阅读说明：本技术 乌苯苷在制备下调肿瘤细胞pd-l1水平的制剂中的应用 (Application of ubenioside in preparation of preparation for reducing tumor cell PD-L1 level ) 是由 刘相国 苏玲 李晓鹏 孙庆国 王莹莹 于 2021-09-03 设计创作，主要内容包括：本发明公开了一种乌苯苷在制备下调肿瘤细胞PD-L1水平的制剂中的应用,其中有效下调肿瘤细胞PD-L1水平的乌苯苷的浓度为100～200nmol/L。本发明证明了乌苯苷可以通过改变细胞质中Ca～(2+)稳态来诱导肿瘤细胞产生内质网应激,干扰PD-L1正常的糖基化修饰。内质网应激后,PD-L1进而被RNF19B识别并进行泛素化,最终导向蛋白酶体降解。本发明还揭示RNF19B会影响USP22与PD-L1的结合,减弱PD-L1在肿瘤细胞内的稳定性。本发明的应用实现了通过下调肿瘤中的PD-L1水平抑制肿瘤的发展,为研制开发有关制备下调肿瘤细胞PD-L1水平的制剂奠定了基础,也为传统药物在肿瘤治疗领域中的二次开发提供了一定的参考和启示,为提高免肿瘤疫疗法的技术手段和临床疗效提供了新的策略。(The invention discloses an application of ubenioside in preparation of a preparation for reducing the level of tumor cells PD-L1, wherein the concentration of ubenioside for effectively reducing the level of tumor cells PD-L1 is 100-200 nmol/L. The invention proves that the ubenioside can change Ca in cytoplasm 2+ Homeostasis to induce endoplasmic reticulum stress in tumor cells, interfering with the normal glycosylation modification of PD-L1. Following endoplasmic reticulum stress, PD-L1 is further recognized by RNF19B and ubiquitinated, ultimately leading to proteasomal degradation. The invention also discloses that RNF19B can affect the combination of USP22 and PD-L1, and the stability of PD-L1 in tumor cells is weakened. The application of the invention realizes the inhibition of the development of the tumor by down-regulating the PD-L1 level in the tumor, lays a foundation for the research and development of the preparation for down-regulating the PD-L1 level of the tumor cells, and also lays a foundation for the traditional methodThe secondary development of the medicine in the field of tumor treatment provides certain reference and inspiration, and a new strategy is provided for improving the technical means and the clinical curative effect of the tumor-immune therapy.)

1. Application of ubenioside in preparing a preparation for reducing the level of tumor cells PD-L1 is provided.

2. Use according to claim 1, characterized in that: the concentration of the ubenioside which effectively reduces the level of the tumor cells PD-L1 is 100-200 nmol/L; the tumor is a tumor with high expression of PD-L1 receptor naturally or with high expression of PD-L1 receptor caused by tumor treatment.

3. Use according to claim 2, characterized in that: the concentration of the ubenioside which effectively reduces the level of the tumor cells PD-L1 is 200 nmol/L; the tumor is non-small cell lung cancer.

Technical Field

The invention relates to application of sodium-potassium ATPase inhibitor ubenioside, in particular to application of ubenioside in preparation of a preparation for regulating the level of tumor cells PD-L1(Programmed Cell Death 1Ligand 1, also called CD274 or B7-H1), and belongs to the technical field of biological medicine and molecular biology.

Background

PD-L1 is a glycoprotein present in the plasma membrane of tumor cells, and inhibits the proliferation of T cells, the release of cytokines and the killing ability by binding to PD-1(Programmed Death Receptor 1) on the surface of T lymphocytes, ultimately resulting in the inhibition of immune system function. Clinical trials currently underway or already conducted on the PD-1/PD-L1 pathway have reported that good results are obtained in the clinical diagnosis and treatment of certain cancers, such as melanoma, non-small cell lung cancer, bladder cancer, breast cancer, lymphoma and renal cell carcinoma. Currently, monoclonal antibodies such as pembrolizumab, nivolumab, pidilizumab, durvalumab and atezolizumab are mainly used as related drugs on the market. However, as the tumor immunotherapy is further developed, the use efficiency is not satisfactory, and off-target effects, drug resistance and potential toxic side effects are successively appeared.

The natural small molecular compound is always a medicine source for treating key diseases such as cancer, and the small molecular compound with anti-cancer activity is searched by screening medicines, so that the natural small molecular compound has the characteristics of quickness, economy, simplicity, convenience and effectiveness. The natural active compound can also be used as a lead substance and is expected to become a new generation of tumor immunotherapy medicine through proper structural modification. Therefore, the search for natural small molecule compounds capable of down-regulating the expression of PD-L1 in tumor cells is also a current topic of intense research and development.

Ubenioside is a steroid glycoside, also known as g-Convolvulus glycoside. Used as cardiotonic. Ubenioside has been used to study specific inhibitors of sodium-potassium ATPase (k-curoside is also effective), and its cardiotonic effect is based on this inhibition. Ubenilin is widely existed in nature as cardiac glycoside compound, and is mainly used in clinicCan be used for treating heart failure and arrhythmia. The common cardiac glycosides mainly include digoxin, ubenioside, oleandrin and bufalin. The acting site of cardiac glycoside is Na on plasma membrane⁺-K⁺-atpase (nka). The relevant experiments on the ubenioside show that the ubenioside has certain influence on the body immunity.

The ubenioside can activate immune cells and improve the ability of the immune cells to resist apoptosis, so as to eliminate immunosuppression generated by cancer cells. However, the relevant influence of the ubenioside on PD-L1 in tumor cells is not reported at present through search.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide the application of the ubenioside in preparing the preparation for down-regulating the level of tumor cells PD-L1.

The invention relates to an application of ubenioside in preparing a preparation for regulating the level of tumor cells PD-L1.

Wherein: the concentration of the ubenioside which can effectively reduce the level of the tumor cell PD-L1 is 100-200 nmol/L. The tumor is a tumor with high expression of PD-L1 receptor naturally or with high expression of PD-L1 receptor caused by tumor treatment.

Preferably, the concentration of ubeniside effective to down-regulate the level of PD-L1 in tumor cells is 200 nmol/L. The tumor is non-small cell lung cancer.

The invention provides a regulation and control mode aiming at PD-L1 ubiquitination, which is helpful for further understanding the molecular mechanism related to PD-L1 and provides a theoretical basis for designing related medicaments.

The invention discloses the potential of the ubenioside in the anti-tumor immune response, and provides certain reference and inspiration for the secondary development of the traditional medicine in the tumor treatment field.

In order to better understand the essence of the invention, biochemical and cell experiments and results of ubeniside are used below to illustrate the application of ubeniside in preparing preparations for down-regulating the PD-L1 level of tumor cells and related researches.

The following experiments were carried out using biochemical, cell biological and molecular biological methods:

1. the ubeniside down-regulates the protein level of lung cancer cell PD-L1 and shows obvious concentration and time dependence

N-linked glycosylation is one of the most important modes of post-translational modification of PD-L1, and the immature, non-glycosylated form of PD-L1 is extremely unstable and is degraded by recognition by the relevant protein degradation systems in the cell. The sugar chain structure on the PD-L1 molecule can obviously enhance the binding of PD-L1 to PD-1 on the surface of T cells, and the increase of the affinity can also improve the efficiency of the immune escape of tumor cells.

Mixing 1.0X 10⁵H157 cells per ml were seeded in 12-well cell culture plates, after the number of cells increased to about 60%, various concentrations of ubenidin (Ouabain) were added for treatment, and 24 hours later, the cell status was observed and cells were collected, and the levels of glycosylated and non-glycosylated PD-L1 protein were measured by Western blot.

In H1792, H1299, H460 and A549, the culture was continued for 12H after treating the cells with different concentrations of ubeniside, and the PD-L1 and USP22 protein levels were detected by Western blot. (USP22 is a deubiquitinase that maintains stable expression of PD-L1 molecules in cells). PD-L1 and USP22 protein levels were measured by Western blot after H157 and H460 were treated with 200nmol/L of ubenioside for various times.

In H1792 and A549, after treating with 200nmol/L ubenioside for 12H, extracting total RNA for reverse transcription to obtain cDNA, performing PCR amplification on the gene sequence of PD-L1 by using the obtained cDNA as a template and upstream and downstream primers designed from PD-L1 gene, and performing 1% agarose gel electrophoresis to detect the transcription condition of PD-L1.

The results show that: (1) the gradual decrease in glycosylation of PD-L1 accompanied by an increase in non-glycosylated PD-L1 with an increase in the treatment concentration of ubeniside indicates that ubeniside interferes with the normal synthesis of PD-L1 (fig. 8). (2) The downregulation of PD-L1 by ubeniside showed concentration-dependent effects in H460, a549, H1792 and H1299, and in H157 and H460, the effect of ubeniside on PD-L1 was also time-dependent (fig. 1A, 1B). (3) There was no trend in the transcript level of PD-L1 after the treatment with ubenioside (FIG. 1C), indicating that the effect of ubenioside on PD-L1 did not occur at the transcript level.

2. The ubenioside can be obtained by changing Ca in cytoplasm²⁺Homeostatic induction of endoplasmic reticulum stress in tumor cells, and the down-regulation of PD-L1 by ubenioside depends on a proteasome pathway rather than a lysosomal pathway

The regulation of PD-L1 by the hexamidine is not at the transcriptional level, so that the down-regulation of PD-L1 only has the possibility of causing problems in the translation or post-translation process, and the non-glycosylated form of PD-L1 is obviously increased under the hexamidine treatment, which indicates that the synthesis of PD-L1 in the endoplasmic reticulum has problems. CHOP or p-eIF2 alpha is a marker protein of endoplasmic reticulum Stress (ER Stress), and changes of CHOP of the marker protein of ER Stress are detected by Western blot after treatment in H460 and A549 by using ubenioside with concentrations of 0, 100 and 200 nmol/L. After 1 mol/L4-PBA (4-PBA is a common ER Stress inhibitor) is used for pretreatment in H460 and A549 for 1H, 200nmol/L ubenioside is added for continuous treatment for 12H. Changes in PD-L1, CHOP and p-eIF2 alpha were detected by Western blot after 12 h. The ouabain acts on Na + -K + -ATPase on plasma membrane, and Na + -K + -ATPase is involved in multiple functions of causing Ca in cytoplasm²⁺A signal path that rises horizontally. In the A549 and H1792 cell lines, 10. mu. mol/L (Ca) was added²⁺Chelating agent) BAPTA/AM pretreatment for 1h, then adding 200nmol/L ubenioside, continuing culturing for 12h, and detecting the levels of marker proteins CHOP of PD-L1 and ER Stress by Western blot.

Treatment with 20 μmol/L proteasome inhibitor MG132 and 15 μmol/L lysosomal inhibitor CQ blocked the respective degradation pathways in both a549 and H1792 lung cancer cell lines, respectively. After 200nmol/L of ubenioside is treated for 4h, MG132 and CQ are added respectively, and then culture is continued for 8 h. The cells were harvested and the levels of PD-L1 and ACTB were measured by Western blot, and the pathways on which ubeniside is dependent for down-regulation of PD-L1 were examined.

The results show that: (1) with the increase of the treatment concentration of the ubenioside, the protein content of CHOP or p-eIF2 alpha in tumor cells is increased, and after the treatment of 4-PBA, the production of ER Stress mediated by the ubenioside is prevented to a certain extent, and the ubenioside is prevented from reducing the intensity of PD-L1 (FIGS. 2A and 2B). Using Ca²⁺The chelating agent BAPTA/AM and the ubeniside are simultaneously treatedThe rise of the endoplasmic reticulum stress marker CHOP of the parenchyma cells is inhibited, and the content of PD-L1 is reduced (FIG. 2C). Indicating that ubeniside can break Ca²⁺The balance of (a) and (b) allows tumor cells to be under endoplasmic reticulum stress, interfering with the synthesis of PD-L1. (2) Treatment with proteasome inhibitor MG132 inhibited ubenioside-induced PD-L1 down-regulation, whereas the combined use of lysosomal inhibitor CQ showed no significant change compared to treatment with ubenioside alone (fig. 2D), indicating that ubenioside down-regulation of PD-L1 was dependent on the proteasome pathway rather than the lysosomal pathway.

