阅读说明：本技术 Cybb基因外显子表达变异在辅助鉴定慢性肉芽肿病中的应用 (Application of CYBB gene exon expression variation in auxiliary identification of chronic granulomatosis ) 是由 杨军 夏宇 罗书立 史丽娜 于 2019-10-28 设计创作，主要内容包括：本发明公开了CYBB基因外显子表达变异在辅助鉴定慢性肉芽肿病中的应用。本发明提供了检测待测人基因组中CYBB基因第11号外显子是否缺失或突变或表达水平的物质在制备辅助检测待测人是否患有慢性肉芽肿病产品中的应用。本发明首次发现CYBB基因的第11外显子的缺失或表达水平与慢性肉芽肿病相关,同时本发明首次设计了用于检测CYBB基因的第11外显子的缺失或表达水平的引物对,并采用实时荧光定量PCR进行扩增,鉴定该基因的第11外显子是否缺失或表达水平是否变化,从而辅助判断待测人是否患有慢性肉芽肿病。(The invention discloses application of CYBB gene exon expression variation in auxiliary identification of chronic granulomatosis. The invention provides application of a substance for detecting whether a CYBB gene No. 11 exon in a genome of a human to be detected is deleted or mutated or has an expression level in preparation of a product for assisting in detecting whether the human to be detected has chronic granulomatosis. The invention discovers that the deletion or expression level of the 11 th exon of the CYBB gene is related to the chronic granulomatosis for the first time, simultaneously designs a primer pair for detecting the deletion or expression level of the 11 th exon of the CYBB gene for the first time, adopts real-time fluorescent quantitative PCR (polymerase chain reaction) for amplification, and identifies whether the 11 th exon of the gene is deleted or the expression level is changed, thereby assisting in judging whether a human to be detected has the chronic granulomatosis.)

1. The application of the substance for detecting whether the 11 th exon of the CYBB gene in the genome of a human to be detected is deleted or mutated or expressed in the genome of the human to be detected in the preparation of products for assisting in detecting whether the human to be detected has chronic granulomatosis.

2. Use according to claim 1, characterized in that:

the 11 th exon of the CYBB gene is the 37665640-st and 37665786 th sites of the X chromosome.

3. Use according to claim 1 or 2, characterized in that:

the substances are 1) or 2) as follows:

1) the substances comprise related reagents or instruments for high-throughput second-generation sequencing of CYBB genes in human genomes to be detected;

2) the substance comprises a primer for amplifying the 11 th exon of the CYBB gene in the genome of the human to be detected or a PCR reagent or a kit containing the primer.

4. Use according to claim 3, characterized in that:

the primer for amplifying the CYBB gene No. 11 exon in the human genome to be detected consists of the following a and b:

a. a single-stranded DNA molecule shown in sequence 4 or a derivative thereof;

b. a single-stranded DNA molecule shown in sequence 5 or a derivative thereof.

5. A product for assisting in detecting whether a human to be detected has chronic granulomatous disease, which is the substance for detecting whether the 11 th exon of the CYBB gene in the genome of the human to be detected is deleted, mutated or expressed in the application of any one of claims 1 to 4.

6. A kit for auxiliary detection of whether a human to be detected has chronic granulomatosis comprises a primer for amplifying the 11 th exon of a CYBB gene in a genome of the human to be detected or a PCR reagent containing the primer.

7. The kit of claim 6, wherein:

the primer for amplifying the CYBB gene No. 11 exon in the human genome to be detected consists of the following a and b:

a. a single-stranded DNA molecule shown in sequence 4 or a derivative thereof;

b. a single-stranded DNA molecule shown in sequence 5 or a derivative thereof.

8. The kit according to claim 6 or 7, characterized in that: the kit also comprises a primer for amplifying the internal reference gene CSF2 RA.

9. The kit according to any one of claims 6 to 8, wherein:

the primer for amplifying the internal reference gene CSF2RA consists of the following c and d:

c. a single-stranded DNA molecule shown in sequence 8 or a derivative thereof;

d. a single-stranded DNA molecule shown in seq id No. 9 or a derivative thereof.

Technical Field

The invention relates to the field of molecular biomedicine, in particular to application of CYBB gene exon expression variation in auxiliary identification of chronic granulomatosis.

Background

Chronic granulomatous disease (chronic granulomatous disease) is a lethal genetic defect in leukocyte function. The clinical main characteristic is that the children patients are highly sensitive to various catalase positive bacteria, such as staphylococcus, serratia, aspergillus, etc., repeatedly suffer from chronic bacterial infection, locally suffer from chronic granuloma, and are characterized by extensive granulomatous damage to skin, lung and lymph nodes. The onset is mostly within 2 years of age, and a few of them can come late to 10 years of age. About 75% of cases are X-linked recessive inheritance, the rest are autosomal recessive inheritance, and the incidence ratio of male and female is 9: 1. The leucocyte function is screened mainly through a tetrazole nitrogen blue experiment, and then the diagnosis is confirmed by combining with corresponding X-ray examination. Diagnosis may be delayed until puberty or after adulthood and is difficult to distinguish from diseases such as G6-PD deficiency, leukocyte glutathione peroxidase deficiency, familial lipopigment histiocytosis, etc. Therefore, the molecular detection method can be applied to detect the cause of the disease as soon as possible, and the treatment and intervention can be carried out in time, so that the pain of the patient can be reduced as far as possible.

At present, the main gene detection method is second-generation sequencing, and mainly comprises three links of high-throughput sequencing of a gene package, gene data analysis and suspected pathogenic mutation verification. Sequencing is efficient, but expensive and time consuming (on average 1 month results). In addition, the method is suitable for point Mutation, deletion insertion Mutation (micro Mutation) within 50bp and deletion detection of more than 2 exon levels, is not suitable for detection of special types of Mutation such as deletion, dynamic Mutation, complex recombination and the like of a single exon, and records that the current Mutation types of the CYBB Gene reach 790 varieties according to a Human Gene Mutation Database (Human Gene Mutation Database), wherein the deletion ratio of a large fragment reaches 15.57%. Therefore, a method for identifying gene copy number variation more accurately is important.

Disclosure of Invention

The invention aims to provide application of a substance for detecting whether the exon 11 of the CYBB gene in a human genome to be detected is deleted or mutated or expressed.

The invention provides application of a substance for detecting whether a CYBB gene No. 11 exon in a genome of a human to be detected is deleted or mutated or has an expression level in preparation of a product for assisting in detecting whether the human to be detected has chronic granulomatosis.

In the above application, the 11 th exon of the CYBB gene is the 37665640-position 37665786 of the X chromosome (i.e., the 26310-position 26456 of the sequence 1).

In the above application, the substance is 1) or 2) as follows:

1) the substances comprise related reagents or instruments for high-throughput second-generation sequencing of CYBB genes in human genomes to be detected;

2) the substance comprises a primer for amplifying the 11 th exon of the CYBB gene in the genome of the human to be detected or a PCR reagent or a kit containing the primer.

