阅读说明：本技术 一种mep1b基因在制备检测或调控子宫内膜发育产品中的应用 (Application of MEP1B gene in preparation of products for detecting or regulating endometrial development ) 是由 洪林君 吴珍芳 贺艳娟 杨化强 蔡更元 李紫聪 顾婷 杨杰 郑恩琴 徐铮 黄思秀 于 2021-07-07 设计创作，主要内容包括：本发明属于生物技术领域,具体涉及一种MEP1B基因在制备检测或调控子宫内膜发育产品中的应用。本发明通过超表达MEP1B基因和沉默MEP1B基因进行CCK8实验、ki67检测细胞增殖实验及细胞周期实验均可表明MEP1B蛋白的表达能够促进猪子宫内膜上皮细胞的增殖功能,一方面MEP1B基因可作为妊娠标志物快速准确的检测猪妊娠状况,另一方面为精准调控子宫内膜发育、提高胚胎的成功附植提供了理论依据。(The invention belongs to the technical field of biology, and particularly relates to an application of MEP1B gene in preparation of products for detecting or regulating endometrial development. According to the invention, both a CCK8 experiment, a ki67 cell proliferation detection experiment and a cell cycle experiment are carried out by over-expressing MEP1B gene and silencing MEP1B gene, which show that the expression of MEP1B protein can promote the proliferation function of porcine endometrial epithelial cells, on one hand, MEP1B gene can be used as a pregnancy marker to quickly and accurately detect the pregnancy condition of a pig, and on the other hand, theoretical basis is provided for accurately regulating and controlling the endometrial development and improving the successful implantation of an embryo.)

1. An application of MEP1B gene in preparing products for detecting or regulating endometrial development is characterized in that: the nucleotide sequence of the MEP1B gene is shown as SEQ ID NO:1 is shown.

2. The use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 1, wherein the product comprises:

the product for detecting the endometrial development comprises a product for detecting the endometrial development by RT-PCR, real-time quantitative PCR, immunodetection, in-situ hybridization or a gene chip.

3. The use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 2, wherein:

the product for detecting endometrial development through real-time quantitative PCR comprises at least one pair of primers for specifically amplifying MEP1B gene.

4. The use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 3, wherein:

the primers for specifically amplifying MEP1B gene are MEP1B-F and MEP1B-R, and the nucleotide sequences are shown as follows:

MEP1B-F：CTGCCGTGTTCGCCCTGATG；

MEP1B-R：TGCTGTATGTGAACCTGGCTCTTTAC。

5. the use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 1, wherein the product comprises:

the regulation of endometrial development comprises inhibition of endometrial development.

6. The MEP1B gene according to claim 5, wherein the MEP1B gene is used for preparing products for detecting or regulating endometrial development, and is characterized in that:

the inhibition of the endometrial development comprises the inhibition of the expression of a uterine cavity fluid total exosome protein MEP 1B.

7. The use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 6, wherein:

the inhibition of the expression of the uterine cavity fluid total exosome protein MEP1B comprises the inhibition of the expression of the uterine cavity fluid total exosome protein MEP1B by an RNA interference method.

8. The use of MEP1B gene in the preparation of a product for detecting or regulating endometrial development according to claim 7, wherein:

the nucleotide sequence of the siRNA for inhibiting the expression of the uterine cavity fluid total exosome protein MEP1B is shown as follows:

siRNA-MEP1B-2-sense：CCUGGCACAUAAGGAAUUUTT；

siRNA-MEP1B-2-antisense：AAAUUCCUUAUGUGCCAGGTT。

9. an inhibitor for inhibiting endometrial development, comprising an inhibitor of the total exosome protein MEP1B of uterine cavity fluid.

10. The inhibitor for inhibiting endometrial development according to claim 9, wherein:

the uterine cavity fluid total exosome protein MEP1B inhibitor comprises siRNA for inhibiting expression of the uterine cavity fluid total exosome protein MEP1B, and the nucleotide sequence of the siRNA is shown as follows:

siRNA-MEP1B-2-sense：CCUGGCACAUAAGGAAUUUTT；

siRNA-MEP1B-2-antisense：AAAUUCCUUAUGUGCCAGGTT。

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an application of MEP1B gene in preparation of products for detecting or regulating endometrial development.

Background

The average litter size of the sow is the most important factor influencing the production efficiency and the economic benefit of the pig industry. Compared with the growth trait of the pig, the average heritability of the farrowing of the sow is 0.1, and the expected substantial breakthrough is difficult to achieve by using the conventional breeding technology to improve the low heritability trait of the farrowing. If the important genes for regulating and controlling the litter size of the sow can be identified, the genes can be used for molecular marker-assisted selection or artificial regulation to improve the litter size of the sow. During the whole gestation period, the number of ovulations of the pigs is 20-28, but the final litter size is only 10-18, the death rate of embryos in the gestation period is 30-50%, the 30-50% of embryo death rate limits the realization of the litter size potential of sows, and the economic benefit of a pig farm is also influenced.

During implantation of the porcine embryo, the endometrial epithelial cells are columnar in shape and closely packed. The endometrium epithelium mainly serves as a barrier for embryo invasion, and in a non-accepting state, the endometrium epithelium can prevent trophoblast cell invasion, and in an accepting state, the endometrium epithelium and the placenta trophoblast epithelium are tightly combined to form a maternal-fetal interface epithelial bilayer. Before embryo implantation, uterus is in non-adhesive state, and a large amount of cell surface anti-adhesion molecule-polysaccharide-protein complexes are expressed in endometrial epithelial cells. During implantation, the content of polysaccharide-protein complex of the endometrial epithelium is reduced, so that the endometrial epithelium is in a receptive state, the steric hindrance is reduced, and preparation is provided for the adhesion of the embryo and the endometrial epithelium. The porcine embryo in the period of implantation is in a long-time free state in the uterine cavity, the embryo starts to enter the uterine cavity on the 2 nd day, the embryo develops into a tubular shape on the 9 th day, develops into a spherical shape on the 10 th-11 th day and develops into a filamentous shape on the 12 th day, the embryo change is most obvious in the stage from the 10 th-11 th day to the 12 th day, and the embryo develops into a thick linear shape and starts to adhere to the endometrium on the 15 th day, and is fixed in position in the uterus; during this period, from day 9 to 12, the endometrium thickens and assumes a different state with increasing gestational period. The thickness and developmental status of the endometrium affect the successful implantation of the embryo.