3. RNF19B interacting with PD-L1

Since the glycosylation of PD-L1 is important for its protein stability, two plasmids were constructed in this application for PD-L1, one being pcDNA3.1-FLAG-PD-L1, which expresses the normally glycosylated form of PD-L1; the other is pcDNA3.1-FLAG-PD-L1(3NQ), which mutates the three major glycosylation sites (N192, N200 and N219) of PD-L1, rendering it unable to be normally glycosylated and eventually present in the endoplasmic reticulum in an immature, non-glycosylated form. The mediation of PD-L1 by ubeniside is accomplished via the proteasome pathway. Degradation of proteins usually requires the addition of E3 Ligase, and RNF19B is an E3 Ligase. Plasmids pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-V5-RNF19B were overexpressed in HEK293FT cells, and Co-IP experiments were performed using FLAG protein antibodies. The binding of RNF19B to PD-L1(WT) and PD-L1(3NQ) was examined by Western blot. Plasmids expressing pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-FLAG-PD-L1(3NQ) in H1299 were subjected to CO-IP experiments by using FLAG antibodies, and the binding of the endogenous protein RNF19B to the two forms of PD-L1 was detected by Western blot.

The results show that: RNF19B interacts with both glycosylated and non-glycosylated PD-L1 (fig. 3A, 3B). In addition, it was confirmed by Co-IP experiments that RNF19B binds to endogenous PD-L1 (FIG. 3C).

4. RNF19B affects PD-L1 protein levels

RNF19B is over-expressed in A549 and H1792, 200nmol/L of ubenioside is added into the cells before the cells are collected for 12H, the cells are treated for 12H, and the expression conditions of PD-L1, CHOP and ACTB are detected by Western blot. In A549 and H1792, siRNA of RNF19B is used for interfering the expression of RNF19B, 200nmol/L ubenioside is used for treating for 12H, and the expression conditions of PD-L1, RNF19B, CHOP and ACTB are detected by Western blot.

The results show that: after the endoplasmic reticulum stress is induced by using the ubenioside in A549 and H1792 cells and RNF19B is over-expressed, the degradation of PD-L1 is accelerated, the total amount of PD-L1 in cancer cells is obviously reduced (figure 4A), and the strength of PD-L1 reduction caused by the ubenioside is inhibited after the siRNA of RNF19B is used for interfering RNF19B (figures 4B and 4C). Indicating that RNF19B affects PD-L1 protein levels.

5. RNF19B under treatment of ubenicoside enhances ubiquitination of PD-L1, and RNF19B has strong affinity and ubiquitination level to non-glycosylated PD-L1

pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB were overexpressed in H1299, Co-IP experiments were performed, and the ubiquitination levels of glycosylated and unglycosylated PD-L1 were examined by Western blot. pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ) were overexpressed in H1299 and A549, while pcDNA3.1-HA-UB was treated with 200nmol/L of ubenidin for 12H, and Co-IP experiments were performed to detect the ubiquitination levels of glycosylated and non-glycosylated PD-L1 by Western blot.

pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB plasmids were transfected into H1299 and H1792 cells, and Co-IP experiments were performed to detect the binding of RNF19B to both forms of PD-L1 and the level of ubiquitination by Western blot. pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB are transfected into H1299 cells, after pretreatment is carried out for 30min by using 1 mmol/L4-PBA (inhibitor of ER Stress), 200nmol/L ubenioside is added for continuous treatment for 12H, 20 mu mol/L MG132 is added for treatment before 8H of collecting cells, the cells are collected for Co-IP experiment, and the ubiquitination level of non-glycosylated PD-L1 by RNF19B is detected by Western blot. pcDNA3.1-V5-RNF19B and pcDNA3.1-FLAG-PD-L1(3NQ) plasmids are transfected in H1299, cells are fixed after being cultured overnight, immunofluorescence staining is carried out, and the co-location condition of the two is observed by photographing under a laser co-focusing microscope.

The results show that: (1) RNF19B enhanced ubiquitination of PD-L1 under treatment with ubenioside. After overexpression of RNF19B and simultaneous induction of ER Stress with ubenioside, RNF19B promoted ubiquitination of both glycosylated and non-glycosylated forms of PD-L1 (FIGS. 5B, 5C). If no treatment with ubeniside was used, mere overexpression of RNF19B had a relatively small effect on ubiquitination of both forms of PD-L1 (FIG. 5A). The result shows that RNF19B is E3 ubiquitin ligase of PD-L1, and RNF19B participates in the ubiquitination process of PD-L1 in the process of ubenicoside-mediated reduction of PD-L1. (2) RNF19B has a strong affinity for non-glycosylated PD-L1 and a strong level of ubiquitination. (FIGS. 5D and 5E). Using immunofluorescence confocal technology, co-localization between non-glycosylated PD-L1 and RNF19B was observed (FIG. 5G), indicating that the regulation of PD-L1 by RNF19B is mainly performed in cytoplasm on one hand, and the process is mainly ubiquitination recognition and degradation of immature PD-L1 by RNF 19B. (3) When the cells were treated with the inhibitor 4-PBA of ER Stress, the ubiquitin level of non-glycosylated PD-L1 was also significantly reduced by RNF19B after the inhibition of ER Stress (FIG. 5F), indicating that PD-L1 was ubiquitinated by RNF19B after ER Stress was initiated by ubenin.

6. RNF19B binds to cytoplasmic fragment of PD-L1 through its (252-732) structural region (its nucleotide sequence is shown in SEQ ID No.8)

In the present application, several fragments of RNF19B (FIG. 6E) were designed and constructed with respect to the structural characteristics thereof, namely 5 fragment plasmids of RNF19B (1-167) (the nucleotide sequence thereof is shown in SEQ ID No.5), RNF19B (1-252) (the nucleotide sequence thereof is shown in SEQ ID No.6), RNF19B (167-732) (the nucleotide sequence thereof is shown in SEQ ID No.7), RNF19B (252-732) (the nucleotide sequence thereof is shown in SEQ ID No.8), RNF19B (319-732) (the nucleotide sequence thereof is shown in SEQ ID No.9), and the fragment form of PD-L1 was also constructed: the full length pEGFPC2-PD-L1, the extracellular and transmembrane region pEGFPC2-PD-L1(1-259) (the nucleotide sequence of which is shown in SEQ ID No.2), and the transmembrane and intracellular region pEGFPC2-PD-L1(239-290) (the nucleotide sequence of which is shown in SEQ ID No. 3). pcDNA3.1-V5-RNF19B, pEGFPC2-PD-L1, pEGFPC2-PD-L1(1-259) and pEGFPC2-PD-L1(239-290) plasmids were transfected into HEK293FT cells, the cells were collected after treatment for 6h with 20. mu. mol/L MG132, and Co-IP experiments were performed to detect the binding of RNF19B to the PD-L1 fragment by Western blot.

Five segmented plasmids of RNF19B and plasmids of PD-L1(WT)/PD-L1(3NQ) were transfected into HEK293FT cells, and 20. mu. mol/L of MG132 was added 6h before the cells were harvested to perform a Co-IP assay to detect the binding of the segmented RNF19B form to the two PD-L1 forms by Western blot.

Meanwhile, the plasmid pcDNA3.1-T7-PD-L1(K5R) with 5 ubiquitination site mutations of the cytoplasmic region of PD-L1 is constructed in the application, and the 5 sites are K263, K270, K271, K280 and K281 respectively. Three plasmids, namely pcDNA3.1-V5-RNF19B, pcDNA3.1-T7-PD-L1 and pcDNA3.1-T7-PD-L1(K5R), are transfected into HEK293FT cells, the cells are collected after being treated for 6 hours by using MG132 with the concentration of 20 mu mol/L, a Co-IP experiment is carried out, and the binding condition of the RNF19B and 5 Lys ubiquitination site mutation PD-L1 in a cytoplasmic region is detected by Western blot.

The results show that: (1) RNF19B binds to cytoplasmic fragments of PD-L1 in tumor cells (FIG. 6A), mediating the ubiquitination process of PD-L1. (2) In HEK293FT cells, 5 segments of PD-L1(WT) and RNF19B and 5 segments of PD-L1(3NQ) and RNF19B were transfected, and the amino acid sequences of 167-732 (the nucleotide sequences of which are shown in SEQ ID No.7), 252-732 (the nucleotide sequences of which are shown in SEQ ID No.8) and 319-732 (the nucleotide sequences of which are shown in SEQ ID No.9) of RNF19B were found to be combined with PD-L1 by Co-IP experiments, but the binding strengths were different (FIGS. 6C and 6D). The 167-732 amino acid sequence of RNF19B includes two active regions, the IBR region and the RING2 region of RNF19B, when both regions are present, RNF19B binds most strongly to PD-L1, and if there is no IBR region but only the RING2 domain, RNF19B can also bind to PD-L1 but not the last fragment. If neither region is present, the binding capacity of RNF19B to PD-L1 will be greatly diminished. This indicates that the key region for RNF19B binding to PD-L1 is the RING2 domain. (3) It was found by Co-IP experiments in HEK293FT cells that RNF19B failed to bind further to PD-L1 with 5 mutations in ubiquitination sites (FIG. 6B). Thus, it was demonstrated that RNF19B must first bind to the cytoplasmic domain of PD-L1 in order to ubiquitinate PD-L1, and that 5 ubiquitination sites in the cytoplasmic domain are important for the binding of RNF19B to PD-L1.

7. RNF19B affected binding of USP22 to PD-L1.

USP22 is a deubiquitinase, and can maintain the stable expression of PD-L1 molecule in cells. Plasmids pcDNA3.1-V5-RNF19B and pcDNA3.1-HA-USP22 were overexpressed in HEK293FT cells, and after treatment for 6h with 20. mu. mol/L MG132, the cells were harvested for Co-IP experiments and binding of RNF19B to USP22 was detected by Western blot.

pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22 and pcDNA3.1-FLAG-PD-L1 plasmids were overexpressed in HEK293FT cells, and the cells were harvested after treatment with 20. mu. mol/L of MG132 for 6h, subjected to a Co-IP experiment, and examined for the effect of RNF19B on the binding of PD-L1 and USP22 by Western blot. pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22 and pcDNA3.1-HIS-UB were overexpressed in A549 and H1299 cells, treated with or without 200nmol/L of ubenidin for 6 hours, treated with 20. mu. mol/L of MG132 for 6 hours, and then the cells were harvested and subjected to Co-IP experiments to detect ubiquitination of USP22 by RNF19B in the presence or absence of ubenidin.

The results show that: (1) Co-IP experiments found that RNF19B was associated with USP22 (FIG. 7A). (2) Co-IP experiments found that RNF19B reduced the binding of PD-L1 to USP22 (FIG. 7B). Increasing the instability of PD-L1. After overexpression of RNF19B, ubiquitination of USP22 did not increase (FIG. 7C), which means that RNF19B exposes its ubiquitination site by affecting the binding of USP22 to PD-L1 throughout the process, thus exposing PD-L1. RNF19B was shown to affect the level of PD-L1 under ER Stress rather than affecting the level of PD-L1 by reducing the level of USP 22.