In the application, the primer for amplifying the CYBB gene No. 11 exon in the human genome to be detected consists of the following a and b:

a. a single-stranded DNA molecule shown in sequence 4 or a derivative thereof;

b. a single-stranded DNA molecule shown in sequence 5 or a derivative thereof.

The substance shown in the 2) also comprises a primer for amplifying the internal reference gene CSF2 RA;

the primer for amplifying the internal reference gene CSF2RA consists of the following components c and d:

c. a single-stranded DNA molecule shown in sequence 8 or a derivative thereof;

d. a single-stranded DNA molecule shown in seq id No. 9 or a derivative thereof.

The derivative of each of the above single-stranded DNA molecules is a single-stranded DNA molecule obtained by deletion, mutation or substitution of 1 or several bases.

The application is as follows: detecting whether the exon 11 of the CYBB gene in the genome of the human to be detected is deleted, mutated or expressed, if the deletion, mutation or expression level of the exon 11 of the CYBB gene of the human to be detected is reduced compared with the human not suffering from the chronic granulomatosis, determining that the candidate of the human to be detected suffers from the chronic granulomatosis, and if the exon 11 of the CYBB gene of the human to be detected is not deleted, mutated or expressed, if the deletion, mutation or expression level of the exon 11 of the CYBB gene of the human to be detected is not reduced compared with the human not suffering from the chronic granulomatosis, determining that the candidate of the human to be detected does not suffer from the chronic granulomatosis;

in the embodiment of the invention, all exons 11 of the human CYBB gene to be detected are deleted through sequencing.

The detection of whether the 11 th exon of the CYBB gene in the genome to be detected is deleted or mutated or expressed is realized by the following method:

the method A comprises the following steps: directly carrying out high-throughput next generation sequencing on CYBB genes in a human genome to be tested;

the method B comprises the following steps: taking the genome of a human to be detected as a template, performing Q-PCR amplification by using a primer pair consisting of a primer shown in a sequence 4 and a primer shown in a sequence 5, and performing human control without chronic granulomatosis, wherein if the expression level of an amplification product of the human to be detected is lower than that of a human without chronic granulomatosis, the CYBB gene No. 11 exon of the human to be detected is deleted or low in expression level; if the expression level of the amplification product of the human to be detected is not lower than (equal to or higher than) that of the human not suffering from the chronic granulomatosis, the CYBB gene No. 11 exon of the human to be detected is not deleted or the expression level is not low.

The Q-PCR amplification is detected by using a Roche LightCycler480 real-time fluorescent quantitative PCR detector,

in an amplification system, the final concentration of each primer is 200 nM; the amplification procedure is shown in table 3 in the examples.

The invention also aims to provide a product for auxiliary detection of whether a person to be detected has chronic granulomatous disease.

The product provided by the invention is the substance for detecting whether the 11 th exon of the CYBB gene in the human genome to be detected is deleted or mutated or expressed.

The invention also aims to provide a kit for assisting in detecting whether a person to be detected has chronic granulomatous disease.

The kit provided by the invention comprises a primer for amplifying the 11 th exon of the CYBB gene in a human genome to be detected or a PCR reagent containing the primer.

In the kit, the primer for amplifying the 11 th exon of the CYBB gene in the human genome to be detected consists of the following a and b:

a. a single-stranded DNA molecule shown in sequence 4 or a derivative thereof;

b. a single-stranded DNA molecule shown in sequence 5 or a derivative thereof.

The derivative of each of the above single-stranded DNA molecules is a single-stranded DNA molecule obtained by deletion, mutation or substitution of 1 or several bases.

The kit also comprises a primer for amplifying the internal reference gene CSF2 RA; the primer for amplifying the internal reference gene CSF2RA consists of the following c and d:

c. a single-stranded DNA molecule shown in sequence 8 or a derivative thereof;

d. a single-stranded DNA molecule shown in seq id No. 9 or a derivative thereof.

The kit may further comprise a primer pair for amplifying exon 10 of CYBB gene and a primer pair for amplifying exon 12 of CYBB gene.

The primer pair for amplifying the 10 th exon of the CYBB gene consists of a single-stranded DNA molecule shown in a sequence 2 and a single-stranded DNA molecule shown in a sequence 3.

The invention discovers that the deletion or expression level of the 11 th exon of the CYBB gene is related to the chronic granulomatosis for the first time, simultaneously designs a primer pair for detecting the deletion or expression level of the 11 th exon of the CYBB gene for the first time, adopts real-time fluorescent quantitative PCR (polymerase chain reaction) for amplification, and identifies whether the 11 th exon of the gene is deleted or the expression level is changed, thereby assisting in judging whether a human to be detected has the chronic granulomatosis.

The primer and the real-time fluorescent quantitative PCR method adopted by the invention have the advantages that:

(1) the invention adopts a real-time fluorescent quantitative PCR detection technology, and designs a brand-new CYBB gene and an internal reference primer for detecting the change of the expression quantity.

(2) The invention carries out high-throughput detection, carries out detection on the same PCR plate, adopts a 96-well plate reaction system of 8x12, and can accurately, quickly and efficiently detect the expression quantity of a plurality of patient samples.

(3) The invention greatly reduces the cost of detecting the CYBB gene expression level and improves the accuracy of detecting the gene expression level.

(4) The principle of the invention can be applied to any existing fluorescent real-time quantitative PCR instrument, is convenient to use and is easy to popularize in a large range.

(5) The detection method can simply and rapidly detect the expression quantity of the CYBB gene, the minimum detection limit is 1 ng/mu L, the time is short, and the result obtained from the sample submission can be completed within 3 hours.

In a word, the primer and the experimental process can simultaneously detect 3 variations related to the CYBB gene expression level under the same reaction condition, have strong specificity and short time consumption, and can finish the detection of a sample to obtain a result within 3 hours. 40 PCR cycles (384-well plate) are completed in 40 minutes, can be applied to relative and absolute quantification, and can be combined with the latest gene scanning based on a high-resolution melting curve to realize accurate, rapid and economic detection of the copy number variation of the CYBB gene.

The method adopts a real-time fluorescence PCR method to detect the change of the expression quantity of the CYBB gene, the real-time fluorescence PCR method has high sensitivity, accurate typing, simple and quick operation, the used instrument is easy to popularize and popularize, and the method can also quickly detect a large sample quantity.

Drawings

FIG. 1 is a family diagram of a patient;

FIG. 2 is a second generation patient order graph;

FIG. 3 shows the expression levels of exons RT-Qpcr of 10, 11 and 12 of patient family CYBB genes.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 obtaining of pathogenic mutations

1. Sample collection

The applicant collects samples of 3 chronic granuloma families (fig. 1, chronic granuloma patients, patient fathers and patient mothers) and normal persons (non-chronic granuloma patients or healthy men in families) from the department of immunization of children hospitals in Shenzhen city, wherein the samples are specifically venous peripheral blood of persons to be tested, and all family members participating in the research of the invention sign informed consent.