Disclosure of Invention

In order to overcome the defects and shortcomings of the prior art, the primary object of the present invention is to provide an application of MEP1B gene in the preparation of products for detecting or regulating endometrial development.

Another object of the present invention is to provide an inhibitor for inhibiting endometrial development, which comprises an inhibitor of the total exosome protein MEP1B of uterine cavity fluid.

The purpose of the invention is realized by the following technical scheme:

an application of MEP1B gene in preparing products for detecting or regulating endometrial development;

the nucleotide sequence of the MEP1B gene is shown as SEQ ID NO:1 is shown in the specification;

the endometrial development comprises endometrial development in early pregnancy;

the product for detecting the endometrial development comprises a product for detecting the endometrial development by RT-PCR, real-time quantitative PCR, DNA sequencing, immunodetection, in-situ hybridization or a gene chip;

the product for detecting the endometrial development through real-time quantitative PCR comprises at least one pair of primers for specifically amplifying MEP1B gene;

the primers for specifically amplifying MEP1B gene are preferably MEP1B-F and MEP1B-R, and the nucleotide sequences are shown as follows:

MEP1B-F：CTGCCGTGTTCGCCCTGATG；

MEP1B-R：TGCTGTATGTGAACCTGGCTCTTTAC；

said regulating endometrial development comprises inhibiting endometrial development;

the inhibition of the endometrial development comprises the inhibition of the expression of uterine cavity fluid total exosome protein MEP 1B;

the inhibition of the expression of the uterine cavity fluid total exosome protein MEP1B comprises the inhibition of the expression of the uterine cavity fluid total exosome protein MEP1B by an RNA interference method;

the nucleotide sequence of the siRNA for inhibiting the expression of the uterine cavity fluid total exosome protein MEP1B is shown as follows:

siRNA-MEP1B-2-sense：CCUGGCACAUAAGGAAUUUTT；

siRNA-MEP1B-2-antisense：AAAUUCCUUAUGUGCCAGGTT；

an inhibitor for inhibiting endometrial development, comprising an inhibitor of the total exosome protein MEP1B of uterine cavity fluid;

the uterine cavity fluid total exosome protein MEP1B inhibitor comprises siRNA for inhibiting expression of the uterine cavity fluid total exosome protein MEP1B, and the nucleotide sequence of the siRNA is shown as follows:

siRNA-MEP1B-2-sense：CCUGGCACAUAAGGAAUUUTT；

siRNA-MEP1B-2-antisense：AAAUUCCUUAUGUGCCAGGTT；

the endometrium includes, but is not limited to pig endometrium, and may also be endometrium of other animals such as cattle, sheep, mouse, etc.;

the principle of the invention is as follows:

in the process of embryo colonization, the embryo and the mother body do not exist in independent individuals, and biological factors between the embryo and the mother body are exchanged to form correct signal communication between the mother body and the embryo. Since the embryo at this stage is free in the uterine cavity fluid for a long time, the signal communication between the mother and the fetus is completed by the related factors in the uterine cavity fluid, the exosome is a double-layer membrane vesicle with the diameter of 30-150nm, the exosome can transport the carried protein to the target cell to play a role, and the function of remotely carrying out the signal transmission between cells is considered to be a novel signal communication between cells. Exosomes are shown to be present in the uterine cavity fluid of pigs, and the protein components carried by it play an important role in signal communication between the endometrium and the embryo. However, the specific regulatory mechanism is not known.

According to the invention, by researching the action mechanism of signal communication between endometrium and embryo of protein components of pig uterine cavity fluid total exosome in early gestation period, the expression of MEP1B protein is found to increase along with the increase of gestation time in the endometrial development in the early gestation period. CCK8 experiments, ki67 cell proliferation detection experiments and cell cycle experiments carried out by over-expressing MEP1B gene and silencing MEP1B gene all show that the expression of MEP1B protein can promote the proliferation function of porcine endometrial epithelial cells.

Compared with the prior art, the invention has the following advantages and effects:

(1) the early pregnancy diagnosis can confirm whether the bred sows are pregnant or not, timely carry out fetus protection on the sows which are pregnant, timely take compounding measures on the sows which are not pregnant, shorten the non-pregnant period, and early eliminate the sows which are frequently bred to be pregnant. The B-ultrasonic diagnosis is the most popular pregnancy diagnosis method in pig farms at present, but the B-ultrasonic diagnosis needs to be carried out for about 30 days of pregnancy of sows to achieve higher accuracy. In order to accurately determine the pregnancy condition of a sow in the early pregnancy, exosome and MEP1B gene carried by the exosome are used as pregnancy markers to quickly and accurately detect the pregnancy condition of the sow.

(2) According to the invention, both CCK8 experiments, ki67 cell proliferation detection experiments and cell cycle experiments are carried out on the over-expression MEP1B gene and the silent MEP1B gene, which show that the expression of MEP1B protein can promote the proliferation function of porcine endometrial epithelial cells, and further provide theoretical basis for accurately regulating and controlling endometrial development and improving successful implantation of embryos.

(3) The invention provides a pair of siRNA for efficiently silencing MEP1B gene, and the siRNA can effectively silence MEP1B gene of porcine endometrium epithelial cell by silencing experiment verification, thereby providing basis and direction for research of sow litter size potential theory mechanism and development of pig breeding.

Drawings

FIG. 1 is an electron microscopic identification and Western blot (protein CD9, CD63 expression) detection result analysis chart of porcine uterine cavity fluid total exosome of 12 days of gestation prepared in example 1; wherein, A: electron microscope identification results, B: and (5) detecting a result by using Western blot.

FIG. 2 is a diagram showing the result of analyzing and detecting total exosomes of uterine cavity fluid of pigs in 12 days of gestation prepared in example 1 by NTA technology.