From the above experiments and the results thereof, the following conclusions can be drawn:

in non-small cell lung cancer, ubenioside can cause Ca by acting on the sodium potassium pump in the plasma membrane²⁺Imbalance in homeostasis induces the production of endoplasmic reticulum stress. Under endoplasmic reticulum stress, the normal glycosylation modification of PD-L1 is interfered, and the non-glycosylated PD-L1 is further recognized by RNF19B and is ubiquitinated, and finally is guided to proteasome degradation. Meanwhile, RNF19B not only can play a role in down-regulation of non-glycosylated PD-L1, but also can play the same role in mature PD-L1. In addition, the wholeIn the process, RNF19B can affect the combination of USP22 and PD-L1, reduce the protection of USP22 on PD-L1 and increase the instability of PD-L1 in tumor cells. All results ultimately resulted in a significant reduction in PD-L1 levels in tumor cells.

The invention has the beneficial effects that:

the invention provides application of ubenioside in preparation of a preparation for reducing the level of tumor cells PD-L1. Wherein: the concentration of the ubenioside capable of effectively reducing the level of tumor cells PD-L1 is 100-200 nmol/L. Further proves that the ubenioside can inhibit the development of tumors and the application potential of the ubenioside in anti-tumor immune response by reducing the PD-L1 level in the tumors. Meanwhile, the ubenioside disclosed by the invention lays a foundation for research and development of preparations for reducing the level of tumor cell PD-L1, and also provides certain reference and revelation for secondary development of traditional medicines in the field of tumor treatment.

The regulation and control mode aiming at the ubiquitination of PD-L1 is helpful for further understanding the molecular mechanism related to PD-L1, provides a theoretical basis for designing related medicines, provides a theoretical basis for solving the basic mechanism of tumor escape, also develops the application of the ubenioside in the field of anti-tumor immunotherapy, and provides a new strategy for improving the technical means and clinical curative effect of the tumor immunotherapy.

Drawings

FIG. 1 shows that the ubenioside down-regulates the protein level of lung cancer cell PD-L1 to show obvious concentration and time dependence

In FIG. 1A, the cells were treated with different concentrations of ubenioside in H1792, H1299, H460 and A549 and then cultured for 12H, and Western blot detection of proteins revealed that the levels of PD-L1 and USP22 both decreased with the increase of the concentration of ubenioside treatment, showing obvious concentration-dependent effect. FIG. 1B shows that after H157 and H460 were treated with 200nmol/L of ubenioside for different periods of time, the Western blot protein detection showed that PD-L1 and USP22 continued to decrease with increasing treatment time. FIG. 1C shows that in H1792 and A549, after treatment with 200nmol/L of ubenioside for 12H, total RNA was extracted and reverse transcribed to obtain cDNA. The obtained cDNA was used as a template, and the gene sequence of PD-L1 was amplified by PCR using the upstream and downstream primers designed from the PD-L1 gene, and then subjected to 1% agarose gel electrophoresis to detect the transcription of PD-L1.

FIG. 2 shows that ouabain can be obtained by changing Ca in cytoplasm²⁺Homeostatic induction of endoplasmic reticulum stress in tumor cells, and the down-regulation of PD-L1 by ubenioside depends on a proteasome pathway rather than a lysosomal pathway

In FIG. 2A, the change of CHOP, a marker protein of ER Stress, was detected by WB after H460 and A549 in response to treatment with ubenioside at concentrations of 0, 100, and 200 nmol/L. FIG. 2B shows that after 1 mol/L4-PBA (commonly used ER Stress inhibitor for 4-PBA) is used for pretreatment in H460 and A549 for 30min, 200nmol/L of ubenioside is added for subsequent treatment for 12H. Changes in PD-L1 and CHOP and p-eIF2 α were detected after 12 h. FIG. 2C shows the WB assay of PD-L1, CHOP and ACTB levels using two NSCLC cell lines, A549 and H1792, after 1H of pretreatment with 10. mu. mol/L BAPTA/AM followed by 200nmol/L ubenioside and 12H of further culture. FIG. 2D shows that treatment with 20. mu. mol/L proteasome inhibitor MG132 and 15. mu. mol/L lysosomal inhibitor CQ blocked the respective degradation pathways in both A549 and H1792 lung cancer cell lines, respectively. After the 200nmol/L ubenioside is treated for 4 hours, MG132 and CQ are respectively added, and then the culture is continued for 8 hours. Cells were harvested and WB tested for PD-L1 and ACTB levels.

FIG. 3 shows the interaction of RNF19B with PD-L1

FIGS. 3A and 3B show that pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-V5-RNF19B plasmids are overexpressed in HEK293FT cells, and Co-IP experiments are performed by using FLAG protein antibodies. Binding of RNF19B to PD-L1(WT) and PD-L1(3NQ) was detected by WB. FIG. 3C shows the expression of pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-FLAG-PD-L1(3NQ) in H1299 plasmid, and the detection of the combination of endogenous protein RNF19B and PD-L1 by CO-IP assay with FLAG antibody.

FIG. 4 is a graph showing that RNF19B affects PD-L1 levels

Wherein, FIG. 4A shows that RNF19B is over-expressed in A549 and H1792, 200nmol/L of ubenioside is added into the cells 12H before the cells are collected, the cells are collected and run for glue preparation, and the expression conditions of PD-L1, CHOP and ACTB are detected by WB. FIG. 4B shows the siRNA of RNF19B used in A549 and H1792 to knock down the expression of RNF19B and the expression of PD-L1, RNF19B, CHOP and ACTB detected by WB after treating with 200nmol/L ubenioside for 12H.

FIG. 5 shows that RNF19B enhances ubiquitination of PD-L1 under treatment of ubenioside, and RNF19B has strong affinity and ubiquitination level for non-glycosylated PD-L1

Wherein, FIG. 5A shows that pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB are over-expressed in H1299, and the glycosylated and non-glycosylated ubiquitination levels of PD-L1 are detected by co-immunoprecipitation. FIGS. 5B and 5C show the ubiquitination levels of glycosylated and non-glycosylated PD-L1 detected by co-immunoprecipitation by overexpressing pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ) in H1299 and A549 and treating pcDNA3.1-HA-UB with 200nmol/L of ubenidin for 12H. FIGS. 5D and 5E show the transfection of pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ), and pcDNA3.1-HA-UB plasmids in H1299 and H1792 cells, and the detection of the binding of RNF19B to both forms of PD-L1 and the level of ubiquitination by co-immunoprecipitation and WB. FIG. 5F shows the transfection of pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-HA-UB into H1299 cells, pretreatment with 1 mmol/L4-PBA for 30min, addition of 200nmol/L ubenidin for further treatment for 12H, addition of 20. mu. mol/L MG132 for treatment 8H before cell collection, and cell collection with Co-IP detection of ubiquitination level of RNF19B to unglycosylated PD-L1. FIG. 5G shows the transfection of pcDNA3.1-V5-RNF19B and pcDNA3.1-FLAG-PD-L1(3NQ) plasmids in H1299, after overnight incubation, the cells were fixed, stained with fluorescence, and photographed under a confocal laser microscope for co-localization.

FIG. 6 shows that RNF19B binds to the cytoplasmic domain of PD-L1 via its (252-732) domain (the nucleotide sequence of which is shown in SEQ ID No.8)

FIG. 6A shows the binding of RNF19B and PD-L1 fragments by Co-IP assay after transfection of three plasmids, namely pcDNA3.1-V5-RNF19B, pEGFPC2-PD-L1, pEGFPC2-PD-L1(1-259) and pEGFPC2-PD-L1(239-290), in HEK293FT cells treated with MG132 at 20. mu. mol/L for 6 hours. FIG. 6B shows the transfection of three plasmids, pcDNA3.1-V5-RNF19B, pcDNA3.1-T7-PD-L1 and pcDNA3.1-T7-PD-L1(K5R), in HEK293FT cells, after the cells were treated with 20. mu. mol/L MG132 for 6h, the binding of RNF19B to cytoplasmic 5 Lys ubiquitination site mutation PD-L1 was detected by Co-IP assay. FIGS. 6C and 6D show five plasmids of RNF19B and PD-L1(WT)/PD-L1(3NQ) transfected in HEK293FT cells, MG132 was added at 20. mu. mol/L6 h before cells were harvested, and cells were harvested to detect the binding of RNF19B fragments to PD-L1 by Co-IP assay. FIG. 6E is a domain segmentation of RNF 19B: the full length is divided by domains (dark labeled segments), with the 1 st segment from the left being the RING1 region, the 2 nd segment from the left being the IBR region, the 3 rd segment from the left being the RING2 region, and the 4 th and 5 th segments from the left being the TM regions (transmembrane regions).

FIG. 7 shows that RNF19B affects binding of USP22 to PD-L1

Wherein, FIG. 7A shows the plasmids pcDNA3.1-V5-RNF19B and pcDNA3.1-HA-USP22 are overexpressed in HEK293FT cell. Co-immunoprecipitation experiments were performed using HA protein antibodies to detect binding of RNF19B to USP22 by WB. FIG. 7B shows the overexpression of pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22, pcDNA3.1-FLAG-PD-L1 plasmids in HEK293FT cells, the co-immunoprecipitation experiment using FLAG antibody, and the detection of the binding of RNF19B to PD-L1 and USP22 by WB. FIG. 7C shows overexpression of pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22, and pcDNA3.1-HIS-UB in A549 and H1299 cells, co-immunoprecipitation using HA antibody, and ubiquitination of USP22 by WB detection of RNF19B in the presence or absence of ubenin.

FIG. 8 shows that ubenioside down-regulates lung cancer cell glycosylation PD-L1 protein level

Wherein it is shown that 1.0 × 10⁵H157 cells per ml are planted in 12-well cell culture plates, after the cell number is increased to about 60%, various concentrations of ubenioside (Ouabain) solutions are added, the cell state is observed after 24H, and WB is collected to detect the protein level of glycosylated and non-glycosylated PD-L1.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

In the following examples, materials, plasmids, reagents and the like used were obtained commercially unless otherwise specified.

Wherein: ubenioside (Ouabain) was purchased from seleck; human non-small cell type lung cancer cell lines (NSCLC): h460, H1792, A549, H157, H1299, Calu-1 were all purchased from ATCC in USA; human embryonic kidney cell line: HEK293FT, HEK293T were purchased from Invitrogen.

The plasmids referred to in the examples of the present invention are: pcDNA3.1-FLAG-PD-L1, pcDNA3.1-HA-UB, pcDNA3.1-HIS-UB, pEGFPC2-PD-L1, pEGFPC2-PD-L1(1-259), pEGFPC2-PD-L1(239-290), pcDNA3.1-T7-PD-L1, pcDNA3.1-HA-USP22, pcDNA3.1-V5-RNF19B (1-167), pcDNA3.1-V5-RNF19 (1-252), pcDNA3.1-V5-RNF19B (167-732), pcDNA3.1-V5-RNF B (DNA732), pcDNA3.1-V5-RNF 7 (1-RNF 319), pcDNA3.1-V-FLAG-UB (7-7), and pcDNA3.1-V7-RNF 7 (7). The construction adopts a conventional molecular biology method, wherein the specific construction method takes pcDNA3.1-FLAG-PD-L1 plasmid as an example as follows:

1. tumor cell RNA extraction

(1) The cells were cultured in 6-well plates, and the medium solution in the plates was aspirated by a vacuum pump before RNA extraction, and then washed once with 1 XPBS phosphate buffer solution, and the residual liquid was aspirated.

(2) To each 6-well plate, 500. mu.L of TRIZOL solution was added for lysis by repeatedly blowing with a pipette to completely disrupt the cells, and then the 6-well plate was allowed to stand at room temperature for 5 minutes.

(3) After standing, the lysate was placed in an autoclaved 1.5mL RNase-free centrifuge tube. Then, 100. mu.L of chloroform solution was added thereto, and the mixture was sufficiently shaken for about 15 seconds, and finally allowed to stand at room temperature for 2 minutes.