Patient information: the male is repeatedly infected, the left axilla is wrapped for 1 year and other symptoms, the conventional leucocyte fluctuation of blood is monitored to be 17.11-35.43 multiplied by 10^9/L during the hospitalization period, the CRP fluctuation is monitored to be 43.48-109.05mg/L, the humoral immunity function test, the lymphocyte immunity analysis and other test results are comprehensively analyzed, then the immune function is suspected to be abnormal, the chronic granuloma is suffered, and the genetic test is further carried out for accurate diagnosis.

2. Target area capture and high throughput sequencing

1) DNA extraction, library construction, sequencing

The main process is to enrich the DNA fragment of the target area by using a capture chip and then carry out sequencing by using a high-throughput second-generation sequencing platform. In the research, a target sequence capture chip (MyGenosics, the probe of the whole exon is P039-exon, Beijing Makino gene science and technology, Inc.) is adopted to capture the exons of about 24000 genes in the whole genome range and the 50bp regions of the upstream and the downstream of the exons. The specific process of capture is as follows: randomly breaking the genome DNA of a patient into fragments, linking the fragments with an Illumina PE adaptor oligonucleotide mixture, performing link-mediated Polymerase chain reaction (LM-PCR) amplification and purification on the products to obtain a DNA library, performing quality detection on the DNA library, hybridizing the PCR products with a target region capture chip to enrich a target region sequence, sequencing the captured sequence by means of an Illumina Next 500 sequencing platform, and performing primary processing on original data, wherein the primary processing comprises image recognition and sample distinguishing.

2) Biological information analysis

The raw sequencing data were freed of contaminating and linker sequences, the filtered sequences were then aligned to the NCBI database human genome reference sequence (hg19) using BWA software (http:// bio-bw. sourcefor. net /), and information about Single Nucleotide Variations (SNV) and insertion and deletion mutations (INDELs) was analyzed using GATK software (https:// software. broadinfection. org/GATK /). All SNPs and INDEL were then annotated by ANNOVAR software (http:// ANNOVAR. openbioinformatics. org/en/latest /). Mutation sites with a frequency of less than 0.05 were screened out from normal human databases including the thousand human genome project (http:// www.1000genomes.or /), outer Variant Server (http:// EVS. gs. washington. edu/EVS) and EXAC (http:// EXAC. broadnattitute. org /). Missense mutations were pathogenicity and conservation predicted using SIFT (http:// SIFT. jcvi. org /), PolypPhen-2 (http:// genetics. bw. harvard. edu/pph2/), MutationTaster (http:// www.mutationtaster.org /) and GERP + + (http:// mendel. stanford. edu/SidowLab/downloads/GERP/index reading. html) software, changes in the splice site were predicted for harmfulness using SPIDEX (http:// www.deepgenomics.com/SPIDEX) software, and final pathogenicity assessment of genetic variation was based primarily on the sequence variation standards and guidelines issued by the American society for genetics and genomics (ACMG) in 2015.

3) The result of the detection

By searching databases and comparing the phenotype and clinical symptoms of various pathogenic genes in the classification standard issued by IUIS, the inventor finds that compared with normal people, the mutation is suspected to be homozygous deletion of the No. 11 exon of the CYBB gene of a chronic granulomatous patient, and as a result, as shown in figure 2, the mutation causes the truncation of the CYBB encoding protein, and the protein truncation influences the function of cytochrome B, so that the macrophage NADPH oxidase can not normally work, and the patient shows recurrent systemic pyogenic infection. The gene is located on the X chromosome and belongs to X-linked recessive inheritance.

Example 2 determination of exon 11 deletion in the CYBB Gene and its use for the identification of chronic granulomas

1. Design of Q-PCR primers

According to the Human genome version of Human GRCh37/hg19, the CYBB gene corresponds to the NM-000397 transcript sequence (the nucleotide sequence is sequence 1), the CSF2RA reference gene and the CYBB gene exon 10 (chrX:37664259-37664421), the exon 11 (chrX:37665640-37665786, the sequence 1 at position 26310-26456) and the exon 12 (chrX: 37668820-378944) are designed into amplification primers respectively, the design principle is that the number of sites is within 5, the length of the fragment is 80-200bp, the GC content of the sequence is 35-65%, and no special complex structure is predicted structurally; the corresponding sequence primers are shown in table 1 below:

TABLE 1

Numbering	Name (R)	Sequence of
			Sequence 2	Exon 10F	CCTTCAGGATAGCGGTTGAT (sequence 2)
Sequence 3	Exon 10R	TAAGGCCCTCCGATAAATGA (sequence 3)
			Sequence 4	Exon 11F	ATGCAGGAAAGGAACAAT (sequence 4)
Sequence 5	Exon 11R	CCTTACCTGAGACTCATC (sequence 5)
			Sequence 6	Exon 12F	AAGACTTTGTATGGACGG (sequence 6)
Sequence 7	Exon 12R	GGTGACAGACTCCTTACT (sequence 7)
			Sequence 8	Internal reference F	TGGTGATGTTAGTGGGAGCA (sequence 8)
Sequence 9	Internal reference R	GCCCTGTTCAAAGTGTGGTT (SEQ ID NO: 9)

2. Q-PCR amplification

The Realtime PCR was specifically performed on a computer, and referring to Roche 480 manual, Q-PCR amplification was performed using the genomic DNA of the patient with chronic granuloma and the parental genome DNA of example 1 as templates, respectively, and using the primers shown in Table 1. The experiment was repeated 3 times and the Cp results for the parallel groups were averaged for Avergage Cp. Then, the delta-Ct value obtained by subtracting the reference gene from the gene to be detected was subtracted, the delta-Ct value obtained by subtracting the delta-Ct value obtained by the control group from the delta-Ct value obtained by the experimental group was subtracted, and the final result was obtained by using the excel formula ═ POWER (2, -. DELTA. -delta. Ct) (. DELTA. -delta. Ct here is converted to an actual value).

And calculating the relative expression quantity of the CYBB of the detected object by using the expression quantity of a certain exon of the CYBB gene of the control population.