FIG. 3 is an analysis chart of the expression result of MEP1B protein in total exosomes of porcine uterine cavity fluid detected by Western blot at four stages (C9, D9, D12 and D15).

FIG. 4 is a graph of qPCR assay results after transfection of endometrial epithelial cells with three pairs of siRNA and NC interfering fragments.

FIG. 5 is a diagram showing the result of analyzing the proliferation of porcine endometrial epithelial cells after CCK8 detection and transfection of an overexpression vector (P < 0.05).

FIG. 6 is an analysis chart of the results of Western Blot detection of expression of MEP1B protein and ki67 protein in porcine endometrial epithelial cells transfected with the overexpression vector (P < 0.05).

FIG. 7 is a diagram showing the analysis of the cell cycle of porcine endometrial epithelial cells after the transfection of the overexpression vector by flow cytometry (P < 0.05).

FIG. 8 is an analysis chart of the proliferation results of porcine endometrial epithelial cells after CCK8 detection of siRNA interference (P < 0.01).

FIG. 9 is an analysis chart of the results of expression of MEP1B protein and ki67 protein in porcine endometrial epithelial cells after siRNA interference by Western Blot assay (P)_(MEP1B)＜0.01；P_(ki67)＜0.05)。

FIG. 10 is an analysis chart of the results of cell cycle of porcine endometrial epithelial cells after siRNA interference detection by flow cytometry (p < 0.05).

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

EXAMPLE 14 preparation and characterization of Total exosomes of porcine uterine cavity fluid at different stages

Preparation of pig uterine cavity fluid total exosome in one or 4 different periods

(1) Taking uterus of large white sow (provided by Wen's three and slaughter house, 3 times of each time, 12 times in total) for estrus 9 days, gestation 12 days and gestation 15 days;

(2) cutting 1 small opening on one side of uterus, inserting one end of a embryo-washing tube into the small opening, injecting air by using an injector, fixing the position of the embryo-washing tube in the uterine cavity, and using a 50ml centrifuge tube at the other end of the embryo-washing tube to collect the washing liquid of PBS;

(3) injecting a syringe filled with PBS into the uterine cavity, clamping the upstream part of an injection port, slowly injecting the PBS into the uterine cavity, and slightly pressing by hands to enable PBS flushing fluid to flow towards the direction of a rinsing duct; repeating the above operations for several times, and collecting uterine cavity fluid in time; collecting uterine cavity fluid from the uterus of the other side by the same method, and mixing the uterine cavity fluid from the uterus of both sides and storing at-80 deg.C in time;

(4) centrifuging the collected uterine cavity fluid at 4 deg.C and 2000g for 20min, removing precipitate, and keeping supernatant;

(5) transferring the supernatant into a new centrifuge tube, centrifuging at 4 deg.C and 8000g for 40min, removing precipitate, and keeping the supernatant;

(6) transferring the supernatant into a super-centrifuge tube, centrifuging at 4 deg.C and 100000g for 2 hr to obtain precipitate as total exosome of pig uterine cavity fluid, collecting supernatant, and storing at-80 deg.C;

identification of two or 4 total exosomes of porcine uterine cavity fluid in different periods

(1) Electron microscope identification of exosomes

Re-suspending the total exosomes of the porcine uterine cavity fluid prepared in the step one by PBS to obtain total exosome weight suspension of the porcine uterine cavity fluid; then 10 mul of the heavy suspension liquid is dropped on a copper net; then 10 mul of uranium solution is taken and mixed with the 10 mul of heavy suspension, negative dyeing is carried out for 2min at room temperature, and natural air drying is carried out; and finally observing under a transmission electron microscope at 80 KV.

The total exosomes of the porcine uterine cavity fluid prepared in the first step all conform to the morphological characteristics of exosomes of 30-150nm, wherein the total exosomes of the porcine uterine cavity fluid in 12 days of gestation are shown in figure 1A.

(2) Western blot for detecting existence of proteins CD9 and CD63

Taking out 30 mu l of the total exosome of the porcine uterine cavity fluid prepared in the step one, and transferring the total exosome into a 1.5ml centrifuge tube. Adding 300 mul of sample lysate, and adding a protease inhibitor PMSF to make the final concentration of the sample lysate be 1 mM; then ultrasonic crushing on ice: the power is 80W, the ultrasound is 1.0s, the closing is 1.0s, and the total time is 3 min; centrifuging the solution at 12000 Xg for 10min at room temperature after ultrasonic treatment, taking the supernatant, and centrifuging again to take the supernatant; the supernatant is the total protein solution of the sample, and the supernatant is subjected to protein concentration measurement and subpackaged and stored at-80 ℃ for standby, wherein the concentration of the total protein solution of the sample at estrus 9 days (C9) is 0.873 mu g/mu L, the concentration of the total protein solution of the sample at pregnancy 9 days (D9) is 1.564 mu g/mu L, the concentration of the total protein solution of the sample at pregnancy 12 days (D12) is 1.853 mu g/mu L, and the concentration of the total protein solution of the sample at pregnancy 15 days (D15) is 2.201 mu g/mu L;

secondly, cleaning the glass plate and the comb by using liquid detergent, cleaning by using ultrapure water, and drying in an oven to prepare separation glue with the mass volume ratio of 12% and concentrated glue with the mass volume ratio of 5%; loading, wherein the loading amount of each hole is 30 mu g;

mounting electrodes, switching on a power supply, and regulating the voltage to about 80V for 30 min; then regulating the voltage to about 100V for 60 min;

soaking the cellulose membrane in a plate filled with methanol for activation, placing a glass plate in a tray filled with membrane transferring liquid, slightly prying off the glass plate, and cutting glue;

making the cellulose film, the glue, the filter paper and the thin sponge into a sandwich-like structure, wherein the stacking sequence on the film transfer device is as follows: clamping a negative electrode, a thin sponge, filter paper, glue, a cellulose membrane, filter paper, a thin sponge and a positive electrode; placing the gel in an electrophoresis tank, pouring the membrane transfer liquid and placing the gel in an ice bag, and placing the electrophoresis tank in a refrigerator at 4 ℃;

