific fluorescent probe is added at the same time, when the probe is complete, a fluorescent signal emitted by a reporter group is absorbed by a quenching group; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme cuts and degrades the probe, so that the reporter fluorescent group and the quenching fluorescent group are separated, a fluorescence monitoring system can receive a fluorescence signal, namely, one fluorescent molecule is formed when one DNA chain is amplified, and the accumulation of the fluorescence signal and the formation of a PCR product are completely synchronous. The TaqMan fluorescent probe has good repeatability, strong specificity and wide linear range, and can improve the reaction efficiency and the detection sensitivity.
Preferably, according to the whole genome sequence of the dengue virus, the sequences of the primers are as follows:
the Sequence of the dengue virus forward specific primer is Sequence ID No.1 and is CAGGTGGAAGGGCGTACAAC; the Sequence of the dengue virus reverse specific primer is Sequence ID No.2 and is CTCCCGTGACTGTAGCCAGA; the Sequence of the dengue virus probe is Sequence ID No.3, and is FAM-ACTGCCGGAGACCCTGGAGACATTGCT-BHQ 1. The sequence of the forward specific primer and the sequence of the reverse specific primer of the dengue virus comprise specific conserved regions of a gene sequence of the dengue virus, have target gene specificity, can quickly carry out polymerase chain amplification reaction on the gene sequence of the dengue virus, reduce reaction time and improve reaction sensitivity. The fluorescent group of the dengue virus probe is FAM, and when detection is carried out, if a fluorescence curve of FAM appears in a result, dengue virus nucleic acid in a detected mosquito sample can be immediately analyzed, so that the detection and analysis efficiency is improved.
Preferably, the initial concentration of the dengue virus forward specific primer is 10 μm/L, the initial concentration of the dengue virus reverse specific primer is 10 μm/L, and the initial concentration of the dengue virus probe is 10 μm/L.
Preferably, the dengue virus forward specific primer is applied at a concentration of 0.2 μm/L, the dengue virus reverse specific primer is applied at a concentration of 0.2 μm/L, and the dengue virus probe is applied at a concentration of 0.1 μm/L.
Preferably, the reaction system preparation adding amount of the dengue virus forward specific primer is 1 μ l, the reaction system preparation adding amount of the dengue virus reverse specific primer is 1 μ l, and the reaction system preparation adding amount of the dengue virus probe is 0.5 μ l.
Preferably, based on the whole genome sequence of aedes aegypti, the primer sequences are as follows:
the Sequence of the Aedes aegypti forward specific primer is Sequence ID No.4 and is TCCGCCAAAAGCAGAACCTG; the Sequence of the Aedes aegypti reverse specific primer is Sequence ID No.5 and is TCGGCCGGGATGTAGATGTT; the Sequence of the Aedes aegypti probe is Sequence ID No.6 and is VIC-TCCGTGCGGCCAAGTATGCCAAGAAGT-BHQ 1. The sequence of the forward specific primer and the sequence of the reverse specific primer of the aedes aegypti comprise specific conserved regions of the gene sequence of the aedes aegypti, have target gene specificity, can quickly perform polymerase chain amplification reaction on the gene sequence of the aedes aegypti, reduce reaction time and improve reaction sensitivity. The fluorescent group of the Aedes aegypti probe is VIC, and when detection is carried out, if a fluorescence curve of VIC appears in a result, the detected mosquito sample nucleic acid can be immediately analyzed to be the Aedes aegypti gene, so that the efficiency of mosquito classification and identification is improved.
Preferably, the initial concentration of the Aedes aegypti forward specific primer is 10 μm/L, the initial concentration of the Aedes aegypti reverse specific primer is 10 μm/L, and the initial concentration of the Aedes aegypti probe is 10 μm/L.
Preferably, the application concentration of the forward specific primer of the Aedes aegypti is 0.2 mu m/L, the application concentration of the reverse specific primer of the Aedes aegypti is 0.2 mu m/L, and the application concentration of the probe of the Aedes aegypti is 0.1 mu m/L.
Preferably, the preparation adding amount of the reaction system of the Aedes aegypti forward specific primer is 1 mul, the preparation adding amount of the reaction system of the Aedes aegypti reverse specific primer is 1 mul, and the preparation adding amount of the reaction system of the Aedes aegypti probe is 0.5 mul.