Delta Ct of test sample

The Q-PCR amplification system is shown in Table 2 below:

TABLE 2

The procedure for Q-PCR amplification described above is as follows in Table 3:

TABLE 3

The results are shown in FIG. 3, where the relative expression amount of each exon of the CYBB gene in the other samples is 1 in terms of the expression amount of each exon of the CYBB gene in the normal control (male), relative to the expression amount of each exon of the CYBB gene in the normal control (male); the abscissa is divided into 3 groups from left to right, wherein the 1 st group is a normal sample, the 10 th exon of a patient, the 11 th exon of the patient and the 12 th exon of the patient, the 2 nd group is a normal sample, the 10 th exon of the father of the patient, the 11 th exon of the father of the patient and the 12 th exon of the father of the patient, and the 3 rd group is a normal sample, the 10 th exon of the mother of the patient, the 11 th exon of the mother of the patient and the 12 th exon of the mother of the patient; it can be seen that the relative expression amount of exon 11 of the proband (male, i.e., patient) CYBB gene is 0, and the relative expression amounts of exon 10 and exon 12 are 1; the relative expression quantity of the 10 th exon, the 11 th exon and the 12 th exon of the parent of the patient is 1; the patient's mother was female, containing 2 x chromosomes, with the relative expression of each exon being 2-fold that of the father.

Therefore, whether the human suffers from chronic granulomatosis can be determined in an auxiliary way by detecting whether the exon 11 of the CYBB gene to be detected is deleted or expressed, and the specific steps are as follows:

detecting whether the exon 11 of the CYBB gene in the genome of the human to be detected is deleted, mutated or expressed, if the deletion, mutation or expression level of the exon 11 of the CYBB gene of the human to be detected is reduced compared with the human not suffering from the chronic granulomatosis, determining that the candidate of the human to be detected suffers from the chronic granulomatosis, and if the exon 11 of the CYBB gene of the human to be detected is not deleted, mutated or expressed, if the deletion, mutation or expression level of the exon 11 of the CYBB gene of the human to be detected is not reduced compared with the human not suffering from the chronic granulomatosis, determining that the candidate of the human to be detected does not suffer from the chronic granulomatosis.

In the embodiment of the invention, all exons 11 of the human CYBB gene to be detected are deleted through sequencing.

The detection of whether the 11 th exon of the CYBB gene in the genome to be detected is deleted or mutated or expressed is realized by the following method:

the method A comprises the following steps: directly carrying out high-throughput next generation sequencing on CYBB genes in a human genome to be tested;

the method B comprises the following steps: taking the genome of a human to be detected as a template, performing Q-PCR amplification by using a primer pair consisting of a primer shown in a sequence 3 and a primer shown in a sequence 4, and performing human control without chronic granulomatosis, wherein if the expression level of an amplification product of the human to be detected is lower than that of a human without chronic granulomatosis, the CYBB gene No. 11 exon of the human to be detected is deleted or low in expression level; if the expression level of the amplification product of the human to be detected is not lower than that of the human without the chronic granulomatosis, the CYBB gene No. 11 exon of the human to be detected is not deleted or the expression level is not low.

SEQUENCE LISTING

<110> Shenzhen city children hospital

Application of <120> CYBB gene exon expression variation in auxiliary identification of chronic granulomatosis