sixthly, mounting an electrode, switching on a power supply, adjusting the voltage to about 110V for 60min, taking out the cellulose membrane after the membrane conversion is finished, putting the cellulose membrane in a culture dish filled with TBST, and washing the cellulose membrane for 6 times and 5min each time by TBST;

seventhly, sealing the mixture by using 5 mass percent of skimmed milk powder for 2.5 hours; washing the sealed membrane with TBST for 5min for 6 times;

adding primary anti-CD 9 (rabbit anti, ab236630, abcam) and CD63 (rabbit anti, ab134045, abcam) for incubation, and placing in a refrigerator at 4 ℃ for overnight incubation; washing with TBST for 5min for 6 times after incubation;

ninthly, adding a secondary antibody (goat anti-rabbit, GB23303, Servicebio) for incubation, and incubating for 1.5h on a shaking table at room temperature; washing with TBST for 5min for 6 times after incubation;

the red (R) is dropped on the film in the dark room, the film is soaked in the luminescent liquid for 1min, and exposed on the exposure instrument.

The expression of the marker proteins CD9 and CD63 can be successfully detected in the total exosome samples of the porcine uterine cavity fluid of 4 different periods prepared in this example, wherein fig. 1B is the Western blot detection result of the total exosome samples of the porcine uterine cavity fluid of 12 days of gestation.

(3) Identification of pig uterine cavity liquid total exosome by NTA technology

Carrying out nanoparticle tracking analysis on the porcine uterine cavity fluid total exosomes suspended in PBS by using a nanoparticle size analyzer, wherein the specific method comprises the following steps: taking a proper amount of the total exosome weight suspension of the uterine cavity fluid of the pig prepared in the step (1), further diluting the total exosome weight suspension with PBS, and adjusting the concentration to 2-6 multiplied by 10 per milliliter⁸And (4) granulating. Video recordings are made for 30s during which the analysis software tracks each visible particle. The distribution and number of particles in the sample are determined using the stokes einstein equation.

The results show that: the particle sizes of the total exosomes of the porcine uterine cavity fluid in 4 different periods are all between 30 and 150nm, wherein, figure 2 is a result analysis diagram of the sample of the total exosomes of the porcine uterine cavity fluid in 12 days of gestation.

Selection of three, 4 pig uterine cavity fluid total exosome candidate proteins in different periods

(1) The protein components and relative expression amounts of uterine cavity fluid total exosomes in estrus 9 days, gestation 12 days and gestation 15 days are identified through iTRAQ proteomics (the censorship company is the deer-Ming biological company), and the relative expression amounts of MEP1B protein in gestation 12 days and gestation 15 days are found to be higher. Thus, MEP1B was selected for functional studies.

(2) Detecting MEP1B protein expression by Western blot, and the specific method is the same as the step two (2), wherein the primary antibody is monoclonal rat MEP1B (MAB28951, R & D), and the secondary antibody is goat-resistant rat (GB23302, Servicebio);

the result of Western blot detection is shown in figure 3, and the expression of MEP1B protein in the total exosomes of the porcine uterine cavity fluid in four periods (C9, D9, D12 and D15) is highest in 15 days of pregnancy. Thus, MEP1B was selected for subsequent functional studies.

Example 2 construction of overexpression vector pDouble Ex-EGFP-MEP1B

(1) The pDuble Ex-EGFP (+) eukaryotic expression vector (purchased from Changsha Yingrun biotechnology, Inc.) is subjected to double enzyme digestion by using EcoR I and Xho I, and a specific reaction system (50 mu l) is as follows: EcoRI 2.5. mu.l, XhoI 2.5. mu.l, pDatable Ex-EGFP (+) 2.5. mu.l, FD Buffer 10. mu.l, ddH₂O32.5. mu.l; the reaction procedure is as follows: carrying out enzyme digestion for 2h at 37 ℃; detecting the enzyme digestion result by agarose gel electrophoresis with the mass volume ratio of 1.5% after enzyme digestion and recovering the target fragment;

(2) cDNA of endometrium of large white sow (provided by Wen's Sanjia and slaughter house) 12 days of gestation is extracted, and the cDNA is taken as a template, and specific upstream and downstream primers (MEP 1B-F:CCGGAATTCATGGATTCTTGGTATCTGCCTTCGT；MEP1B-R：CCGCTCGAGTCACAGTGCATATTGATTTTCCAGAGT) performing PCR amplification, wherein the amplification system comprises: cDNA template 1. mu.l, forward primer (10. mu.M): 0.5 μ l, downstream primer (10 μ M): 0.5. mu.l, 2 × Phanta Master Mix: 5 μ l of RNase-free Water 3 μ l; and (3) amplification procedure: pre-denaturation at 94 ℃ for 5 min; 30sec at 94 ℃, 30sec at 55 ℃, 1min at 72 ℃ and 40 cycles; 5min at 72 ℃ and 5min at 16 ℃; after amplification, the target fragment is recovered by agarose gel electrophoresis with the mass volume ratio of 0.8%; carrying out double enzyme digestion on 3 mu g of target fragments (the specific method is the same as the step (1)), and recovering the target fragments by agarose gel electrophoresis with the mass-volume ratio of 0.8% after enzyme digestion;

(3) connecting the target fragment obtained after enzyme digestion and recovery in the step (2) with the pDouble Ex-EGFP (+) vector obtained after enzyme digestion and recovery in the step (1) by using T4 DNA Ligase, wherein a connection system (10 mu l) is as follows: recovering the product from the target fractionMu.l of pDouble Ex-EGFP (+) product 2. mu.l, T4 DNA Ligase 1. mu.l, T4 DNA Ligase buffer 2. mu.l, ddH₂O4 mu l; the connection procedure is as follows: ligation was performed overnight at 4 ℃;

(4) the ligation product is transformed by adopting Trans5 alpha competent cells of Beijing Quanyu gold biology company, and the specific operation steps are as follows:

taking 50 mul of competent cells melted on ice bath, adding the target DNA, gently mixing uniformly, and placing in the ice bath for 30 min;