Preferably, according to the whole genome sequence of aedes albopictus, the primer sequences are as follows:
the Sequence of the forward specific primer of the Aedes albopictus is Sequence ID No.7 and is TCCAGAATGCGTTACGTGGC; the Sequence of the Aedes albopictus reverse specific primer is Sequence ID No.8 and is CCTTCAGCTCGTTGACCACC; the Sequence of the Aedes albopictus probe is Sequence ID No.9, and is Cy5-ACGCCAGCCCATCGAATGCCGACAT-BHQ 2. The sequence of the forward specific primer and the sequence of the reverse specific primer of the aedes albopictus comprise specific conserved regions of the aedes albopictus gene sequence, have target gene specificity, can quickly perform polymerase chain amplification reaction on the aedes albopictus gene sequence, reduce reaction time and improve reaction sensitivity. The fluorescent group of the aedes albopictus probe is Cy5, and when detection is carried out, if a Cy5 fluorescence curve appears in a result, the detected nucleic acid of the mosquito sample can be immediately analyzed and obtained to be the aedes albopictus gene, so that the efficiency of mosquito classification and identification is improved.
Preferably, the initial concentration of the Aedes albopictus forward specific primer is 10 μm/L, the initial concentration of the Aedes albopictus reverse specific primer is 10 μm/L, and the initial concentration of the Aedes albopictus probe is 10 μm/L.
Preferably, the concentration of the forward specific primer of the Aedes albopictus is 0.2 μm/L, the concentration of the reverse specific primer of the Aedes albopictus is 0.2 μm/L, and the concentration of the probe of the Aedes albopictus is 0.1 μm/L.
Preferably, the reaction system preparation adding amount of the aedes albopictus forward specific primer is 1 mul, the reaction system preparation adding amount of the aedes albopictus reverse specific primer is 1 mul, and the reaction system preparation adding amount of the aedes albopictus probe is 0.5 mul.
Preferably, the RT-qPCR reaction solution contains a one-step reaction RT-qPCR buffer solution, so that the amplification performance and specificity of the reaction can be effectively improved, no reagent is required to be added in the reaction process, no cover is required to be opened, and pollution is avoided. In the invention, the initial buffer solution of the one-step reaction RT-qPCR is a buffer solution with higher concentration configured in the kit, and the initial buffer solution concentration of the one-step reaction RT-qPCR is 2 times of the concentration of the application buffer solution of the one-step reaction RT-qPCR. In the invention, the application concentration of the one-step reaction RT-qPCR buffer solution is 1-fold concentration, and the preparation addition amount of the reaction system of the initial buffer solution of the one-step reaction RT-qPCR is 25 mu l.
Preferably, the RT-qPCR enzyme premix solution comprises reverse transcriptase and hot start Taq DNA polymerase, so that the amplification performance and specificity of the reaction can be effectively improved, no reagent is required to be added in the reaction process, no cover is required to be opened, and pollution is avoided. In the invention, the initial premixed solution of the RT-qPCR enzyme is a premixed solution with higher concentration configured in the kit, and the concentration of the initial premixed solution of the RT-qPCR enzyme is 25 times of that of the applied premixed solution of the RT-qPCR enzyme. In the invention, the application concentration of the RT-qPCR enzyme premix is 1-fold concentration, and the reaction system preparation addition amount of the RT-qPCR enzyme initial premix is 2 mu l.
Preferably, the positive quality control substance is a synthetic plasmid mixture containing target gene fragments of dengue virus, aedes aegypti and aedes albopictus, and the loading amount of the positive quality control substance is 10 mu l.
Preferably, the negative quality control substance is normal saline, and the sample adding amount of the negative quality control substance is 10 mu l.
The kit provided by the embodiment of the invention is added with genes of dengue viruses, Aedes aegypti and Aedes albopictus, and simultaneously comprises forward specific primers, reverse specific primers and probes of the genes of the dengue viruses, the Aedes aegypti and the Aedes albopictus. The kit is a novel triple fluorescence RT-PCR nucleic acid detection kit which can classify and identify Aedes aegypti and Aedes albopictus in the same reaction tube and can detect dengue viruses carried by mosquitoes, the RT-qPCR premixed solution, RT-qPCR enzyme, positive quality control products and negative quality control products are mixed to carry out triple real-time fluorescence PCR detection technology, and the kit has the advantages of strong specificity and high sensitivity. The kit provided by the invention is used for carrying out classification and identification on Aedes aegypti and Aedes albopictus, and simultaneously detecting dengue viruses, so that the efficiency of mosquito-vector classification and identification and pathogen monitoring is improved, the time is saved, and the accuracy of mosquito-vector classification and identification and the efficiency of pathogen monitoring are improved.