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 30840

<212> DNA

<213> Artificial sequence

<400> 1

atggggaact gggctgtgaa tgaggggctc tccatttttg tcattgtaag taccaacaag 60

agataagtta taaattctct gacttctcgg ggttatcttg gaactaaaat agaccaaagc 120

ttttttgttc atttgaggaa ttgtgttgaa actgatttac catgtgaacc tatatctatc 180

tgtaaacaga ctgagtccat tcttccaaat tccttaatgg aaagaacata tctgggggct 240

cacttctagc ttacttctga attcctagga ggaataaatt agccagcatt tcgcagaagg 300

agtagaaaat atttcatgct aatgatctct gattctgagt tgtttagtaa tgtttactca 360

gacgcacatg tctatgtgtt tatactactt taaaaatgac aaattgaaat tttataccat 420

tttctaaata aaaaatataa gattgactca tgtatgggaa gtaggccttt atttcagtaa 480

ttacactaaa tataataaaa cttctcaaat ttattttcaa aaacaagtac cttctttttt 540

cagagatcta aacttgagtt atttataaga tttataaaaa ttcaaaagaa cagaattgaa 600

ataagtcatc tagattcata aatatgtagt atgtatattt atatataatt gtatatatat 660

ataaatcaat atagtctgga gaaactatgt aagtaaagat atagctaatt tacaagtgga 720

cagaatgatt tctgtacttt ttaaaacaaa gaaaatcaac tgttctctta aaatggtgtt 780

atcagcaaag caataatgga caaattgggt agatagaaat acgattttta aatagccttt 840

ctaaataacc aatagaagca ttacacagat gttaaaaagt acaattatga atggaatatg 900

aatggagctt ttgtaaaaat ttatcatgaa aaataatgag tctttgagtt ttaaatatag 960

aaagcaatta gtggcacaaa taaaaacaac aaatattttg ttataaaaaa tgtttacgcc 1020

aaaccaacat tctactgcaa cagagaattc ttccgagtat tcgaagctgt aaacttaact 1080

tcttatcacc atttttaagg gcaaataatt tctatagaaa gtaagttcaa attaaacttt 1140

tagctctcgc cacaattttt cccaggaaat gacctccttc taaattatat actcatgcac 1200

ttgaaagtga aaacacagct tggaaagtca gagtaaagaa agaatgacaa gatcaggaaa 1260

ttgggaagtt gctttagcac ttttttcttt gtaaagagag aatattatca agtgtctaga 1320

gcatataata gcttcaaagc atagttgaga aaagatcact atggagctga aggtagagaa 1380

ctgggtagtg tgaccacttg atccagtcag tgcttaggat aaaatgaact gtcatgatct 1440

agaaagctgt ttttgttgta aatcccaagc ccctcactat gctcaatatt ctctccttga 1500

agcattaagt aaaactaatc aaggaaaatg gaaggcttgg cattttagct gatgagaatt 1560

cactagctgg attactgtgt ggtagaggga ggtgattagc acctgtgaga acagaacgca 1620

gtgtcatact ggtggaggga aagcaatagt aatatgttcc cttcctttct cattttaagt 1680

ggagtggcct gctatcagct acctatccaa ggttaagcaa aagagagggg aaaaaaaggg 1740

agtggggtaa tgtaagactg ataatttggt atactggcca aatcataaaa caatcatggg 1800

gaacaacaca gggtggagag gttttaatta tagacaagtg tagtgacact gttgaggaaa 1860

gagctggctc taagctggtt atatccagct ttgtcactac ctttgtcaaa gttggacttg 1920

gggaagtcct gacccttatc tgactccagt cttgtgtgga atctactgtg gaaatgcgga 1980

aacttcatgc aattatttct gtttgtgcag ctggtttggc tggggttgaa cgtcttcctc 2040

tttgtctggt attaccgggt ttatgatatt ccacctaagt tcttttacac aagaaaactt 2100

cttggggtaa gtataaattc catcccatgc aatattggct ggttcacatt tctcatcaga 2160

cattcttgtt catcttcctg ttagcatttt aaatacatat tctgaccaac ccaaacagta 2220

ccattagcct cactccctcc attgcaactt cctgggcaac agtcacttaa agccttccag 2280

tctgggacca acaaaagtgg ggcagagggc cccagtggca tccttcccca accaagaacc 2340

atgtgccatt gtttagctta aaggagaaat ctaatactca ctctgaaatg gaagggcagg 2400

ttggagcaat ccatccagga gtgacacatg tgggacaagt gggactttcc atattttcta 2460

agtcacctaa ttcctagtac ttttttgcat gaagagctct gctcctaatc acatgttatg 2520

aaatgatctt cagaaaataa atctctctct acatataaag actcgaggaa cttgctcaag 2580

ggccacatct gttgactagg acagtagagt gaaggccctt cagtttcctt gggtccttta 2640

gtattctgag tttccttgaa ctgtcaggcc tcttgcctcc agaagacatc tgttacatca 2700

tgctgaaact atgaattaat tgcttaatat taattattat aagtattata aatcataaat 2760

aaataatttt agcatataat tatgctagat cattataatt gttgttagct tattcacatt 2820

gatgctttct cccgccaaaa tatgcaactt ctttagacat tacaaatata ataattataa 2880

tgccaaagca ttataccata ccaatttaag atactgttaa gatcaattta agtgctaaga 2940

aaatatttaa aatctttaaa agtcttgata cttaactcta gttaatgata tgcaccttaa 3000

gtgttaaaga gaaagtgaac tgttgtctgt aacttacttt gaaatgcatc aaaaattaga 3060

tgagttgatg gatggataca ggaatggata gatagaatgt gataaagcaa gcataaaagg 3120

tataatctgg gagatgaata aacaggtatt tattgtaaat ttccttcaac ttgtctttat 3180

gtttgaacat tttaataata aaatgttgaa ttagggcaaa aggtcaattt cagatgaaaa 3240

caaagggtcc tagctagccc taaaggaaaa ccgttggctc tgaaggacct tcctgtacag 3300

atcacttggt gtctctggtg tgtggcctca tgctaagaac cttggggaag tggggacagg 3360

gcatattctg tgctcaaaaa agtcactctg ctccctttcc cgcctcttct agtcagcact 3420

ggcactggcc agggcccctg cagcctgcct gaatttcaac tgcatgctga ttctcttgcc 3480

agtctgtcga aatctgctgt ccttcctcag gggttccagt gcggtaagag aaaatgtttt 3540

actaagttcc tctaattttc aaaggccatc aagcaaaatg ccctttttta ggtaaaaaca 3600

aatgaatgat ttgggaggat tccagcttct gtagaatact catgagccaa gccattatct 3660

agtatatttc tgtgctattt ggggatggag ctccctaaga caactatttg gaaaacaaat 3720

tttgaaaaaa cacacaaaac cacctatacc tcaacagtag caatgaagta gcacacacgt 3780

acacgtttac acacacacac atatatatat gatagatatg catatataca gagctttagg 3840

aagttgacat gtgatatctg ggagttaatc tttcagtgtc attcaaaaaa atttaagtca 3900

gaggaaatat cttctgtgga taatatctca aggagatgga gtcaatggac agagtcacac 3960

tataatgaat gtaaccaaga agtgttggct tcatggaact ggggagcata gagctttcta 4020

aatgtccaga attcctttga ctctcactcc aacaatttag taagccacta aatgtactgt 4080

gctagaaggg ggaaaaaata agtaggaaga atctctgtaa cccataaaat ggtatacaaa 4140

tttcttacta gtattattgt acaaagatga caaacaagga acttaaaatc tacaagtgta 4200

ctcaaataaa tattatacaa agcaaaatat gatgggttcc acaaagcttt acaaataaaa 4260