② heat shock is carried out for 45s in 42 ℃ water bath, then the heat shock is rapidly transferred into an ice bath for 2min, and the process does not need to shake a centrifuge tube;

③ adding 500 mu L of sterile LB culture medium (without antibiotic) into the centrifuge tube, mixing uniformly, putting into a shaker at 37 ℃ and 200rpm for resuscitation for 1 h;

fourthly, according to the experimental requirements, sucking a proper volume of transformed competent cells, adding the transformed competent cells to an LB agar culture medium containing the resistance to kanamycin, and uniformly spreading the cells;

placing the flat plate in an incubator at 37 ℃ for positive culture for 30min, inverting the flat plate, and culturing overnight; then, in an ultra-clean workbench, a sterilization gun head is used for picking monoclonal colonies from a resistant plate to 500 mu L of LB liquid culture medium containing kanamycin, the obtained product is placed in a constant-temperature shaking table at 37 ℃ for amplification culture for 4-6h, 1 mu L of cultured bacterial liquid is taken as a template, and specific primers (MEP 1B-F:CCGGAATTCATGGATTCTTGGTATCTGCCTTCGT；MEP1B-R：CCGCTCGAGTCACAGTGCATATTGATTTTCCAGAGT) performing PCR amplification; and (3) carrying out agarose gel electrophoresis detection after amplification, extracting endotoxin-removed plasmids according to the instruction of an Endo-free Plasmid Mini Kit II Kit of the OMGEA company after positive cloning is determined, and sucking a part of the endotoxin-removed plasmids to send the plasmids to the company for sequencing. And (3) identifying whether the sequence is correct by utilizing a BLASTn comparison sequencing result in an NCBI website, finally successfully obtaining a super-expression vector pDouble Ex-EGFP-MEP1B, and placing the super-expression vector pDouble Ex-EGFP-MEP1B in a refrigerator at the temperature of-20 ℃ for later use, wherein the nucleotide sequence of the MEP1B gene is shown as SEQ ID NO: 1.

Nucleotide sequence of MEP1B gene:

ATGGATTCTTGGTATCTGCCTTCGTTTCTGTTCGTTGCTGCCCTCCTCCTGGTTTCTGGCTTGCCAGCTCCAGAAAACTTCGACGTAGATGGTGGACTTGACCGGGATATATTTGATATCAATGAAGATTTGGGACTGGATCTTTTTGAGGGAGACATCAGTCTTGATGGGGTACAAGAAAGAAATTCCATCGTTGGAGAAGGATATAGGTGGCCTCATACTATTCCATATGTTCTAGACGATAGCTTGGAAATGAATGCCAGAGGAGTTATCCTGGAGGCATTTGAACGCTATCGCCTGAAAACATGCATTGACTTCAAGCCTTGGTCTGGAGAAGCCAACTATATATCGGTGTTCAAGGGCAGTGGCTGCTGGTCTTCAGTGGGAAATCAGCACGTTGGGAAGCAAAATCTCTCCATTGGACATAACTGTGACAGAACAGCAACCGTTCAACATGAATTTCTCCATGCACTGGGATTCTTTCATGAGCAGTCGCGATCTGACCGAGATGACTATGTCAGCATAATATGGGACAGAATTACTCCAGGCAAAGAGAACAATTTTAAAGCCTATACTGACGAAGAAACGGATTCCCTGAATGTTCCCTATGATTACAACTCAGTAATGCACTACAGTAAAACTGCATTCCAGATTGGATCAGAACCAACAATTGTGACAAGAATCTCAGACTTCATGGATGTGATCGGCCAGCGATTGGATTTCAGTGACCATGATCTCTTAAAGTTGAATCGACTCTATAACTGCTCCTCTTCCTTGAGCTTTATGGACTCGTGCGATTTTGAACTGGAAAACGTGTGTGGTATGATTCAAAGTTCAGAAGATAGTGCTGACTGGCAGCGGGTCTCCCAGGTTCCCGAGGGGCCAGAGAGCGATCACTCCAACATGGGCCAGTGCAAAGGTTCTGGCTTCTTCATGCATTTCAGCAGCAGCTCTGTAAATGTCGGGGACACAGCAGTGCTGGAAAGTAGAAAACTCTACCCCAAACGAGGTTTTCAGTGCCTGCAGTTCTTTTTATATAACAGTGGACATGAAAATGACCAGCTGGACATCTATATCCGGGAGTATTCTGGAGACAATGTGAACGGTATTCTAATCCTTGTGGAAGAAATAAAAGATATACCCCTTGGGAGCTGGCAGCTTTACCACGTTACATTGAAGGTGACCAACAAATTTAGAGTAGTGTTTAGAGGGGTCAGAGGTGCTGGTGACTCACTGGGTGGCCTGTCTATCGATGACATCAATCTTTCAGAAACACAGTGCCCTCATCATACCTGGCACATAAGGAATTTCACACAGTACCTTAGCGACCCCAATGGAGCTCTGTTTAGCCCTCCATTTTATTCGTCTAAAGGTTATGCCTTTCAGATTTACATGACCCTAACCAATTTGACTAAGATAGGAATTTATTTCCACTTGATCTCTGGAGCCAATGATGATCAGTTACAGTGGCCGTGTCCTTGGCAACAAGCCACGATGACAATCTTGGATCAGAATCCTGACATTCGACAGCGTATGTCCAACGGGCGGAGTATAACCACAGACCCCTCTTTGACCTCGGATGACGGAACCTATTTTTGGGACAGGCCTTCCAAAGTGGGAACAGAAGCTTTTTTCCCAAATGGAACTCAATTTAAAAGAAGTAGAGGCTATGGATCCAGTTCCTTTATAACCTATGAGAGGCTGAAGAGCAGGGATTTTATCAAAGGAAATGATGTTTACATCCTACTGACAGTGGAAGACATATCCCACCTTAATTCTACACAAGACGAACCAGTCCCAACCTCAAGTGTCAGTGACCTTTGCGCATTCTTCAGGTGTGAGAATGATGGCATCTGCCTTGTCCGAAATGGCAACGCCGAGTGCAGGTGTCCCTCAGGGGAAGACTGGTGGTACATGGGGAAAAGGTGTGAAAAGAGAGGCTCCAGGAGAGACACCATTGTCATCGCCACTTCTTCCACTGCTGCCGTGTTCGCCCTGATGCTGGTCATCACCCTTGTCAGTGTCTACTGTACCCGGAAGAAGTATCGTAAAGAGCCAGGTTCACATACAGCAAATACGACTCTGGAAAATCAATATGCACTGTGA