Accordingly, the embodiment of the present invention also provides a method for detecting aedes classification monitoring and dengue virus by using the above kit, which comprises the following steps:
s01, selecting 10 mosquito vector monitoring samples, and extracting the total RNA of the mosquito samples.
S02, respectively designing and synthesizing a forward specific primer of a highly conserved sequence of a non-coding region of the dengue virus, a reverse specific primer of a highly conserved sequence of a non-coding region of the dengue virus and a dengue virus probe according to the whole genome sequences of the known dengue virus, Aedes aegypti and Aedes albopictus; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe.
S03, preparing a 50 mu l RT-qPCR reaction system according to the RT-qPCR premixed solution, the RT-qPCR enzyme, the positive quality control product and the negative quality control product which are provided by the kit for simultaneously carrying out aedes classification monitoring and dengue virus detection.
S04, setting a reaction program, wherein the fluorescence signal is set as: the fluorescent reporter group is FAM, VIC, Cy5 channel; reference fluorescence (Passive Reference) is None (None); performing fluorescence PCR amplification, and setting the total reaction volume to be 50 mu l; the setup of the fluorescent PCR amplification procedure is shown in Table 1.
TABLE 1
And S05, after the PCR amplification is finished, judging whether the mosquito is classified and infected with the dengue virus or not according to the fluorescence curve. And only when the signals of the positive quality control substances in the 3 fluorescence channels are positive and the signals of the negative quality control substances in the 3 fluorescence channels are negative, the detection result of the sample to be detected is effective.
And when the detection result shows that the number of PCR reaction cycles (CT value) which are passed by the fluorescent signal in each reaction tube when the fluorescent signal reaches the set threshold value is less than or equal to 40, and the detection result is a positive sample if the number of the PCR reaction cycles (CT value) is obviously increased exponentially.
When the CT value is more than 40 and less than 45 in the detection result, and the obvious exponential growth period exists, the detection result is a suspicious sample; and (4) recommending the sample with the suspicious detection result to be subjected to the retest once, if the retest result CT is less than 40 and the exponential amplification exists, judging that the detection result is a positive sample, and otherwise, judging that the detection result is a negative sample.
When the CT value is 40 or no CT value and no exponential amplification period exists in the detection result, the detection result is a negative sample.
Specifically, in step S01, the mosquito-vector samples are selected from 2 mosquito-vector samples, each of which carries dengue virus, aedes albopictus, zakh virus, aedes aegypti, zakh virus, and culex epidemic encephalitis b virus.
Preferably, in the step of extracting the RNA of the mosquito-borne sample, an RNA extraction Kit High Pure Viral RNA Kit, a product of Roche of Switzerland, is adopted. And (4) extracting the nucleic acid of the sample according to the instruction of the reagent.
In the step S02, the dengue virus non-coding region highly conserved sequence forward specific primer, dengue virus non-coding region highly conserved sequence reverse specific primer and dengue virus probe; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; the specific base sequences of the Aedes albopictus ribosomal RNA forward specific primer, the Aedes albopictus ribosomal RNA reverse specific primer and the Aedes albopictus ribosomal RNA probe are as described above, and will not be repeated here.
In the step S03, a 50 μ l RT-qPCR reaction system was prepared based on the RT-qPCR premix, RT-qPCR enzyme, positive quality control, and negative quality control provided by the kit for aedes classification monitoring and dengue virus detection at the same time. The amounts of the components added for the reaction system are shown in Table 2.
TABLE 2
Reaction components
Reaction System preparation addition amount (μ l)
One-step reaction RT-qPCR (reverse transcription-quantitative polymerase chain reaction) premix
25
Dengue virus-forward primer
1
Dengue virus-reverse primer
1
Dengue virus-FAM probes
0.5
Aedes aegypti-forward primer
1
Aedes aegypti reverse primer
1
Aedes aegypti-VIC probe
0.5
Aedes albopictus-forward primer
1
Aedes albopictus reverse primer
1
Aedes albopictus-Cy 5 probe
0.5
RT-qPCR enzymes
2
RNase free ddH2O
10
RNA template
5.5
Total reaction volume
50
In the step S05, when the fluorescence signal in each reaction tube reaches the set threshold value, the number of PCR reaction cycles (CT value) is less than or equal to 40, and there is a significant exponential growth period, the detection result is a positive sample, after the detection result is determined to be a positive sample, the fluorophore is further analyzed to determine the mosquito-borne typing and whether dengue virus is carried. The specific analysis is shown in Table 3, when the fluorophore is FAM, the detection result is positive for dengue virus nucleic acid; when the fluorescent group is VIC, the mosquito is classified as Aedes aegypti; when the fluorescent group is Cy5, the mosquito is classified as Aedes albopictus.