(4) After standing for 2 minutes, the centrifuge tube was placed in a 4 ℃ low temperature centrifuge and centrifuged for 15 minutes at 12000 g.

(5) After the centrifugation is completed, the solution is obviously divided into an upper layer, a middle layer and a lower layer, the liquid in the upper layer is sucked into a new centrifugal tube by using a liquid transfer machine, and 250 mu L of isopropanol solution is added. The mixture was left standing at room temperature for 10 minutes.

(6) After standing, the centrifuge tube is placed into a 4 ℃ centrifuge at 12000g for 10 minutes.

(7) After centrifugation, the supernatant was carefully removed using a pipette, and then 500. mu.L of a 75% ethanol solution prepared with DEPC water was added to the centrifuge tube, gently flicked, and then centrifuged at 7500g for 5 minutes in a 4 ℃ centrifuge. This process was repeated twice.

(8) And (4) completely discarding the supernatant by using a pipettor, and placing the centrifugal tube on sterile absorbent paper with the opening facing downwards for natural drying.

(9) In the air drying process, the white precipitate at the bottom of the centrifuge tube can be clearly seen to become more and more transparent, then 40 mu L of DEPC water is added, and the precipitate is flicked evenly to completely dissolve the RNA of the substrate.

(10) The purity and concentration of the extracted RNA was measured using a spectrophotometer.

2. Reverse transcription process

(1) The whole process of loading is carried out on the ice box. The reverse transcription kit was taken on ice.

(2) An autoclaved PCR vial was taken, and 1. mu.L of oligo (dT) and 1. mu.g of extracted RNA (the volume added to RNA was calculated) were added thereto, and the remaining volume was made up to 13. mu.L using sterile ultrapure water, gently mixed, and then subjected to short-cut separation in a high-speed centrifuge for 10 seconds.

(3) After centrifugation, the PCR tube was placed in a PCR apparatus, and reaction was carried out at 65 ℃ for 10 minutes.

(4) After the Reaction, the PCR tube was taken out, and 4. mu.L of 5 × Reaction buffer, 0.5. mu.L of RNase inhibitor, 0.5. mu.L of reverse transcriptase and 2. mu.L of dNTP solution were added thereto, gently mixed, and subjected to instantaneous centrifugation.

(5) After centrifugation, the PCR tube is placed in the PCR instrument again, the set program is that the reaction is carried out for 30 minutes at 55 ℃, then the reaction is carried out for 5 minutes at 85 ℃, and finally the reaction is stored at-20 ℃ after the reaction is finished.

3. Cloning of the target Gene

(1) PCR system used for gene cloning:

reagent name addition volume

2×PrimeSTAR Max Premix 5μL

10 mu mol/L PD-L1 upstream primer 0.4 mu L

10 mu mol/L PD-L1 downstream primer 0.4 mu L

Template cDNA 0.4. mu.L

Double distilled water 3.8 μ L

Total volume 10. mu.L

The sequences of upstream and downstream primers of the PD-L1 gene are as follows:

pcDNA3.1-PD-L1-FLAG FWD:

CGGTACCGCCGCCACCATGAGGATATTTGCTGTCTTTATATTC

pcDNA3.1-PD-L1-FLAG REV:

CCTCGAGTTACTTGTCGTCATCGTCTTTGTAGTCCGTCTCCTCCAAATGT

GTATC

(2) PCR reaction time and temperature setting:

temperature setting time setting

98 ℃ for 2 minutes

98 deg.C for 10 seconds

53 deg.C for 15 seconds

72 deg.C for 30 seconds

72 ℃ for 7 minutes

Storing at 4 deg.C

Note: the number of PCR cycles was set to 35 cycles.

(3) Adding A for reaction: and (3) putting 30 mu L of PCR final product into a new PCR tube, adding 0.3 mu L of DNA Taq polymerase into the new PCR tube, gently mixing the mixture evenly, and putting the mixture into a PCR instrument for a reaction process of 20 minutes at 72 ℃.

(4) Connection of the target gene fragment to the T vector:

reagent name volume

PD-L1 Gene PCR product 4. mu.L

pMD19-T Vector 1μL

Solution Ⅰ 5μL

The volume of double distilled water is supplemented to 10 mu L

Place in PCR instrument at 16 ℃ overnight for T-vector ligation

4. Plasmid expression vector construction

(1) Taking 10 μ L of Escherichia coli competent cells from a refrigerator at-80 deg.C, and placing on an ice box

(2) 3-5. mu.L of the product of the gene linked to the T vector was added to the competent cells, gently mixed and then left to stand on an ice box for 30 minutes.

(3) After completion of the standing on ice, the heat shock reaction was carried out in a constant temperature water bath at 42 ℃ for 90 seconds, followed by further standing on ice for 2 minutes.

(4) After standing, 500. mu.L of liquid LB medium was added to the centrifuge tube, and the mixture was shake-cultured on the bacterial culture medium bed at 37 ℃ for 1 hour.

(5) After 1h, 500. mu.L of the above-mentioned bacterial solution was added to LB solid medium containing antibiotics selected according to the resistance gene carried by the vector to which it was ligated, using a pipette.

(6) After bacterial plating, the bacterial plates were incubated in a 37 ℃ bacterial incubator overnight with inversion.

(7) An appropriate number of 1.5mL centrifuge tubes were taken, 15. mu.L of sterile water was added thereto, and then a certain number of individual strains were picked up and put in sterile water according to colonies grown on the plates.

(8) After completion of the picking, 15. mu.L of phenol chloroform isoamyl alcohol solution was added to the centrifuge tube, and the bacteria were disrupted using a vortex shaker.

(9) And after the lysis is finished, centrifuging at normal temperature for 10 minutes at 12000g, dividing the solution into three layers after centrifugation, and taking the upper layer solution for agarose gel electrophoresis verification.

(10) And selecting the successfully connected colonies according to the electrophoresis result, and carrying out a bacteria shaking step. Firstly, adding a liquid LB culture medium and 1 per mill of antibiotics into a 5mL bacteria shaking tube, and then picking out a selected single colony and placing the single colony into a bacteria incubator for shake culture for 16 h.

(11) And extracting plasmids by using a small-extraction medium-amount plasmid extraction kit.

(12) The extracted plasmid is sent to a biological company to test the gene sequence, and whether the gene sequence is consistent with the target gene sequence or not is compared.

(13) Carrying out restriction enzyme digestion on the T vector connected with the PD-L1 gene fragment and the plasmid expression vector pcDNA3.1 by using the same restriction enzymes KpnI and XhoI, and carrying out agarose gel electrophoresis verification after the enzyme digestion is finished. The enzyme digestion system is as follows:

reagent name volume

10 Xfast-cutting enzyme buffer 3. mu.L

Restriction enzyme KpnI 1.5. mu.L

Restriction enzyme XhoI 1.5. mu.L

Plasmid expression vector pcDNA3.1/T vector 4. mu.g connected with PD-L1 gene

The volume of double distilled water is supplemented to 30 mu L

(14) After the verification is successful, cutting the band on the agarose gel electrophoresis, recovering the gel, and purifying the DNA.

(15) The PD-L1 gene fragment recovered from the glue is connected with a plasmid expression vector according to the following system:

reagent name volume

PD-L1 gene fragment 3.7 μ L recovered from glue

Plasmid expression vector pcDNA3.1 fragment 0.3. mu.L

T4-DNA ligase 1. mu.L

1 μ L of T4-DNA ligase buffer

The volume of double distilled water is supplemented to 10 mu L

5. Protein validation

Selecting plasmid transfection cells with correct construction sequencing, collecting the cells, making a western blot, and verifying whether the protein is over-expressed.

In addition to the construction of the pcDNA3.1-FLAG-PD-L1 plasmid, the construction procedures of the other plasmids are the same as above, except that the sequences of the upstream and downstream primers required by each plasmid are as follows:

pEGFPC2-PD-L1(1-259)FWD:

CCTCGAGGCCGCCACCATGAGGATATTTGCTGTCTTTATATTC

pEGFPC2-PD-L1(1-259)REV:

CGGTACCTTAGAAGATGAATGTCAGTGCTACACC

pEGFPC2-PD-L1(239-290)FWD:

CCTCGAGGCCGCCACCATGACTCACTTGGTAATTCTGG

pEGFPC2-PD-L1(239-290)REV:

CGGTACCTTACGTCTCCTCCAAATGTGTATC

pcDNA3.1-V5-RNF19B(1-167)FWD:

CAAGCTTGCCGCCACCATGGGCTCCGAGAAGGACTC

pcDNA3.1-V5-RNF19B(1-167)REV:

CCTCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCGCT

GCACTCGGGGCAGCTG

pcDNA3.1-V5-RNF19B(1-252)FWD:

CAAGCTTGCCGCCACCATGGGCTCCGAGAAGGACTC

pcDNA3.1-V5-RNF19B(1-252)REV:

CCTCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCATC

GCATGTCTGATTTGGATGC

pcDNA3.1-V5-RNF19B(167-732)FWD:

CAAGCTTGCCGCCACCATGAGCGAGCGACTCAACCC

pcDNA3.1-V5-RNF19B(167-732)REV:

CCTCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTCAT

ACTCTGGCTTCTCCACC

pcDNA3.1-V5-RNF19B(252-732)FWD:

CAAGCTTGCCGCCACCATGGATATGGCCCGTCAACAG

pcDNA3.1-V5-RNF19B(252-732)REV:

CCTCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTCAT

ACTCTGGCTTCTCCACC

pcDNA3.1-V5-RNF19B(319-732)FWD:

CAAGCTTGCCGCCACCATGAAAGAGATCTCAGACTTGC

pcDNA3.1-V5-RNF19B(319-732)REV:

CCTCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTCAT

ACTCTGGCTTCTCCACC

example 1: the ubeniside down-regulates the protein level of lung cancer cell PD-L1 and shows obvious concentration and time dependence

Mixing 1.0X 10⁵H157 cells per ml were seeded in 12-well plates (cell culture dishes) at 37 ℃ with CO₂Culturing in an incubator, adding different concentrations of ubesain (0-500nmol/L) solution to treat cells for 24h when the number of the cells is increased to about 60%, placing a culture plate (dish) with the cells on ice, and sucking away the culture medium; washing the cells once with pre-chilled 1 × PBS, and then aspirating the liquid from the plate; adding appropriate volume of cell lysis solution (PIC) containing 1% mixed protease inhibitor, performing ice lysis for 30min, collecting cell lysis solution, centrifuging at 4 deg.C 13200r/min for 15min, and collecting supernatant. Then, a standard curve is made and the protein concentration is measured, 5 EP tubes with the volume of 1.5mL are taken firstly, 10 mu L of deionized water is added respectively, and then (0, 1, 2, 4, 8) mu L of BSA (the concentration is 2mg/mL) is added respectively, and the group is used for making the standard curve; taking a 0.5mL EP tube, adding 10 mu L deionized water, and then adding 2 mu L protein sample lysate; preparing a proper amount of 1 x protein dye solution (formed by diluting 5 x protein dye solution, prepared at present), adding 500 mu L dye solution into an experimental group, adding 1mL dye solution into a standard yeast group, and uniformly mixing; respectively taking 200 mu L of each tube of liquid, adding the liquid into a 96-well plate, measuring an OD value under the wavelength of 595nm by using an enzyme-labeling instrument, drawing a standard curve according to the OD value of a standard curve group, and calculating the concentration of a sample according to the OD value of the sample; calculating the volumes of the required protein lysate, 3 xSDS and 1 xSDS according to the concentration and the sample loading amount, and sequentially adding the volumes into a 0.5mL EP tube to prepare a protein sample; performing metal bath at 95 deg.C, denaturing for 5min, and loading on SDS-PAGE gel. Separating glue and concentrated glue are prepared according to the formula. And (4) carrying out short-time centrifugation on the protein sample after the metal bath heating denaturation, and then carrying out loading. The rubber hole comb is pulled out, and the diluted 1 XRunning Buffer solution is added into the electrophoresis tank and the rubber plate. The standard protein Marker is added in the loading pore channel according to the experimental sequence of the protein samples and is added among different experimental groups to indicate the molecular weight of different proteins. After the sample loading is finished, glue running is carried out, and 90V is carried out firstlyAnd pressing the glue by using voltage, and finishing glue running when bromophenol blue runs to the position near the bottom of the glue by using 120V voltage after the protein Marker is separated. Then, the membrane is transferred, the PVDF membrane is activated by methanol for 1min, the Transfer buffer is precooled in advance, and the proteins on the gel are transferred to the PVDF membrane by a wet Transfer method for 150V for 2-3 h. After the membrane transfer is finished, 5% of skimmed milk powder (in a configuration of 1 xPBST) is sealed for 1 h; washing with 1 × PBST for 5 min; primary antibody incubation, 3% BSA preparation primary antibody, and 4 ℃ incubation overnight; recovering primary antibody in the next day, washing with 1 × PBST twice for 8 min; incubating the secondary antibody (prepared by 3% skimmed milk powder) for 1h at room temperature; washing with 1 × PBST for 10 min; ECL color development, mixing the film with the substrate, placing in a dark room, exposing with a developing sheet, and analyzing the result. Glycosylated and non-glycosylated PD-L1 protein levels were detected after the above western blot procedure.