example 3 design and Synthesis of MEP1B Gene siRNA

Firstly, the CDS region Sequence of the pig MEP1B gene (NCBI Reference Sequence: XM _003127883.5) is searched at the NCBI website of national institute of Biotechnology in America (http:// www.ncbi.nlm.nih.gov /), 3 pairs of siRNA are designed aiming at different target sites of the pig MEP1B gene by using BlOCK-iTRNAiDesigner software (http:// rnaidesigner. thermofisher. com/rnaiexpress/sort. do), and negative control siRNA-NC (Sequence is shown in Table 1) is designed, and the Sequence is synthesized by Suzhou Jima gene GmbH.

TABLE 1 pig MEP1B Gene siRNA sequences

Cell transfection of two, three pairs of siRNA and NC interfering fragments

(1) The separation method of the porcine endometrial epithelial cells comprises the following steps: picking fresh uterus (not pregnant) of a large white sow, cutting the uterus in a super clean bench, and taking endometrium; washing the collected endometrial tissue with PBS once, and cutting into 1mm³Washing the small blocks with PBS once, centrifuging for 5min at 500g, and removing the supernatant; adding collagenase I with a concentration of 0.1mg/ml and a volume which is 2 times that of the precipitate, digesting for 2.5 hours, and shaking for several times every 30 min; adding an equal volume of culture solution to stop digestion; sieving cells (100 mesh cell sieve), centrifuging at 500g for 5min, collecting supernatant, precipitating to obtain porcine endometrium epithelial cells, adding culture medium (79% F12+ 20% FBS + 1% double antibody), and changing solution after 24 hr;

(2) one day before transfection, well-formed and vigorously growing porcine endometrial epithelial cells were inoculated into 6-well cell culture dishes at 37 ℃ and 5% CO₂Culturing in an incubator, and transfecting according to a transfection system shown in the table 2 when the density of the cells reaches 70-80%; the specific transfection method is as follows:

TABLE 2 siRNA transfection System

Diluting 9 mu L of RNAiMAXReagent reagent by 150 mu L of Opti-DEETM culture medium and fully mixing;

diluting 3 mu L of siRNA (30pmol) interference fragment by 150 mu L of Opti-DEETM culture medium to prepare a premixed solution, and fully and uniformly mixing;

mixing the liquid in the second step uniformly according to the volume ratio of 1:1, and incubating for 5min at room temperature;

fourthly, the mixed liquid in the third step is added into the cell culture hole, is shaken up gently and is placed at 37 ℃ and 5 percent CO₂Culturing in an incubator;

fifthly, after culturing for 4-6h, absorbing and removing the transfection mixed solution, and adding a complete culture medium for continuous culture.

(3) After culturing for 48h, carrying out qPCR experiment, wherein the used target gene primers (MEP 1B-F: CTGCCGTGTTCGCCCTGATG; MEP 1B-R: TGCTGTATGTGAACCTGGCTCTTTAC) and reference gene primers beta-actin (F: CCACGAGACCACCTTCAACTC; R: TGATCTCCTTCTGCATCCTGT) comprise the following fluorescent quantitative PCR system: 1 mu L of cDNA template; the upstream and downstream primers were 0.5. mu.L, respectively; green qPCR SuperMix 5. mu.L; 3 mu L of RNase-free Water; the fluorescent quantitative PCR program comprises: pre-denaturation at 94 ℃ for 30 sec; 94 ℃ 5sec, 60 ℃ 30sec, 40 cycles; 94 ℃ for 15sec, 60 ℃ for 1min and 94 ℃ for 15 sec.

As shown in FIG. 4, after transfection of three pairs of siRNA and NC interfering fragments into endometrial epithelial cells, siRNA-MEP1B-2 was found to interfere with the expression of MEP1B gene most efficiently, and therefore, the experiment of example 5 was performed using siRNA-MEP 1B-2.

Example 4 Effect of MEP1B Gene overexpression vector pDouble Ex-EGFP-MEP1B in proliferation of porcine endometrial epithelial cells

Cell transfection of overexpression vector pDouble Ex-EGFP-MEP1B

(1) One day before transfection, well-formed and vigorously growing porcine endometrial epithelial cells were inoculated into a cell culture dish at 37 ℃ and 5% CO₂Is cultured in an incubator until the density of the cellsWhen 70-80% of the total amount of the plasmid reaches the amount of the plasmid, the plasmid pDouble Ex-EGFP-MEP1B prepared in example 2 is transfected according to the transfection system in Table 3, and the plasmid pDouble Ex-EGFP is transfected in the control group; the specific transfection method is as follows:

TABLE 3 overexpression vector transfection System

[ solution ] Lipofectamine available from Invitrogen corporation was diluted with Opti-DEETM medium^TM3000, mixing the reagents, and standing for 5min at room temperature;

② preparing a premix by diluting pDouble Ex-EGFP-MEP1B with Opti-DEETM medium, and then adding P3000^TMMixing the reagents, and standing at room temperature for 5 min;

thirdly, liquid in the second step is mixed according to the volume ratio of 1:1, uniformly mixing, and incubating for 15min at room temperature;

fourthly, the mixed liquid in the third step is added into the cell culture hole, is shaken up gently and is placed at 37 ℃ and 5 percent CO₂Culturing in an incubator;

fifthly, after culturing for 4-6h, absorbing and removing the transfection mixed solution, and adding a complete culture medium for continuous culture.

(2) CCK8 detection of cell proliferation

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 5X 10 per well³The amount of (A) was inoculated in a 96-well plate at 37 ℃ with 5% CO₂The culture chamber is cultured, when the cell density reaches 70-80%, 0.2. mu.g pDecuble Ex-EGFP-MEP1B is transfected (same as the step (1)), and CCK8 reagent is added at 37 ℃ and 5% CO 24h after transfection₂The incubation was carried out for 2h and the absorbance at 450nm was measured with a microplate reader.