tactatgggg aagcaagaga gaagttgtgt caggtggggc agagaatgaa gaagggcatt 4320

ttagagaagg tgacattaga gatgagtata taaaaataag cttctaagag gtgtaaagga 4380

gagagaaagg cattctatgt ggagaagatg gcatggacag aagcacagga aatagtgagg 4440

aaatcgtatt cttgaaggcc aagaattggc atagccttgg cttctctttg tattattatt 4500

ataaatattt ttttgccacc tgtgaccaca ccaaagaggg tagctgggaa aaaagtaggg 4560

attggtgtcc tggtgggacc aattccgtgg ttcattaatg actagtagct tctaggtttt 4620

ttttaaaaaa taaaaggtat agtaagcttt ttgaaaaaaa tacttattaa gtagagatca 4680

cttatggagg acagcagaaa gcaaactact tttgtgggaa tgtagggatt gtacagggca 4740

gatgcctgac ataaggctgg agaaaagagg taggatttta ctggtaaact agaactgcat 4800

atgtatagtt gaggagttca tgcttaattt ggcaattaca gaatatttga aggaggcagt 4860

gaactaaact gtaataacaa gcataacttg ccttgaactc tgcctcattt ttcctagtta 4920

cactaaattc atgctgatcc agagaatttt tttctttaag aacatataac attcaattta 4980

ctaatatagg actagaggct ataatttagc ttttatttta tgacttaact atttacaaaa 5040

taccatttca tcttaaacca actgccaaaa ttgggctctc acaaatctaa agtacaagtt 5100

ggcagaaata actgttacac cttcgcttcc tcagaaaaag aagaatgttg ataaccaatt 5160

taagatgttc cagaaagagt cgtgatatct tcctctgaaa aattctgtga tgaggttcct 5220

ttccttaagc cataaattct atgctacgca atgttgtctt gcaaactgag agctaaccaa 5280

aaccaaaaac taacaacagt acttggtatt aaacattgat tacaaggatt tccaaaaaat 5340

cttccaaatt taagaaatca cagaggtaaa attacactca attgaaagtt ttattaatga 5400

gccacctatt gtaaagtata acgtttaata tatcgtaagt gcccagtgaa catttgctaa 5460

atgaagccca tgcactatag cttatttttg agttgggttc tctatcaccc aggctggagt 5520

gcagtggtac gatcatagct cactgcagcc tggaactcct gggctcaagt gatcatccct 5580

ccttgacttc catacatgtg gggattacag gcatgagtca cctgcctggc gagttccttg 5640

tttctaagga gacacaattc atttttattc tccctacccc cattagaata gtttctattt 5700

agaggaagta aagcctgaga aacaggcaat gttttcacca agatggcctg ttaagaaatc 5760

ttggttagtc tacaagtcca aatttcactg ccggtgagca ccatgtccca tgagcagcac 5820

atgttgtaat gccagctttt atgcctcctg tgacccagga gggaagatct gcatgagagt 5880

ctctaaagac agggatgaaa tgagactgcc cttcaaatcg cagagaagct tggctgtata 5940

actacataga tctttatata aaagaatatg ttttaaaact atcagcaagc aacattcttt 6000

tatagatcaa gcatgtactt tcttctggga ttcctaacct gaaatgtgaa cttttctaat 6060

aaaacttctt ctgtgattgt gattaaaatg agtgagtgtg ctgtaactaa tgttggaaat 6120

catatagctg ccactcattg aagcttaatg gaattcaccg catgaaatct gcacatcaaa 6180

ccagtaaagt gggaacaaaa ttaaatggaa gtgttggcat tcaaacccag gtcattgtgt 6240

ccccagagcc cattcacttt aaatcatgct gccaaaactt cttgaaattg tgctgttgca 6300

gtattatgat cctagaaagc cattatatat atgagtgttt gagcatgcca agtaacctag 6360

actagaaatg acaaggatgt tataaataca aggacttaat agtaggacac tatataagca 6420

aaataaccac gaacttgcat tcagtttcta gaggtctcaa tcattgaaac tttgctttgt 6480

aatccttctg gttacctaga gaaagaaagc cccagggttg cccaccccac cactccagga 6540

aaggtagggg taaaggctct cagactgctt tgttgagaaa aatggagaat gggtgaagct 6600

cagcacacaa aaatctctga ggaagcctta aaaaccccca acttgccatg cagaaactaa 6660

tttctgtctg gatggcagtc ctagtcttaa gatcagaaag aaacaggaag gtgagagggt 6720

gaggttttat ctgttacctt atatagtctg ggagtcagag gcactcagtg tgcctctatc 6780

tttaatcacg tggtctagca ctagtctctt gggctttctg tctcatagtt ttttttttta 6840

gttgaaaaac aggtcaacta acacaaatgt aagaaggcat atgttggtct aaaagtatat 6900

taattgttta agtctgtcaa ttagtgagtt gtcagtcaat aaatatttgt tgagtgccat 6960

ttatgtgcta agcactgggg acatgtggta agtaaagatt aagttataga taggccatga 7020

gcttaaggag cttagagtgt taacaggaga gacagagaat aaatatggaa cttccaaatt 7080

ataaacagtg ctatgcaaat aaggtagtgt tattcatatt tatcagatat tctactgcca 7140

gcaggtgtgg atattactgt caacttactt gcctgagttc tgtagattca aagttggatt 7200

ttgtaatttc tcccagttgc gtataaatat ctaaatcaga tacattgatg gtgcgtgtgg 7260

tgagatcaag tgtacaaaaa gtagagcttt tgagtttctg taaagtgtta caccccataa 7320

aatatgtact tctttttagt tccacttccc attttcttga aatatttttt tcttactcag 7380

tttcaataga gcatagaaat ctgctgaagt gactcaataa tctcccttgc attagaatgg 7440

tagtttattg aaatcgggca aggcttccgg tgacagtaac agagaaactt ccctttagaa 7500

gtcaatggca gaaagtaaag taagttagta aggaagctat ggggcatgat ggcaacgtgg 7560

ataattggga agtggctggc aataatttag aagtaactca aagcatataa atgcaatctg 7620

cctgatgatg gggaacaaaa aattatgggc agtcacagac agtaaagtcc ttccttccta 7680

tgccaccaac cggttgtctc gcctcctttt ttaaggaagt ggtgaggaga tggtattctt 7740

aaaagcccag tatcagcatg acttgtggct tctttttgga tttgtttgcc attcctgtcc 7800

acaccaaaga gggtaggtgg gaaaaattag ggatttgtgc cctgatggtt ggacccactc 7860

cactgatcca ttagttacta gtaatctcac tttttccttt caatataata tatgtgtttt 7920

acattaacta gctttttaaa aattacctat taagatgaaa cagagtatca ttgaatggac 7980

aatgtatttc ccaatcacat ctctccactg ttctggcttt cagttaattt ttctctaagg 8040

atctacagtt aaagctatca gggggcatca acatatatta ttttacattt tttatgatcc 8100

atggtgatta tgatgataag gataggacta tgaagacagt gtatgttcca caacaaaacc 8160

atattcgttt gctttaaatt cggcgtgcag gagccagtga attttcccca aaaaatttca 8220

aaaggatttg tcaacaaata gaaaagaaca gtgtgtggca agtatagaca tgggggtaaa 8280

ttcatctcta taggtttagt atgatcatct ccagttccag ggcatgaaaa tgtacttcat 8340

ttatgcagcc aaataatgat taaaagattt ttttaagtac atgacatact gtttttcaca 8400

caggaagctt acctgctagc tggggagtgc agccttacta actgaaaact taaataatga 8460

tactaaataa catcaaatat tgattaaata cctgtcaatg aatatatgca atagggattt 8520

gagggactaa ctatgataat tatacaggtg aggaaactgg agactgagta tgttgttcga 8580

tgtcacacgg ctaggtggga ggactgggac ccaacatagg tatatctgaa gacaaaactt 8640