TABLE 3
The method is a method for detecting by using the kit which is simultaneously used for aedes classification monitoring and dengue virus detection, dengue virus, aedes aegypti and aedes albopictus are detected on a sample based on a triple fluorescence PCR technology, the detection time is 2 hours, and the detection result can be used in a plurality of research fields such as dengue virus detection, aedes classification identification, conventional medical vector biological monitoring and the like. Compared with the prior art, the invention has the advantages that: (1) one sample can be detected for 1 time, namely aedes classification monitoring and dengue virus detection can be simultaneously carried out, the detection time is 2 hours, and compared with the detection for 3 times by 1 sample, the detection efficiency is obviously improved; (2) designing a forward and reverse specific amplification primer and a Taqman probe respectively aiming at gene sequences of dengue viruses, Aedes aegypti and Aedes albopictus to ensure the specificity and accuracy of detection; (3) can accurately identify the molecular biology level of mosquito eggs, pupas, larvae, mosquito complexes, kindred species and the like.
Further, the description will be given in the context of specific embodiments.
Example 1
S01, selecting and collecting a sample of Aedes aegypti carrying dengue viruses, a sample of Aedes albopictus carrying dengue viruses, a sample of Aedes aegypti carrying Zika viruses, a sample of Aedes albopictus carrying Zika viruses and a sample of Culex carrying epidemic encephalitis B viruses, wherein 2 mosquito-media samples are selected respectively. Extracting nucleic acid of a sample according to a Roche High Pure Viral RNA Kit method of an RNA extraction Kit for later use; respectively taking the Aedes aegypti carrying dengue virus sample nucleic acid, the Aedes albopictus carrying dengue virus sample nucleic acid, the Aedes aegypti carrying Zika virus sample nucleic acid and the Aedes albopictus carrying Zika virus sample nucleic acid to carry out positive sample verification; and (3) taking the nucleic acid of the sample carrying the epidemic encephalitis B virus of the culex mosquito for specific detection.
S02, respectively designing and synthesizing a forward specific primer of a highly conserved sequence of a non-coding region of the dengue virus, a reverse specific primer of a highly conserved sequence of a non-coding region of the dengue virus and a dengue virus probe according to the whole genome sequences of the known dengue virus, Aedes aegypti and Aedes albopictus; an Aedes aegypti ribosome RNA forward specific primer, an Aedes aegypti ribosome RNA reverse specific primer and an Aedes aegypti ribosome RNA probe; an Aedes albopictus ribosome RNA forward specific primer, an Aedes albopictus ribosome RNA reverse specific primer and an Aedes albopictus ribosome RNA probe. The nucleotide sequences of the primers are shown in Table 4.
TABLE 4
S03, preparing a 50 mu l RT-qPCR reaction system according to the RT-qPCR premixed solution, the RT-qPCR enzyme, the positive quality control product and the negative quality control product which are provided by the kit for simultaneously carrying out aedes classification monitoring and dengue virus detection. The reaction system formulation of each component is shown in Table 5.
TABLE 5
S04, setting a reaction program, wherein the fluorescence signal is set as: the fluorescent reporter group is FAM, VIC, Cy5 channel; reference fluorescence (Passive Reference) is None (None); performing fluorescence PCR amplification, and setting the total reaction volume to be 50 mu l; the setup of the fluorescent PCR amplification procedure is shown in Table 1.
TABLE 1
And S05, after the PCR amplification is finished, judging whether the mosquito is classified and infected with the dengue virus or not according to the fluorescence curve. And only when the signals of the positive quality control substances in the 3 fluorescence channels are positive and the signals of the negative quality control substances in the 3 fluorescence channels are negative, the detection result of the sample to be detected is effective.
And when the detection result shows that the number of PCR reaction cycles (CT value) which are passed by the fluorescent signal in each reaction tube when the fluorescent signal reaches the set threshold value is less than or equal to 40, and the detection result is a positive sample if the number of the PCR reaction cycles (CT value) is obviously increased exponentially.