The results are shown in FIG. 5, the cellular absorbance of the group transfected with pDouble Ex-EGFP-MEP1B is higher than that of the control group (P < 0.05), which indicates that the up-regulation of MEP1B protein promotes the proliferation of porcine endometrial epithelial cells.

(3) ki67 detection of proliferative proteins

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 3X 10 per well⁴The amount of (2) was inoculated in a 6-well plateAt 37 ℃ and 5% CO₂The culture chamber of (1), when the cell density reaches 70-80%, transfecting 5 ug pDouble Ex-EGFP-MEP1B (same as the step (1)), and detecting the expression of MEP1B protein and ki67 protein by Western Blot 72h later, wherein the expression of MEP1B protein: the primary antibody is monoclonal rat MEP1B (MAB28951, R)&D) The secondary antibody is goat-resistant rat (GB23302, Servicebio); ki67 protein: the primary antibody is rabbit monoclonal antibody ki67(ab92742, abcam), and the secondary antibody is goat anti-rabbit (GB23303, Servicebio).

The results are shown in FIG. 6, and the expression of MEP1B protein and cell proliferation protein ki67 protein of the transfected pDouble Ex-EGFP-MEP1B group cells is higher than that of the control group (P < 0.05), which indicates that the expression of MEP1B gene is up-regulated to promote the proliferation of the porcine endometrial epithelial cells.

(4) Regulation and control of porcine endometrial epithelial cell cycle by overexpression vector pDouble Ex-EGFP-MEP1B

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 3X 10 per well⁴The amount of (A) was inoculated in a 6-well plate at 37 ℃ with 5% CO₂When the density of the cells reaches 70-80%, 5 mu g of pDouble Ex-EGFP-MEP1B is transfected (the method is the same as the step (1)), digested endometrial epithelial cells are fixed by alcohol with the volume fraction of 70% after 72h of transfection, then the fixed cells are stained by pi staining solution, and the staining is carried out by an up-flow cytometer within half an hour.

The results are shown in FIG. 7, the S-phase positive rate of the cells of the group transfected with pDouble Ex-EGFP-MEP1B is higher than that of the control group (P < 0.05), which indicates that the up-regulation of the expression of MEP1B gene promotes the S-phase increase of the endometrial epithelial cells of the pigs.

The overexpression results generally indicate that the overexpression of MEP1B promotes the growth of porcine endometrial epithelial cells.

Example 5 inhibition of proliferation of porcine endometrial epithelial cells by siRNA after expression of MEP1B Gene

(1) Cell transfection of siRNA interfering fragments

One day before transfection, well-formed and vigorously growing porcine endometrial epithelial cells were inoculated into a cell culture dish at 37 ℃ and 5% CO₂Cultured in an incubator to treat the cellsWhen the density of the cells reaches 70-80%, the transfection is carried out, and the transfection system is shown in table 2; the transfection method is as follows:

firstly, diluting an RNAiMAXReagent reagent by using an Opti-DEETM culture medium and fully and uniformly mixing;

using Opti-DEMETM culture medium to dilute siRNA-MEP1B-2(30pmol) interference fragment to prepare premixed solution and fully mixing the premixed solution and the solution;

mixing the liquid in the second step uniformly according to the volume ratio of 1:1, and incubating for 5min at room temperature;

fourthly, the mixed liquid in the third step is added into the cell culture hole, is shaken up gently and is placed at 37 ℃ and 5 percent CO₂Culturing in an incubator;

fifthly, after culturing for 4-6h, absorbing and removing the transfection mixed solution, and adding a complete culture medium for continuous culture.

(2) CCK8 detection of cell proliferation

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 5X 10 per well³The amount of (A) was inoculated in a 96-well plate at 37 ℃ with 5% CO₂The cells were cultured in the incubator, and when the cell density reached 70-80%, transfection was carried out with 5pmol of siRNA-MEP1B-2 and siRNA-NC (same procedure as in step (1)), and 24 hours after transfection, CCK8 reagent was added at 37 ℃ and 5% CO₂The incubation was carried out for 2h and the absorbance at 450nm was measured with a microplate reader.

The results are shown in FIG. 8, where the cellular absorbance of the transfected si-MEP1B-2 group is lower than that of the control group (P < 0.01), indicating that interfering with the expression of MEP1B gene inhibits the proliferation of porcine endometrial epithelial cells.

(3) ki67 detection of proliferative proteins

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 3X 10 per well⁴The amount of (A) was inoculated in a 6-well plate at 37 ℃ with 5% CO₂The cells were cultured in the incubator, and when the cell density reached 70-80%, 30pmol of siRNA-MEP1B-2 and siRNA-NC was transfected, and the expression of MEP1B protein and ki67 protein was examined by Western Blot 72 hours after transfection (the same antibody as in example 4).

As shown in FIG. 9, the expression of MEP1B protein and ki67 protein in the transfected si-MEP1B-2 group cells was lower than that in the control group (P)_(MEP1B)＜0.01；P_(ki67)< 0.05), indicating an interfering MEPThe expression of the 1B gene inhibits the proliferation of the porcine endometrial epithelial cells.

(4) Regulation of cell cycle of porcine endometrial epithelial cells by siRNA interfering fragments

Prior to the experiment, the porcine endometrial epithelial cells were plated at approximately 3X 10 per well⁴The amount of (A) was inoculated in a 6-well plate at 37 ℃ with 5% CO₂The cells are cultured in an incubator, transfection is carried out when the density of the cells reaches 70-80%, 30pmol of siRNA-MEP1B-2 and siRNA-NC is transfected, digested endometrial epithelial cells are fixed by alcohol with the volume fraction of 70% after transfection for 72h, then the fixed cells are stained by pi staining solution, and the staining is carried out on an up-flow cytometer within half an hour.

The results are shown in FIG. 10, the S phase positivity of the cells in the group transfected with siRNA interfering fragment is lower than that in the control group (p < 0.05), which indicates that the S phase growth of the porcine endometrial epithelial cells is inhibited by the expression of interfering MEP1B gene.