H1792, H1299, H460 and A549 cells were seeded in 12-well plates (cell culture dishes) respectively, CO at 37 ℃₂After culturing in an incubator for 24 hours, adding different concentrations of ubenioside (0-450nmol/L) to treat cells for 24 hours, placing a culture plate (dish) with cells on ice, and sucking away a culture medium; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of cell lysate (PIC) containing 1% mixed protease inhibitor, lysing on ice for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, collecting supernatant, and detecting the levels of PD-L1 and USP22 protein after the above western blot procedure.

H460 and H157 cells were seeded in 12-well plates (cell culture dishes) at 37 ℃ with CO₂After culturing in an incubator for 24h, adding ubenioside (200nmol/L) to treat cells for different time (12-24h), placing a culture plate (dish) with cells on ice, and sucking away a culture medium; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of cell lysate (PIC) containing 1% mixed protease inhibitor, performing ice lysis for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, collecting supernatant, and detecting protein levels of PD-L1 and USP22 after the above western blot procedure.

H1792 and A549 cells were seeded in 6-well plates (cell culture dishes) respectively at 37 ℃ with CO₂After 24h of culture in an incubator, adding ubeniside (200nmol/L) to treat cells for 12h, sucking out a culture medium solution in a culture plate by using a vacuum suction pump before extracting RNA, then adding 1 XPBS phosphoric acid buffer solution to clean once, and sucking out residual liquid; adding 500 mu L of TRIZOL solution into each 6-well plate for cracking, repeatedly blowing and beating the 6-well plate by using a pipette during cracking so as to completely crack the cells, and standing the 6-well plate for 5 minutes at room temperature; after standing, the lysate was placed in an autoclaved 1.5mL RNase-free centrifuge tube. Then adding 100 mu L of chloroform solution for fully shaking for about 15s, and finally standing for 2 minutes at room temperature; standing for 2 minutes, and then placing the centrifugal tube into a low-temperature centrifugal machine at 4 ℃ for centrifuging for 15 minutes at the rotating speed of 12000 g; after the centrifugation is finished, the solution is obviously divided into an upper layer, a middle layer and a lower layer, the liquid in the upper layer is sucked into a new centrifugal tube by using a liquid transfer machine, and 250 mu L of isopropanol solution is added. After being uniformly mixed, the system is placed at room temperature and stands for 10 minutes; after standing, putting the centrifuge tube into a 4 ℃ centrifuge at the rotating speed of 12000g for 10 minutes; after centrifugation, the supernatant was carefully removed using a pipette, and then 500. mu.L of a 75% ethanol solution prepared with DEPC water was added to the centrifuge tube, gently and uniformly flicked, and then centrifuged at 7500g for 5 minutes in a 4 ℃ centrifuge. This process was repeated twice; discarding all the supernatant by using a pipettor, placing the centrifuge tube on sterile absorbent paper with the tube opening facing downwards, and naturally airing; in the air drying process, the white precipitate at the bottom of the centrifuge tube can be clearly seen to become more and more transparent, then 40 mu L of DEPC water is added, and the precipitate is flicked evenly to completely dissolve the RNA of the substrate; the purity and concentration of the extracted RNA was measured using a spectrophotometer. Taking the reverse transcription kit on ice; taking an autoclaved PCR tube, adding 1 μ L of oligo (dT) and 1 μ g of extracted RNA (calculating the volume added by RNA) into the tube, filling the remaining volume to 13 μ L with sterile ultrapure water, gently mixing, and then separating in a high-speed centrifuge for 10 seconds; after centrifugation, putting the PCR tubule into a PCR instrument, and reacting at 65 ℃ for 10 minutes; after the Reaction was completed, the PCR tube was taken out, and 4. mu.L of 5 × Reaction buffer, 0.5. mu.L of RNase inhibitor and 0.5. mu.L of RNase inhibitor were added theretoSlightly and uniformly mixing reverse transcriptase and 2 mu L dNTP solution, and performing instantaneous centrifugation; after centrifugation, the PCR tube is placed in the PCR instrument again, the set program is that the reaction is carried out for 30 minutes at 55 ℃, then the reaction is carried out for 5 minutes at 85 ℃, and finally the reaction is stored at-20 ℃ after the reaction is finished. Using the obtained cDNA as a template, 10. mu.L of PCR system (2 XPrimeSTAR Max Premix 5. mu.L, 10. mu. mol/L of PD-L1 gene upstream primer 0.4. mu.L, 10. mu. mol/L of PD-L1 gene downstream primer 0.4. mu.L, template cDNA 0.4. mu.L, double distilled water 3.8. mu.L, total volume 10. mu.L) was used to perform PCR amplification of the gene sequence of PD-L1 with upstream and downstream primers designed from PD-L1 gene, and then 1% agarose gel electrophoresis was performed to detect the transcription of PD-L1.

The sequences of the upstream and downstream primers of the PD-L1 gene are as follows:

FWD:CGGTACCGCCGCCACCATGAGGATATTTGCTGTCTTTATATTC

REV:CCTCGAGTTCGTCTCCTCCAAATGTGTATC

the results show that: (1) the gradual decrease in glycosylation of PD-L1 accompanied by an increase in non-glycosylated PD-L1 with an increase in the treatment concentration of ubeniside indicates that ubeniside interferes with the normal synthesis of PD-L1 (fig. 8). (2) The downregulation of PD-L1 by ubeniside showed concentration-dependent effects in H460, a549, H1792 and H1299, and in H157 and H460, the effect of ubeniside on PD-L1 was also time-dependent (fig. 1A, 1B). (3) There was no trend in the transcript level of PD-L1 after the treatment with ubenioside (FIG. 1C), indicating that the effect of ubenioside on PD-L1 did not occur at the transcript level.

Example 2: the ubenioside can be obtained by changing Ca in cytoplasm²⁺Homeostatic induction of endoplasmic reticulum stress in tumor cells, and the down-regulation of PD-L1 by ubenioside depends on the proteasome pathway rather than the lysosomal pathway

H460 and A549 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO, respectively₂After 24h of incubation in an incubator, the cells are treated by adding different concentrations of ubeniside (0, 100, 200nmol/L) for 12h, the cells are collected and lysed (the specific steps are shown in example 1), and the change of CHOP (marker protein of ER Stress) is detected after passing through western blot (the steps are shown in example 1). H460 and A549 cellsRespectively inoculating in 6-well plate (cell culture dish) at 37 deg.C and CO₂After 24h of incubation in an incubator, 1mol/L of 4-PBA is added for pretreatment for 30min, 200nmol/L of ubenidin is added for continuous treatment for 12h, cell lysis is collected (the specific steps are shown in example 1), and changes of PD-L1, CHOP and p-eIF2 alpha are detected after western blot (the steps are shown in example 1). H460 and A549 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO, respectively₂After 24h of incubation in an incubator, 10. mu. mol/L of (Ca) was added²⁺Chelating agent) BAPTA/AM pretreatment for 1h, adding 200nmol/L ubenioside, continuing culturing for 12h, collecting cell lysis (specific steps are shown in example 1), and detecting the levels of marker proteins CHOP of PD-L1 and ER Stress through western blot (steps are shown in example 1).

A549 and H1792 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h of incubation in an incubator, 200nmol/L of ubenidin is added for treatment for 4h, then 20 μmol/L of proteasome inhibitor MG132 and 15 μmol/L of lysosome inhibitor CQ are respectively added for treatment for 8h, then the cells are collected for lysis (the specific steps are shown in example 1), and the levels of PD-L1 and ACTB are detected after passing through a western blot (the steps are shown in example 1).

The results show that: (1) with the increase of the treatment concentration of the ubenioside, the protein content of CHOP or p-eIF2 alpha in tumor cells is increased, and after the treatment of 4-PBA, the production of ER Stress mediated by the ubenioside is prevented to a certain extent, and the ubenioside is prevented from reducing the intensity of PD-L1 (FIGS. 2A and 2B). Using Ca²⁺When the chelating agent BAPTA/AM and the ubeniside are used for treating the cells simultaneously, the rise of the endoplasmic reticulum stress marker CHOP is inhibited, and the reduction of the content of PD-L1 is weakened (figure 2C). Indicating that ubeniside can break Ca²⁺The balance of (a) and (b) allows tumor cells to be under endoplasmic reticulum stress, interfering with the synthesis of PD-L1. (2) Treatment with proteasome inhibitor MG132 inhibited ubenioside-induced PD-L1 down-regulation, whereas the combined use of lysosomal inhibitor CQ showed no significant change compared to treatment with ubenioside alone (fig. 2D), indicating that ubenioside down-regulation of PD-L1 was dependent on the proteasome pathway rather than the lysosomal pathway.