gctctgaaat gtgtaattca gtactgcttt ccaaccctac taattctcat tctctgattc 8700

tttggactcc aacctagttt caccactcct gtaaggactg tatcaatcat ctatcgtgta 8760

acaaattacc acaataactt aaaacaaccc ctgtttatta gtttacagtt ctgtaggtca 8820

caagtccagc acccagttgc tgggttctct gctcagagta tcataagact gaaatcaagg 8880

tgttttctgg gctgaattcc cacctggaaa ctctaagtaa aaaccctctt ccaagctcat 8940

tcttgttggc agaattcagt tcattacaga tgtagcacta gaggtccctg tttccttgct 9000

ggtgatcatc tagggtccac tcaaatccta gatgttcctg cattccctgc cacatgccct 9060

cctccacctt ccaaccagca gcagtgcttc aaatctctga cttcctccat ctctgacttc 9120

taaacccaga tttaaagagt tcatgtgatt gggtttgttg gcccagataa tctccctatt 9180

aaagtcaact tgggacttta cctctgcaaa atcccttttg ccatataatg taacaaaatc 9240

acagagtgat gtctcatcat tttcacaggt ccaaactcaa ggggaggaga ttatataagt 9300

cattgggggt cattctagaa ttctgtctac cacaaggact ctcagaaact atagaggaaa 9360

ttaagttgaa atttaagaag ccaaagaaag aaagaaggaa agaaagaaag aaagaaagag 9420

aaagaaagaa aggaagaaag aaagaaagaa aataaataaa taaataaata aataaactat 9480

aaaggaacat ggcaattggg aaacaggaaa aagttatttc ctcaaaattt taaggaatac 9540

aaagtagaaa ataattttca gcacttgtaa tgaacacaaa agacaaggag gctatataag 9600

aaaacaaaga tggtcaactt ttcaacaaca gatcagtaaa atgtatttta caaataaatt 9660

tttatttcaa aaacattaag tttgaaaatt tgtattttac aagtttttat ttcaaatagg 9720

aaaccattgt tttgagagtc tgagtcattg ctcagctcca ctggtgaaca tttaattata 9780

accaatgcat tggtgctcca ccatattccc taagcactgg cacttccaat ccatgcgaca 9840

actgcccttt gcaagcatca ttcactctct gcctggggat tttctttcag ctttctcctg 9900

gggcaagcct gaaatcccag gggattgatg tcctgagagc atccctcaga gcagccctca 9960

gccaatcatg gatggcagtt ggtggttgaa cacccaagct tcttaacccg ttaggtaaaa 10020

accaaagaac gaaacaaaca aagtaaatga ataaaaaacc ctttgggata agttctacac 10080

agtctcccag agttccctgg tgtgatcgag cccaatgata tgatatgatc atggtagctg 10140

atataataat gcactcttca ttaatttcct tcccagtctc atttttaccc tcgttttcta 10200

tgaccacctt ccggatagaa tacttacact taaattcttg tcacaggttt ctaggcactt 10260

agaataatag tgactatatt cctgcatttg gtttggtaga aaagggcatt aaccttttat 10320

agacaaatag acttggatcc cagccaatgt gcaattttag ctttagtttt cttacctgta 10380

aaatgaggac attaagattt accttgttgc attaaatgag taatgattat gggtaaacta 10440

cctagttcac agaaggaatt caataaagca taattttttt atttttcctt tttctggaat 10500

cctcagtgtc ttccttgcta ctatttctgt aatttcaaga acctgacctc atggtttaaa 10560

cttcctgccc tccctagtta tggctaactg agagatagat ggtggagtaa gcacaatttt 10620

ctgtgcaatt atattttcta caaaatcaga gtattttatt aaaaataagt aagccaaata 10680

ttaaacaccc ctatatttaa attgaataaa acatttagaa ccaaatattt taagtacata 10740

aattttcttt ggtacttcac tctcttgttc ttaaagttcc ctgaatctct gtgacagtgc 10800

atttagacta tggaacaaag caaccagagc aagacattgg ccagttttca ggagagccaa 10860

gctctaattc aaccataaat cagtttaaat cagttttttt ctttctttga gcattggcac 10920

gaattgagat tcaaactcac attttctaac atatgtaggt tcgtcaaata cactaaaata 10980

ctgagtacaa tagtattttt aatgccaaag gaaatcatgt aaagtatgaa atatcagaat 11040

gtttatataa actctagtat cagatggcct gagtttaaat cccagctctg caacttatta 11100

gctgtgtgac ctaaggctag gtaaactctc tatccctttg ttttctcatc tgttatgtag 11160

taataataat ggtacctccc ttgtaccatt attgtaagaa ttaaagagtt aatttgatta 11220

ttacattaaa gattaaatta aattaaatat tacatcaatt acattaaaga ttaatgtaag 11280

aattaaatta gtcaatgcat gtaaaacagt tgcagaagct cttggtaaat gttagctatt 11340

gttattttgg ctattagcat ttggtcaatg atctcccctg tgatgttgtt cacctacatg 11400

ggcaggtgta cccttctttc tcctctcata gtgtgtatgt cctagaacag tgttgtttga 11460

aaactattca cttgttctag aactgttcac ttgtctgtgt ccccacttga ctatgaggta 11520

tgtgatgtta atttctacat cctttgttta atgagtaaat taatcagaac tagaaactat 11580

gtagctagat atgttttttg tacaagttta tatttttata cagttaagca atggattcca 11640

gaggagactt tatgtcacca gtatgagaac agaaaacata ccagttaagc cagccatgtc 11700

acttactggc tgtttgacct gaggaagatg actgcatctc tctgaacctc agtttcctca 11760

tttatcaaat agatataatg atacagtttg cagggtggtc atgaaaatta aatgagataa 11820

tatgtatcaa atgtttgaca catagcaagc tttcctgtta acaattacta ttccattctt 11880

tcccccttaa tccaaagtgc tgctcaacaa gagttcgaag acaactggac aggaatctca 11940

cctttcataa aatggtggca tggatgattg cacttcactc tggtaagttt attaaagaaa 12000

acttggaacc agggagttcc ctctattcat agataccttt ttatatagga gatcaaccag 12060

ttttatagtt agattaagtg gtggttggat atgttgtatt tttttaatga gttttgctca 12120

aaagtattta ccacactttc tgccacttca atattaggat ttattccttt aggttttaaa 12180

gcatttttat ttcaggattt tcctataaaa atgaaaatat gccatcagaa aagtcaatcc 12240

tagtgtcctc accctttgct attctttcta gtgtcaaaaa tgttaattca ctcatgaaaa 12300

cttatttatt ctaaaaaaag ttcttggttg catgtgtgaa tttgtggact ttttgcagca 12360

aacctacagg agccatagcc cataaattga gaatccctca agacggtcat tatcagctaa 12420

ataccttcat tattattatt actattgtta ttgttattgc atgtatccat acaatggata 12480

tatatgtgtg tatatagata ttatatgtta ttattaaaat tattagggtg gtagtgtcag 12540

tgcaagaagg gctgtatttg ggacccttat ctaattccac taattcactc aacaaatcat 12600

tcatgtgcca gagaatatat aagcacagtg ataaagcaga cttgtactct gcccttaaaa 12660

agtctgttcc tagcctgagt aaaataggct tagattacag gcatttaact gagtttctct 12720

tctactagta gatctggcag gcttttttag cagtggcaaa taaatagttc aaaagaaata 12780

tatgataaaa tcttgttaga aactggcata gtgtacggat taagagcaca tatttgcgtg 12840

ccagaggtac tggatttgat tcttaactct gctgcttcct agcttgatga ccttgaacaa 12900

ggttttaaag cagtctatgt cccagcttcc tcacctgtaa gatgagctga tattaatagt 12960