When CT is more than 40 and less than 45 in the detection result, and the index growth period is obvious, the detection result is a suspicious sample; and (4) recommending the sample with the suspicious detection result to be subjected to the retest once, if the retest result CT is less than 40 and the exponential amplification exists, judging that the detection result is a positive sample, and otherwise, judging that the detection result is a negative sample.
When the CT value is 40 or no CT value and no exponential amplification period exists in the detection result, the detection result is a negative sample.
And analyzing the detection result of the sample, and detecting the dengue virus sample nucleic acid carried by Aedes aegypti, the dengue virus sample nucleic acid carried by Aedes albopictus, the Zika virus sample nucleic acid carried by Aedes aegypti and the Zika virus sample nucleic acid carried by Aedes albopictus, wherein the detection result of the target mosquito and the pathogen is positive, and the detection rate of the positive sample is 100%. The sample is verified as shown in figures 1-6. Wherein, FIG. 1 is an amplification curve of a positive quality control product, FIG. 2 is an amplification curve of a negative quality control product, FIG. 3 is an amplification curve of an Aedes aegypti sample, FIG. 4 is an amplification curve of an Aedes albopictus sample, FIG. 5 is an amplification curve of an Aedes aegypti sample and a dengue virus positive sample, and FIG. 6 is an amplification curve of an Aedes albopictus sample and a dengue virus positive sample. It can be seen that the amplification curves of the positive quality control products are positive values, and the amplification curve of the negative quality control products is the amplification curve of Wu. The different types of aedes samples have different fluorescent groups on probes, and the different fluorescent groups represent the different types of aedes samples obtained by detection, wherein the fluorescent group of the aedes aegypti probe is VIC, and the fluorescent group of the aedes albopictus probe is Cy 5.
By carrying out specificity detection on the sample of the culex carrying epidemic encephalitis B virus, the detection of non-target mosquitoes and pathogens is negative, and the result shows that the method has good specificity, and the specificity is 100%.
The above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and modifications and improvements made within the principle of the present invention are included in the scope of the present invention.
Sequence listing
<110> Guangxi international travel health care center (Nanning customs port outpatient department)
<120> kit simultaneously used for aedes classification monitoring and dengue virus detection
<130>2021.08.30
<160>9
<210>1
<211>20
<212>DNA
<213> Artificial Synthesis
<400>1
CAGGTGGAAG GGCGTACAAC 20
<210>2
<211>20
<212>DNA
<213> Artificial Synthesis
<400>2
CTCCCGTGAC TGTAGCCAGA 20
<210>3
<211>27
<212>DNA
<213> Artificial Synthesis
<400>3
ACTGCCGGAG ACCCTGGAGA CATTGCT 27
<210>4
<211>20
<212>DNA
<213> Artificial Synthesis
<400>4
TCCGCCAAAA GCAGAACCTG 20
<210>5
<211>20
<212>DNA
<213> Artificial Synthesis
<400>5
TCGGCCGGGA TGTAGATGTT 20
<210>6
<211>27
<212>DNA
<213> Artificial Synthesis
<400>6
TCCGTGCGGC CAAGTATGCC AAGAAGT 27<210>7
<211>
<212>DNA
<213> Artificial Synthesis
<400>7
TCCAGAATGC GTTACGTGGC 20
<210>8
<211>20
<212>DNA
<213> Artificial Synthesis
<400>8
CCTTCAGCTC GTTGACCACC 20
<210>9
<211>25
<212>DNA
<213> Artificial Synthesis
<400>9
ACGCCAGCCC ATCGAATGCC GACAT 25
Sequence listing
<110> Guangxi international travel health care center (Nanning customs port outpatient department)
<120> kit simultaneously used for aedes classification monitoring and dengue virus detection
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 1
caggtggaag ggcgtacaac 20
<210> 2
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 2
ctcccgtgac tgtagccaga 20
<210> 3
<211> 27
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 3
actgccggag accctggaga cattgct 27
<210> 4
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 4
tccgccaaaa gcagaacctg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 5
tcggccggga tgtagatgtt 20
<210> 6
<211> 27
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 6
tccgtgcggc caagtatgcc aagaagt 27
<210> 7
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 7
tccagaatgc gttacgtggc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 8
ccttcagctc gttgaccacc 20
<210> 9
<211> 25
<212> DNA
<213> Artificial synthesis (2 Ambystoma latex x Ambystoma jeffersonia)
<400> 9
acgccagccc atcgaatgcc gacat 25