Example 3: RNF19B interacting with PD-L1

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h of culture in an incubator, transfecting pcDNA3.1-FLAG-PD-L1/pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-V5-RNF19B plasmids in HEK293FT cells, taking 2 1.5mL of EP tubes for each treatment, adding 200 mu L of culture medium respectively, adding the plasmids and transfection reagents with the mass 2 times of that of the plasmids respectively after calculation according to experimental requirements, blowing the plasmids and the transfection reagents with a pipette gun for five times respectively, and standing for 5 min; mixing 2 liquids in 1.5mL EP tubes, blowing and beating for five times to fully mix the liquids, and standing for 20 min; sucking away a part of original culture medium, dripping the uniformly mixed and standing liquid, and shaking to uniformly distribute the liquid; after 6h of transfection, fresh medium with 5% serum was replaced and the culture was continued for 24 h. Adding 20 mu mol/L MG132 for treatment 6h before collecting cells, placing the culture plate (dish) with cells on ice, and sucking off the culture medium; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of IP lysate containing 1% mixed Protease Inhibitor (PIC), lysing on ice for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, and collecting supernatant. To avoid non-specific binding of beads to Protein, 10. mu.L of Protein A beads or Protein G beads were placed in a 1.5mLEP tube, 900. mu.L of 1 XPBS was added, centrifugation was carried out at 9000G for 1min in a 4 ℃ centrifuge, the supernatant was carefully aspirated away, care was taken not to aspirate the beads, 900. mu.L of IP lysate was added, the above procedure was repeated, and finally the Protein sample lysate was added, incubated for 2-4h at 4 ℃ with slow shaking; add 15. mu.L of Protein A beads or Protein G beads to a new 1.5mLEP tube, add 900. mu.L of 1 XPBS, centrifuge 9000G for 1min at 4 ℃, carefully aspirate the supernatant, take care not to aspirate the beads, add 900. mu.L of IP lysate, repeat the above operations; centrifuging the protein sample containing the beads, collecting the supernatant, calculating the volume of the protein sample required by a Co-IP (Co-immunoprecipitation) experiment with a Western blot experiment (step shown in example 1) according to the experiment requirement, adding the protein sample into the newly washed beads, filling the volume with an IP lysate (containing 1% PIC) to 500 mu L, and preparing an input protein sample; adding the antibody into a 500 mu L system IP sample according to the ratio of the antibody to the protein of 1:1000, and incubating for 4-6h at 4 ℃ by a shaking table;after incubation, taking out the centrifuge tube, centrifuging at 4 ℃ for 1 minute, centrifuging at 9000g, sucking out the supernatant by using a pipettor, then adding 900 mu L of an IP lysate containing 1% PIC, washing the beads on a shaking table at 4 ℃ for 5 minutes, finally centrifuging at 9000g for 1 minute, and sucking out the supernatant by using a pipette gun; adding 900 μ L of 1% PIC-containing IP lysate repeatedly, washing the beads on a shaking table at 4 deg.C for 5min, centrifuging at 9000g for 1min, and sucking out the supernatant with a pipette; finally, 20-25 mu L of 2 xSDS is added, after short-time centrifugation, the mixture is placed on a metal bath at 100 ℃ for denaturation for 10 minutes; 13200r/min, centrifugating for 5min, sucking the supernatant, running SDS-PAGE gel, and performing the same procedures as Western blot (see example 1). The binding of RNF19B to PD-L1(WT) and PD-L1(3NQ) was examined by Western blot.

H1299 cells were seeded in 10cm cell culture dishes at 37 ℃ in CO₂After 24H of incubation in an incubator, the H1299 cells are transfected by the conventional method (see example 3) with pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-FLAG-PD-L1(3NQ) plasmids for 24H, MG132 of 20 mu mol/L is added for treatment 6H before the cells are collected, then the cells are collected for Co-IP experiment (see example 3), and the combination of two forms of endogenous proteins RNF19B and PD-L1 is detected by Western blot (see example 1).

The results show that: RNF19B interacts with both glycosylated and non-glycosylated PD-L1 (fig. 3A, 3B). In addition, it was confirmed by Co-IP experiments that RNF19B binds to endogenous PD-L1 (FIG. 3C).

Example 4: RNF19B affects PD-L1 protein levels

A549 and H1792 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24H of incubation in an incubator, pcDNA3.1-V5-RNF19B plasmid is transfected into A549 cells and H1792 cells (the specific steps are shown in example 3) for 24H, 200nmol/L of ubenioside is added into the cells before 12H of cell collection, the cells are treated for 12H, and the expression conditions of PD-L1, CHOP and ACTB are detected by Western blot (the steps are shown in example 1).

A549 and H1792 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24H incubation in incubator, transfection in A549 and H1792 cells (see example 3 for details)After siRNA of RNF19B interferes with expression of RNF19B for 24h, 200nmol/L ubenioside is added into the cells for continuous treatment for 12h before the cells are collected for 12h, and expression conditions of PD-L1, RNF19B, CHOP and ACTB are detected by Western blot (see the steps in example 1).

The results show that: after the endoplasmic reticulum stress is induced by using the ubenioside in A549 and H1792 cells and RNF19B is over-expressed, the degradation of PD-L1 is accelerated, the total amount of PD-L1 in cancer cells is obviously reduced (figure 4A), and the strength of PD-L1 reduction caused by the ubenioside is inhibited after the siRNA of RNF19B is used for interfering RNF19B (figures 4B and 4C). Indicating that RNF19B affects PD-L1 protein levels.

Example 5: RNF19B under treatment of ubenicoside enhances ubiquitination of PD-L1, and RNF19B has strong affinity and ubiquitination level to non-glycosylated PD-L1

H1299 cells were seeded in 10cm cell culture dishes at 37 ℃ in CO₂After 24H of incubation in an incubator, the H1299 cells were transfected (see example 3 for specific steps) with pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-HA-UB plasmid 24H, and then treated with MG132 at a concentration of 20. mu. mol/L6H before the cells were harvested, and the cells were harvested for Co-IP assay (see example 3 for steps), and the ubiquitination levels of glycosylated and non-glycosylated PD-L1 were detected by Western blot (see example 1 for steps). H1299 and A549 cells were respectively inoculated into 10cm cell culture dishes at 37 ℃ and CO₂After 24H of incubation in an incubator, pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 or pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB plasmid 24H are respectively transfected in H1299 and A549 cells (the specific steps are shown in example 3), 200nmol/L of ubenidin is added into the cells before the cells are collected for further treatment for 12H, 20 μmol/L of MG132 is added into the cells for treatment 6H before the cells are collected for treatment, then the cells are collected for Co-IP experiment (the steps are shown in example 3), and the ubiquitination levels of glycosylated and non-glycosylated PD-L1 are detected by Western blot (the steps are shown in example 1).

H1299 and H1792 cells were seeded in 10cm cell culture dishes at 37 ℃ with CO₂After 24H incubation in incubator, pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1 and pc were transfected into H1299 and H1792 cells, respectively (see example 3 for details)DNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB plasmid 24h, 200nmol/L of ubenioside is added into the cells for continuous treatment before 12h of collecting cells, 20 μmol/L of MG132 is added into the cells for continuous treatment before 6h of collecting cells, then the cells are collected for Co-IP experiment (see the step in example 3), and the combination condition of RNF19B and two forms of PD-L1 and the ubiquitination level are detected by Western blot (see the step in example 1). H1299 cells were seeded in 10cm cell culture dishes at 37 ℃ with CO₂After 24H of incubation in an incubator, pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-UB plasmid are transfected into H1299 cells (see example 3), pretreated with 1 mmol/L4-PBA (inhibitor of ER Stress) for 30min, then 200nmol/L ubenidin is added for further treatment for 12H, MG132 of 20 μmol/L is added for treatment 8H before the cells are collected, Co-IP experiment is carried out on the cells (see example 3), and the ubiquitination level of non-glycosylated PD-L1 by RNF19B is detected by Western blot (see example 1).

H1299 cells were seeded in 6cm cell culture dishes at 37 ℃ in CO₂After 24H of incubation in the incubator, plasmids pcDNA3.1-V5-RNF19B, pcDNA3.1-FLAG-PD-L1(3NQ) were transfected into H1299 cells (see example 3 for specific procedures) for 24H. Soaking the required cell climbing sheet in 75% ethanol solution for 30min in a biological safety cabinet; after 30 minutes, the cell slide was removed and placed on sterilized filter paper to air dry the remaining ethanol solution. Preparing a 24-hole cell culture plate, and putting the dried cell climbing sheet into the holes of the culture plate in a biological safety cabinet; treating the transfected H1299 cells for 24H, and planting a proper amount of cells in a 24-well plate placed in a cell slide by calculating the number of the cells; after overnight culture, the next day old medium was aspirated off using a vacuum pump and the residual medium was washed with 1 × PBS solution; after absorbing the participating solution, adding a proper volume of PHEMO fixing solution into a 24-pore plate, and incubating for 10 minutes at room temperature to complete the fixation of cells; after incubation, the participating fixative was aspirated and the cells were washed with 1 x PBS solution, this step was repeated 3 times for 5 minutes each; after washing, blocking the cells for 1h at room temperature using a 1 XPBS solution containing 3% BSA; dissolving the primary antibody in 1%BSA in 1 XPBS at a primary dilution ratio of 1:200, and adding about 300. mu.L of the solution to each well using a pipette, overnight (18h or more) at 4 ℃; after the primary antibody incubation is completed, the PBS solution containing the primary antibody is sucked away, and then the cells are washed by using 1 XPBS solution, and the steps are repeated for 2 times and 5 minutes each time; after washing, the secondary antibody was also diluted in 1 × PBS solution containing 1% BSA and 300 μ L of the solution was added to each well, and incubated for 1h at room temperature in the absence of light. All subsequent steps need to be carried out protected from light. The PBS solution containing the secondary antibody was aspirated, and the cells were washed with 1 XPBS solution, repeated 2 times for 5 minutes each; adding another primary antibody, dissolving the primary antibody in 1 XPBS solution of 1% BSA at a primary antibody dilution ratio of 1:200, adding about 300. mu.L of the solution to each well using a pipette, and standing overnight (18h or more) at 4 ℃; after the primary antibody incubation was completed, the PBS solution containing the primary antibody was aspirated, the cells were washed with 1 × PBS solution, repeated 2 times for 5 minutes each, another secondary antibody was also diluted in 1 × PBS solution containing 1% BSA and 300 μ L of solution was added to each well, and incubation was performed at room temperature for 1h in the absence of light; after the secondary antibody incubation, the secondary antibody solution was aspirated and washed 2 times with 1 × PBS solution for 5 minutes each; finally staining the nuclei, adding 300. mu.L of solution to each well using 1 XPBS solution containing 1. mu.g/mL DAPI for approximately 1 minute, after which the solution is aspirated and washed 3 times for 5 minutes each; after all the staining is finished, taking out the cell crawl sheets from the 24-pore plate one by one, and fixing the cell crawl sheets on a glass slide by using a sealing liquid to finish the sample preparation operation; and finally, taking a picture on a Zeiss LSM700 laser confocal microscope to observe the co-location condition of the prepared sample and the prepared sample.

The results show that: (1) RNF19B enhanced ubiquitination of PD-L1 under treatment with ubenioside. After overexpression of RNF19B and simultaneous induction of ER Stress with ubenioside, RNF19B promoted ubiquitination of both glycosylated and non-glycosylated forms of PD-L1 (FIGS. 5B, 5C). If no treatment with ubeniside was used, mere overexpression of RNF19B had a relatively small effect on ubiquitination of both forms of PD-L1 (FIG. 5A). The result shows that RNF19B is E3 ubiquitin ligase of PD-L1, and RNF19B participates in the ubiquitination process of PD-L1 in the process of ubenicoside-mediated reduction of PD-L1. (2) RNF19B has a strong affinity for non-glycosylated PD-L1 and a strong level of ubiquitination. (FIGS. 5D and 5E). Using immunofluorescence confocal techniques, co-localization between non-glycosylated PD-L1 and RNF19B was observed (FIG. 5G), indicating that the regulation of PD-L1 by RNF19B is mainly performed in cytoplasm on one hand, and the process is mainly ubiquitination recognition and degradation of immature PD-L1 by RNF 19B. (3) When the cells were treated with the inhibitor 4-PBA of ER Stress, the ubiquitin level of non-glycosylated PD-L1 was also significantly reduced by RNF19B after the inhibition of ER Stress (FIG. 5F), indicating that PD-L1 was ubiquitinated by RNF19B after ER Stress was initiated by ubenin.

Example 6: RNF19B binds to cytoplasmic fragment of PD-L1 through its (252-732) structural region (its nucleotide sequence is shown in SEQ ID No.8)

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h of incubation in an incubator, the HEK293FT cells were transfected (see example 3) with pcDNA3.1-V5-RNF19B, pEGFPC2-PD-L1, pEGFPC2-PD-L1(1-259) and pEGFPC2-PD-L1(239-290) plasmids 24h, the cells were treated with MG132 at a concentration of 20. mu. mol/L before being collected for 6h, and then the cells were collected for Co-IP assay (see example 3), and the binding of RNF19B and PD-L1 fragments was detected by Western blot (see example 1).