The above silencing results generally indicate that silencing MEP1B inhibits growth of porcine endometrial epithelial cells.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

Application of MEP1B gene in preparation of products for detecting or regulating endometrial development

<130> 1

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 2106

<212> DNA

<213> Artificial

<220>

<223> nucleotide sequence of MEP1B Gene

<400> 1

atggattctt ggtatctgcc ttcgtttctg ttcgttgctg ccctcctcct ggtttctggc 60

ttgccagctc cagaaaactt cgacgtagat ggtggacttg accgggatat atttgatatc 120

aatgaagatt tgggactgga tctttttgag ggagacatca gtcttgatgg ggtacaagaa 180

agaaattcca tcgttggaga aggatatagg tggcctcata ctattccata tgttctagac 240

gatagcttgg aaatgaatgc cagaggagtt atcctggagg catttgaacg ctatcgcctg 300

aaaacatgca ttgacttcaa gccttggtct ggagaagcca actatatatc ggtgttcaag 360

ggcagtggct gctggtcttc agtgggaaat cagcacgttg ggaagcaaaa tctctccatt 420

ggacataact gtgacagaac agcaaccgtt caacatgaat ttctccatgc actgggattc 480

tttcatgagc agtcgcgatc tgaccgagat gactatgtca gcataatatg ggacagaatt 540

actccaggca aagagaacaa ttttaaagcc tatactgacg aagaaacgga ttccctgaat 600

gttccctatg attacaactc agtaatgcac tacagtaaaa ctgcattcca gattggatca 660

gaaccaacaa ttgtgacaag aatctcagac ttcatggatg tgatcggcca gcgattggat 720

ttcagtgacc atgatctctt aaagttgaat cgactctata actgctcctc ttccttgagc 780

tttatggact cgtgcgattt tgaactggaa aacgtgtgtg gtatgattca aagttcagaa 840

gatagtgctg actggcagcg ggtctcccag gttcccgagg ggccagagag cgatcactcc 900

aacatgggcc agtgcaaagg ttctggcttc ttcatgcatt tcagcagcag ctctgtaaat 960

gtcggggaca cagcagtgct ggaaagtaga aaactctacc ccaaacgagg ttttcagtgc 1020

ctgcagttct ttttatataa cagtggacat gaaaatgacc agctggacat ctatatccgg 1080

gagtattctg gagacaatgt gaacggtatt ctaatccttg tggaagaaat aaaagatata 1140

ccccttggga gctggcagct ttaccacgtt acattgaagg tgaccaacaa atttagagta 1200

gtgtttagag gggtcagagg tgctggtgac tcactgggtg gcctgtctat cgatgacatc 1260

aatctttcag aaacacagtg ccctcatcat acctggcaca taaggaattt cacacagtac 1320

cttagcgacc ccaatggagc tctgtttagc cctccatttt attcgtctaa aggttatgcc 1380

tttcagattt acatgaccct aaccaatttg actaagatag gaatttattt ccacttgatc 1440

tctggagcca atgatgatca gttacagtgg ccgtgtcctt ggcaacaagc cacgatgaca 1500

atcttggatc agaatcctga cattcgacag cgtatgtcca acgggcggag tataaccaca 1560

gacccctctt tgacctcgga tgacggaacc tatttttggg acaggccttc caaagtggga 1620

acagaagctt ttttcccaaa tggaactcaa tttaaaagaa gtagaggcta tggatccagt 1680

tcctttataa cctatgagag gctgaagagc agggatttta tcaaaggaaa tgatgtttac 1740

atcctactga cagtggaaga catatcccac cttaattcta cacaagacga accagtccca 1800

acctcaagtg tcagtgacct ttgcgcattc ttcaggtgtg agaatgatgg catctgcctt 1860

gtccgaaatg gcaacgccga gtgcaggtgt ccctcagggg aagactggtg gtacatgggg 1920

aaaaggtgtg aaaagagagg ctccaggaga gacaccattg tcatcgccac ttcttccact 1980

gctgccgtgt tcgccctgat gctggtcatc acccttgtca gtgtctactg tacccggaag 2040

aagtatcgta aagagccagg ttcacataca gcaaatacga ctctggaaaa tcaatatgca 2100

ctgtga 2106

<210> 2

<211> 33

<212> DNA

<213> Artificial

<220>

<223> MEP1B-F

<400> 2

ccggaattca tggattcttg gtatctgcct tcg 33

<210> 3

<211> 36

<212> DNA

<213> Artificial

<220>

<223> MEP1B-R

<400> 3

ccgctcgagt cacagtgcat attgattttc cagagt 36

<210> 4

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-1-sense

<400> 4

gggaguauuc uggagacaat t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-1-antisense

<400> 5

uugucuccag aauacuccct t 21

<210> 6

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-2-sense

<400> 6

ccuggcacau aaggaauuut t 21

<210> 7

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-2-antisense

<400> 7

aaauuccuua ugugccaggt t 21

<210> 8

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-3-sense

<400> 8

gcaucugccu uguccgaaat t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-MEP1B-3-antisense

<400> 9

uuucggacaa ggcagaugct t 21

<210> 10

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-NC-sense

<400> 10

uucuccgaac gugucacgut t 21

<210> 11

<211> 21

<212> DNA

<213> Artificial

<220>

<223> siRNA-NC-antisense

<400> 11

acgugacacg uucggagaat t 21

<210> 12

<211> 20

<212> DNA

<213> Artificial

<220>

<223> MEP1B-F(qPCR)

<400> 12

ctgccgtgtt cgccctgatg 20

<210> 13

<211> 26

<212> DNA

<213> Artificial

<220>

<223> MEP1B-R(qPCR)

<400> 13

tgctgtatgt gaacctggct ctttac 26

<210> 14

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-actin-F

<400> 14

ccacgagacc accttcaact c 21

<210> 15

<211> 21

<212> DNA

<213> Artificial

<220>

<223> β-actin-R

<400> 15

tgatctcctt ctgcatcctg t 21