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h of incubation in an incubator, five segmented plasmids of RNF19B and plasmids of PD-L1(WT)/PD-L1(3NQ) were transfected into HEK293FT cells (see example 3) for 24h, cells were treated with 20. mu. mol/L MG132 before being harvested for 6h, and then harvested for Co-IP assay (see example 3) and the binding of the segments of RNF19B to both forms of PD-L1 was detected by Western blot (see example 1).

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h of incubation in an incubator, the cells were transfected (see example 3) into HEK293FT pcDNA3.1-V5-RNF19B, pcDNA3.1-T7-PD-L1, pcDNA3.1-T7-PD-L1(K5R) plasmids 24h, treated with 20. mu. mol/L of MG132 before 6h of cell collection, and then collected for Co-IP experiments (see example 3) by Western blot (see example 1 for steps)RNF19B was tested for binding to the cytoplasmic domain 5 Lys ubiquitination site mutation PD-L1.

The results show that: (1) RNF19B binds to cytoplasmic fragments of PD-L1 in tumor cells (FIG. 6A), mediating the ubiquitination process of PD-L1. (2) In HEK293FT cells, 5 segments of PD-L1(WT) and RNF19B and 5 segments of PD-L1(3NQ) and RNF19B were transfected, and the amino acid sequences of 167-732 (the nucleotide sequences of which are shown in SEQ ID No.7), 252-732 (the nucleotide sequences of which are shown in SEQ ID No.8) and 319-732 (the nucleotide sequences of which are shown in SEQ ID No.9) of RNF19B were found to be combined with PD-L1 by Co-IP experiments, but the binding strengths were different (FIGS. 6C and 6D). The 167-732 amino acid sequence of RNF19B includes two active regions, the IBR region and the RING2 region of RNF19B, when both regions are present, RNF19B binds most strongly to PD-L1, and if there is no IBR region but only the RING2 domain, RNF19B can also bind to PD-L1 but not the last fragment. If neither region is present, the binding capacity of RNF19B to PD-L1 will be greatly diminished. This indicates that the key region for RNF19B binding to PD-L1 is the RING2 domain. (3) It was found by Co-IP experiments in HEK293FT cells that RNF19B failed to bind further to PD-L1 with 5 mutations in ubiquitination sites (FIG. 6B). Thus, it was demonstrated that RNF19B must first bind to the cytoplasmic domain of PD-L1 in order to ubiquitinate PD-L1, and that 5 ubiquitination sites in the cytoplasmic domain are important for the binding of RNF19B to PD-L1.

Example 7: RNF19B affects binding of USP22 to PD-L1

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h incubation in incubator, HEK293FT cells were transfected (see example 3) pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22 plasmid 24h, cells were treated with 20. mu. mol/L MG132 6h before being harvested, and cells were harvested for Co-IP assay (see example 3) and tested for binding of RNF19B to USP22 by Western blot (see example 1).

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ CO₂After 24h of incubation in incubator, pcDNA3.1-V5-RNF19B and pcDNA3 were transfected into HEK293FT cells (see example 3 for details)1-HA-USP22, pcDNA3.1-FLAG-PD-L1 plasmid 24h, and 20. mu. mol/L MG132 was added to treat the cells 6h before harvesting them, and then harvesting the cells for Co-IP assay (see example 3 for steps), and the effect of RNF19B on the binding of PD-L1 and USP22 was examined by Western blot (see example 1 for steps).

A549 and H1299 cells were respectively inoculated into 10cm cell culture dishes at 37 ℃ and CO₂After 24H of incubation in an incubator, pcDNA3.1-V5-RNF19B, pcDNA3.1-HA-USP22 and pcDNA3.1-HIS-UB plasmids 24H were transfected into A549 cells and H1299 cells respectively (see example 3), 200nmol/L of ubenioside was added or not added for 6H of treatment, 20 μmol/L of MG132 was added before the cells were collected for 6H of treatment, then the cells were collected for Co-IP experiments (see example 3), and the influence of RNF19B on USP22 ubiquitination in the presence or absence of ubenioside was examined by Western blot (see example 1).

The results show that: (1) Co-IP experiments found that RNF19B was associated with USP22 (FIG. 7A). (2) Co-IP experiments found that RNF19B reduced the binding of PD-L1 to USP22 (FIG. 7B). Increasing the instability of PD-L1. After overexpression of RNF19B, ubiquitination of USP22 did not increase (FIG. 7C), which means that RNF19B exposes its ubiquitination site by affecting the binding of USP22 to PD-L1 throughout the process, thus exposing PD-L1. RNF19B was shown to affect the level of PD-L1 under ER Stress rather than affecting the level of PD-L1 by reducing the level of USP 22.

Sequence listing

<110> Shandong university

Application of ubeniside in preparation of preparation for reducing tumor cell PD-L1 level

<141> 2021-08-28

<160> 9

<210> 1

<211> 873

<212> DNA

<213> Homo sapiens?(human)

<221> full-length nucleotide sequence of PD-L1 (1-290)

<222>（1）…（873）

<400> 1

atgaggatat ttgctgtctt tatattcatg acctactggc atttgctgaa cgcatttact 60

gtcacggttc ccaaggacct atatgtggta gagtatggta gcaatatgac aattgaatgc 120

aaattcccag tagaaaaaca attagacctg gctgcactaa ttgtctattg ggaaatggag 180

gataagaaca ttattcaatt tgtgcatgga gaggaagacc tgaaggttca gcatagtagc 240

tacagacaga gggcccggct gttgaaggac cagctctccc tgggaaatgc tgcacttcag 300

atcacagatg tgaaattgca ggatgcaggg gtgtaccgct gcatgatcag ctatggtggt 360

gccgactaca agcgaattac tgtgaaagtc aatgccccat acaacaaaat caaccaaaga 420

attttggttg tggatccagt cacctctgaa catgaactga catgtcaggc tgagggctac 480

cccaaggccg aagtcatctg gacaagcagt gaccatcaag tcctgagtgg taagaccacc 540

accaccaatt ccaagagaga ggagaagctt ttcaatgtga ccagcacact gagaatcaac 600

acaacaacta atgagatttt ctactgcact tttaggagat tagatcctga ggaaaaccat 660

acagctgaat tggtcatccc agaactacct ctggcacatc ctccaaatga aaggactcac 720

ttggtaattc tgggagccat cttattatgc cttggtgtag cactgacatt catcttccgt 780

ttaagaaaag ggagaatgat ggatgtgaaa aaatgtggca tccaagatac aaactcaaag 840

aagcaaagtg atacacattt ggaggagacg taa 873

<210> 2

<211> 777

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of PD-L1(1-259)

<222>（1）…（777）

<400> 2

atgaggatat ttgctgtctt tatattcatg acctactggc atttgctgaa cgcatttact 60

gtcacggttc ccaaggacct atatgtggta gagtatggta gcaatatgac aattgaatgc 120

aaattcccag tagaaaaaca attagacctg gctgcactaa ttgtctattg ggaaatggag 180

gataagaaca ttattcaatt tgtgcatgga gaggaagacc tgaaggttca gcatagtagc 240

tacagacaga gggcccggct gttgaaggac cagctctccc tgggaaatgc tgcacttcag 300

atcacagatg tgaaattgca ggatgcaggg gtgtaccgct gcatgatcag ctatggtggt 360

gccgactaca agcgaattac tgtgaaagtc aatgccccat acaacaaaat caaccaaaga 420

attttggttg tggatccagt cacctctgaa catgaactga catgtcaggc tgagggctac 480

cccaaggccg aagtcatctg gacaagcagt gaccatcaag tcctgagtgg taagaccacc 540

accaccaatt ccaagagaga ggagaagctt ttcaatgtga ccagcacact gagaatcaac 600

acaacaacta atgagatttt ctactgcact tttaggagat tagatcctga ggaaaaccat 660

acagctgaat tggtcatccc agaactacct ctggcacatc ctccaaatga aaggactcac 720

ttggtaattc tgggagccat cttattatgc cttggtgtag cactgacatt catcttc 777

<210> 3

<211> 159

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of PD-L1(239-290)

<222>（1）…（159）

<400> 3

actcacttgg taattctggg agccatctta ttatgccttg gtgtagcact gacattcatc 60

ttccgtttaa gaaaagggag aatgatggat gtgaaaaaat gtggcatcca agatacaaac 120

tcaaagaagc aaagtgatac acatttggag gagacgtaa 159

<210> 4

<211> 2199

<212> DNA

<213> Homo sapiens?(human)

<221> full-length nucleotide sequence of RNF19B (1-732)

<222>（1）…（2199）

<400> 3

atgggctccg agaaggactc cgagtcgccg cgctccacat cgctacatgc ggccgcaccc 60

gaccctaagt gccgcagcgg cggccggcgc cggcgcctca ccttgcacag cgtcttctct 120

gcctcggccc gcggccgccg cgcccgggcc aagccgcagg ccgagccgcc gcccccggct 180

gcgcagccgc cgcccgcccc ggcccctgcc gcggcccagg gcccgccgcc cgaggcgctg 240

cccgccgagc cggccgccga ggccgaggcg gaggccgcgg cggcggcggc ggagcctggg 300

ttcgacgatg aggaggcggc ggagggcggt ggcccgggcg cggaggaggt ggagtgtccg 360

ctgtgcctgg tgcggctgcc gcctgagcgg gccccgcgcc tcctcagctg tccgcaccgc 420

tcgtgccggg actgcctccg ccactacctg cgcctggaga taagcgagag cagggtgccc 480

atcagctgcc ccgagtgcag cgagcgactc aacccgcacg acatccgctt gctgctcgcc 540

gacccgccgc ttatgcacaa gtacgaggag ttcatgctgc gccgctacct agcctcggac 600

cccgactgcc gctggtgccc ggccccggac tgcggttatg ctgttattgc ctatggctgt 660

gccagctgcc cgaagctaac ttgtgagagg gaaggttgcc agactgagtt ctgctaccac 720

tgcaagcaga tatggcatcc aaatcagaca tgcgatatgg cccgtcaaca gagggcccag 780

actttacgag ttcggaccaa acacacttca ggtctcagtt atgggcaaga atctggacca 840

gcagatgaca tcaagccatg cccacgatgc agtgcataca ttatcaagat gaatgatgga 900

agctgtaatc acatgacctg tgcagtgtgt ggctgtgaat tctgttggct ttgtatgaaa 960

gagatctcag acttgcatta cctcagcccc tctggctgta cattctgggg caagaagcca 1020

tggagccgta agaagaaaat tctttggcag ctgggcacgt tgattggtgc tccagtgggg 1080

atttctctca ttgctggcat tgccattcct gccatggtca ttggcattcc tgtttatgtt 1140

ggaaggaaga ttcacagcag gtatgaggga aggaaaacct ccaaacacaa gaggaatttg 1200

gctatcactg gaggagtgac tttgtcggtc attgcatccc cagttattgc tgcagttagt 1260

gttggtattg gtgtccccat tatgctggca tatgtttatg gggttgtgcc catttctctt 1320

tgtcgtggag gcggctgtgg agttagcaca gccaacggaa aaggagtgaa aattgaattt 1380

gatgaagatg atggtccaat cacagtggca gatgcctgga gagccctcaa gaatcccagc 1440

attggggaaa gcagcattga aggcctgact agtgtattga gcactagtgg aagccctaca 1500

gatggactta gtgttatgca aggtccttac agcgaaacgg ccagctttgc agccctctca 1560

gggggcacgc tgagtggcgg cattctctcc agtggcaagg gaaaatatag caggttagaa 1620

gttcaagccg atgtccaaaa ggaaattttc cccaaagaca cagccagtct tggtgcaatt 1680

agtgacaacg caagcactcg tgctatggcc ggttccataa tcagttccta caacccacag 1740

gacagagaat gcaacaatat ggaaatccaa gtggacattg aagccaaacc aagccactat 1800

cagctggtga gtggaagcag cacggaggac tcgctccatg ttcatgctca gatggcagag 1860

aatgaagaag aaggtagtgg tggcggaggc agtgaagagg atcccccctg cagacaccaa 1920

agctgtgaac agaaagactg cctggccagc aaaccttggg acatcagcct ggcccagcct 1980

gaaagcatcc gcagtgacct agagagttct gatgcacagt cagacgatgt gccagacatc 2040

acctcagatg agtgtggctc cccccgctcc catactgcag cctgcccctc gacccccaga 2100

gcccaaggtg caccgagccc aagtgcccat atgaacctct ctgccctagc cgagggacaa 2160

actgtcttga agccagaagg tggagaagcc agagtatga 2199

<210> 5

<211> 501

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of RNF19B (1-167)

<222>（1）…（501）

<400> 5

atgggctccg agaaggactc cgagtcgccg cgctccacat cgctacatgc ggccgcaccc 60

gaccctaagt gccgcagcgg cggccggcgc cggcgcctca ccttgcacag cgtcttctct 120

gcctcggccc gcggccgccg cgcccgggcc aagccgcagg ccgagccgcc gcccccggct 180

gcgcagccgc cgcccgcccc ggcccctgcc gcggcccagg gcccgccgcc cgaggcgctg 240

cccgccgagc cggccgccga ggccgaggcg gaggccgcgg cggcggcggc ggagcctggg 300

ttcgacgatg aggaggcggc ggagggcggt ggcccgggcg cggaggaggt ggagtgtccg 360

ctgtgcctgg tgcggctgcc gcctgagcgg gccccgcgcc tcctcagctg tccgcaccgc 420

tcgtgccggg actgcctccg ccactacctg cgcctggaga taagcgagag cagggtgccc 480

atcagctgcc ccgagtgcag c 501

<210> 6

<211> 756

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of RNF19B (1-252)

<222>（1）…（756）

<400> 6

atgggctccg agaaggactc cgagtcgccg cgctccacat cgctacatgc ggccgcaccc 60

gaccctaagt gccgcagcgg cggccggcgc cggcgcctca ccttgcacag cgtcttctct 120

gcctcggccc gcggccgccg cgcccgggcc aagccgcagg ccgagccgcc gcccccggct 180

gcgcagccgc cgcccgcccc ggcccctgcc gcggcccagg gcccgccgcc cgaggcgctg 240

cccgccgagc cggccgccga ggccgaggcg gaggccgcgg cggcggcggc ggagcctggg 300

ttcgacgatg aggaggcggc ggagggcggt ggcccgggcg cggaggaggt ggagtgtccg 360

ctgtgcctgg tgcggctgcc gcctgagcgg gccccgcgcc tcctcagctg tccgcaccgc 420

tcgtgccggg actgcctccg ccactacctg cgcctggaga taagcgagag cagggtgccc 480

atcagctgcc ccgagtgcag cgagcgactc aacccgcacg acatccgctt gctgctcgcc 540

gacccgccgc ttatgcacaa gtacgaggag ttcatgctgc gccgctacct agcctcggac 600

cccgactgcc gctggtgccc ggccccggac tgcggttatg ctgttattgc ctatggctgt 660

gccagctgcc cgaagctaac ttgtgagagg gaaggttgcc agactgagtt ctgctaccac 720

tgcaagcaga tatggcatcc aaatcagaca tgcgat 756

<210> 7

<211> 1701

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of RNF19B (167-

<222>（1）…（1701）

<400> 7

agcgagcgac tcaacccgca cgacatccgc ttgctgctcg ccgacccgcc gcttatgcac 60

aagtacgagg agttcatgct gcgccgctac ctagcctcgg accccgactg ccgctggtgc 120

ccggccccgg actgcggtta tgctgttatt gcctatggct gtgccagctg cccgaagcta 180

acttgtgaga gggaaggttg ccagactgag ttctgctacc actgcaagca gatatggcat 240

ccaaatcaga catgcgatat ggcccgtcaa cagagggccc agactttacg agttcggacc 300

aaacacactt caggtctcag ttatgggcaa gaatctggac cagcagatga catcaagcca 360

tgcccacgat gcagtgcata cattatcaag atgaatgatg gaagctgtaa tcacatgacc 420

tgtgcagtgt gtggctgtga attctgttgg ctttgtatga aagagatctc agacttgcat 480

tacctcagcc cctctggctg tacattctgg ggcaagaagc catggagccg taagaagaaa 540

attctttggc agctgggcac gttgattggt gctccagtgg ggatttctct cattgctggc 600

attgccattc ctgccatggt cattggcatt cctgtttatg ttggaaggaa gattcacagc 660

aggtatgagg gaaggaaaac ctccaaacac aagaggaatt tggctatcac tggaggagtg 720

actttgtcgg tcattgcatc cccagttatt gctgcagtta gtgttggtat tggtgtcccc 780

attatgctgg catatgttta tggggttgtg cccatttctc tttgtcgtgg aggcggctgt 840

ggagttagca cagccaacgg aaaaggagtg aaaattgaat ttgatgaaga tgatggtcca 900

atcacagtgg cagatgcctg gagagccctc aagaatccca gcattgggga aagcagcatt 960

gaaggcctga ctagtgtatt gagcactagt ggaagcccta cagatggact tagtgttatg 1020

caaggtcctt acagcgaaac ggccagcttt gcagccctct cagggggcac gctgagtggc 1080

ggcattctct ccagtggcaa gggaaaatat agcaggttag aagttcaagc cgatgtccaa 1140

aaggaaattt tccccaaaga cacagccagt cttggtgcaa ttagtgacaa cgcaagcact 1200

cgtgctatgg ccggttccat aatcagttcc tacaacccac aggacagaga atgcaacaat 1260

atggaaatcc aagtggacat tgaagccaaa ccaagccact atcagctggt gagtggaagc 1320

agcacggagg actcgctcca tgttcatgct cagatggcag agaatgaaga agaaggtagt 1380

ggtggcggag gcagtgaaga ggatcccccc tgcagacacc aaagctgtga acagaaagac 1440

tgcctggcca gcaaaccttg ggacatcagc ctggcccagc ctgaaagcat ccgcagtgac 1500

ctagagagtt ctgatgcaca gtcagacgat gtgccagaca tcacctcaga tgagtgtggc 1560

tccccccgct cccatactgc agcctgcccc tcgaccccca gagcccaagg tgcaccgagc 1620

ccaagtgccc atatgaacct ctctgcccta gccgagggac aaactgtctt gaagccagaa 1680

ggtggagaag ccagagtatg a 1701

<210> 8

<211> 1446

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of RNF19B (252-732)

<222>（1）…（1446）

<400> 8

gatatggccc gtcaacagag ggcccagact ttacgagttc ggaccaaaca cacttcaggt 60

ctcagttatg ggcaagaatc tggaccagca gatgacatca agccatgccc acgatgcagt 120

gcatacatta tcaagatgaa tgatggaagc tgtaatcaca tgacctgtgc agtgtgtggc 180

tgtgaattct gttggctttg tatgaaagag atctcagact tgcattacct cagcccctct 240

ggctgtacat tctggggcaa gaagccatgg agccgtaaga agaaaattct ttggcagctg 300

ggcacgttga ttggtgctcc agtggggatt tctctcattg ctggcattgc cattcctgcc 360

atggtcattg gcattcctgt ttatgttgga aggaagattc acagcaggta tgagggaagg 420

aaaacctcca aacacaagag gaatttggct atcactggag gagtgacttt gtcggtcatt 480

gcatccccag ttattgctgc agttagtgtt ggtattggtg tccccattat gctggcatat 540

gtttatgggg ttgtgcccat ttctctttgt cgtggaggcg gctgtggagt tagcacagcc 600

aacggaaaag gagtgaaaat tgaatttgat gaagatgatg gtccaatcac agtggcagat 660

gcctggagag ccctcaagaa tcccagcatt ggggaaagca gcattgaagg cctgactagt 720

gtattgagca ctagtggaag ccctacagat ggacttagtg ttatgcaagg tccttacagc 780

gaaacggcca gctttgcagc cctctcaggg ggcacgctga gtggcggcat tctctccagt 840

ggcaagggaa aatatagcag gttagaagtt caagccgatg tccaaaagga aattttcccc 900

aaagacacag ccagtcttgg tgcaattagt gacaacgcaa gcactcgtgc tatggccggt 960

tccataatca gttcctacaa cccacaggac agagaatgca acaatatgga aatccaagtg 1020

gacattgaag ccaaaccaag ccactatcag ctggtgagtg gaagcagcac ggaggactcg 1080

ctccatgttc atgctcagat ggcagagaat gaagaagaag gtagtggtgg cggaggcagt 1140

gaagaggatc ccccctgcag acaccaaagc tgtgaacaga aagactgcct ggccagcaaa 1200

ccttgggaca tcagcctggc ccagcctgaa agcatccgca gtgacctaga gagttctgat 1260

gcacagtcag acgatgtgcc agacatcacc tcagatgagt gtggctcccc ccgctcccat 1320

actgcagcct gcccctcgac ccccagagcc caaggtgcac cgagcccaag tgcccatatg 1380

aacctctctg ccctagccga gggacaaact gtcttgaagc cagaaggtgg agaagccaga 1440

gtatga 1446

<210> 9

<211> 1245

<212> DNA

<213> Homo sapiens?(human)

<221> nucleotide sequence of RNF19B (319-732)

<222>（1）…（1245）

<400> 9

atgaaagaga tctcagactt gcattacctc agcccctctg gctgtacatt ctggggcaag 60

aagccatgga gccgtaagaa gaaaattctt tggcagctgg gcacgttgat tggtgctcca 120

gtggggattt ctctcattgc tggcattgcc attcctgcca tggtcattgg cattcctgtt 180

tatgttggaa ggaagattca cagcaggtat gagggaagga aaacctccaa acacaagagg 240

aatttggcta tcactggagg agtgactttg tcggtcattg catccccagt tattgctgca 300

gttagtgttg gtattggtgt ccccattatg ctggcatatg tttatggggt tgtgcccatt 360

tctctttgtc gtggaggcgg ctgtggagtt agcacagcca acggaaaagg agtgaaaatt 420

gaatttgatg aagatgatgg tccaatcaca gtggcagatg cctggagagc cctcaagaat 480

cccagcattg gggaaagcag cattgaaggc ctgactagtg tattgagcac tagtggaagc 540

cctacagatg gacttagtgt tatgcaaggt ccttacagcg aaacggccag ctttgcagcc 600

ctctcagggg gcacgctgag tggcggcatt ctctccagtg gcaagggaaa atatagcagg 660

ttagaagttc aagccgatgt ccaaaaggaa attttcccca aagacacagc cagtcttggt 720

gcaattagtg acaacgcaag cactcgtgct atggccggtt ccataatcag ttcctacaac 780

ccacaggaca gagaatgcaa caatatggaa atccaagtgg acattgaagc caaaccaagc 840

cactatcagc tggtgagtgg aagcagcacg gaggactcgc tccatgttca tgctcagatg 900

gcagagaatg aagaagaagg tagtggtggc ggaggcagtg aagaggatcc cccctgcaga 960

caccaaagct gtgaacagaa agactgcctg gccagcaaac cttgggacat cagcctggcc 1020

cagcctgaaa gcatccgcag tgacctagag agttctgatg cacagtcaga cgatgtgcca 1080

gacatcacct cagatgagtg tggctccccc cgctcccata ctgcagcctg cccctcgacc 1140

cccagagccc aaggtgcacc gagcccaagt gcccatatga acctctctgc cctagccgag 1200

ggacaaactg tcttgaagcc agaaggtgga gaagccagag tatga 1245