acctacatca ttgagtcaat gtaaggatta agtcattgtg aagtacttat aacagtactt 13020

ggcatctagt aagccctatg taagtgttta ttaataaaga atgcaatttt taagacagag 13080

agattcatac cttatggcca taggtttgta tcaattcaat caaatttgtc atctctctct 13140

ggaggtaatt tcagagtcag gttaatgggc cagcaattag gcattcacta catgagtgtt 13200

ttcttgtttg agcccaaata tattatggag agagataatg agagcatatc taaacacctt 13260

cagaaactaa ggctattgtg tagaatctta taacttgatt gagtctttag gagcatatag 13320

ctcaacatct tcatcttaca aattaggaaa ccaagaccag agagttaagt cattttccca 13380

caattacaca actagagagg atcttaccca ctagaattgc cttgtctcct tggttctgga 13440

gacccagttc ttgtctataa gtgtcctggg cctccctttg tctccctgtg gcttatcata 13500

gagtcagagg ctgtcccaga aacccagctt acaataaatt tgttcatacc cttcattctc 13560

tttgtttctc ttctctgccc ttttcagcga ttcacaccat tgcacatcta tttaatgtgg 13620

aatggtgtgt gaatgcccga gtcaataatt ctgatcctta ttcagtagca ctctctgaac 13680

ttggagacag gcaaaatgaa agttatctca attttgctcg aaagagaata aaggtaagcc 13740

tctcattatc tgacttagat attctctagg ccattacaat tgaggactag atttcagtga 13800

gtgaagacct ctcctttgcc aaaaaaaaaa aaagttggct aaccatcaga gggacaagtc 13860

tgtaggttac aataatggga gtatagaaaa aaatgtctcc cacactcctc acctcatgtg 13920

tggaggtctc tagatgtttt ccaggtcttt aagctcatcc atgagaatgt gtgcatgtga 13980

agcctggagt aactcaggct tacctgtgac tatgcccacc agtcaaagaa agctgggaac 14040

acatgtctag tcgaacaagg tttggtttat tacttgctac agcaaaagaa atctcacacc 14100

ttgaggaact ctgggcatct caaggggatg taaagtggat ttagaattta ggattctgtt 14160

agatggtttg ggggaggatt taagaatgca aggattttct ctggatcagt tatggtcagg 14220

aattgggggt agttctcaga taaggtatct taattatttt ttctaggagg cagagggaac 14280

agaataggac taagtctata ataggcaaag aagcagtagt cattgtctag gctcagacat 14340

gattttggag tggttttgct tttatctcac tccatcacag tcacagagtg acctcctcag 14400

aagctggtgt tttgtgaaat tatttatgtg aagtagggaa catcctggcc taagtattag 14460

tgtaaggcca gccaccagct gacagttgtg tgatgccttt ttcttttctt accaacaaca 14520

tctgagggat ggcctgtgtc tacagattgt cattccttga gaagcacatg tgcactggga 14580

gtaactcagc atttctctag gggtagccag gagggtatcc agaagtaaga acttcttcta 14640

tcccagcagt tgttgaagct tcctacactc aaagacagaa gctccaagtc ttcatgcacc 14700

caatgacttg ggaagatgac taaatcacat taatatgcac tgaattctaa aaatgttttc 14760

ttgtgtttag aaaacatcct tagttttgga aaaaataatt attattctca gacttacatg 14820

agaaaaactt gcctgatata cttagggagg gaattaaaca gcatcataaa aaacagattt 14880

tttctacaat atattgggta atttttcttt tacattattc attgtttgcc caatgatata 14940

tgagggtggc aacattaaca taactaggta aatctacact atcatgctct attcagttgt 15000

tcctggatca cttttactgt atctatgctc tcctactctt ctaaatgttt tcattttcaa 15060

taacctgtaa ctgtttcctc ctcagaggac tgccctgggg ctactaaagt cccttttctc 15120

acaggctcag agatcttgga aggttggtgg ggggtggctg aatggttacc tgttcctgtg 15180

caaaccgtta gccaataact ggtggatgca gactatgaaa cctggcttcc ttgccttgag 15240

acaggataaa ctctaagttg taacttaccc tccagagttg ccttgcagga tcaggctgaa 15300

gctatcccct gtgagactgc ctgatttcac ccccttgctt gacttgtttg tcttttctat 15360

cctattccct actctcttac cagtttctct tggagcacat gttttctaag tcacttgccc 15420

atgaagtctc atctcaggat ctgcttctgg ggagcacagc tgatgatgtt cagcattccc 15480

agaatatatt tgcaaactaa gcactgtggc cctttcaaaa tcaaagggag aaagagcctt 15540

cagacacttt taggacatcc tgtagttgat tgatttcctt tattttctac ccccttagaa 15600

ataactattt aagtacatca gttcacattt cctatgacat cttaaccatg taagacattt 15660

taaaatttag aaacatctat ttcaaatcta tatctgtctg tgagggatga ttaggattat 15720

tcaaagaggg ggtgaaaata tctattgttc tatacattgg acactttata atagtcctgc 15780

atttgagaac ctataatatt gtgcttgcgc acatgtgtgt gtgtgtgtgt gtgtgtgtgt 15840

gtgtgtgtgt gtgtgtgtgt ttatatttta cagaaccctg aaggaggcct gtacctggct 15900

gtgaccctgt tggcaggcat cactggagtt gtcatcacgc tgtgcctcat attaattatc 15960

acttcctcca ccaaaaccat ccggaggtct tactttgaag tcttttggta cacacatcat 16020

ctctttgtga tcttcttcat tggccttgcc atccatggag ctgagtgagt gtttaaattc 16080

tgaagtgaag gatttcatgt ccctcaattt ctaggcagga tgctccatta gaggcacagt 16140

gacctccttg cctgtgtgtg gttagcctgt ctgctaaggg aatgtgagag gatagcagag 16200

gtcagtttga tagaaaccag tcaacattgg catttttgtt tcatgcaccc atgtaattgc 16260

tattcatggt gaagttatat atagcaagct tgaaaaatac accaaagtct gagtatcttt 16320

gcaaatgtat aaaacatatt gagagcactg gtaggatctg gaacatctgc aatgatatcc 16380

tctatggttt aatcactagt aaattaaaca aacctccaga ctagaagagt taatgattaa 16440

tcagttgaag aggtttgtta tagttcaata agttttgatt taagcccaca gtcatttatt 16500

tgttgtctac catgtatgag gacctatctc aggcactgca ggaaatacaa gcaggaaaaa 16560

tatgtggttg ttgccttcaa acattctaat ataatgaaag tagcagctaa cttctattaa 16620

gggtctgtgc taagggtttg acatgatata tttcttttaa cccccaaaat gtatagattt 16680

ctcactatca ccatttcttg gggatagtaa ttgcagacaa gaaacctgga gctaaaatgt 16740

taaaatatgc agcctaagcc acctctctgg taagtggccc agctgagatt ggagccaggc 16800

agtctaaagc aggctgtgat aaatgttctc ttagagacac acagttcctg gctatgtggt 16860

taggagagtt tgcctgattg gagatcctct ttcataccaa gtttcctttt ttgtgcagtt 16920

tcataccacc tgcacacaaa ggcaggcctg gggaagttcc ctggtgggta tagggctcca 16980

ggaaattagg gttggaggaa gtagaagctc aagactcact ctgcccagag cccagttggt 17040

ggccaagaca tgactgtgaa aaaggggaag ggtggggaaa gctgcattgg gcactgcatt 17100

cttaaactac ttgctgactg tgacccctga taaactcttt gtaagcatgg agaaatcaat 17160

ggagaccaag aatctgatga ctctcttaaa gcactcaaat atctttaaat gggacttagt 17220

cataatcccg tgtttcaggt aatcctagag aagagaaata atttcttccc ctctccaatt 17280

tagtaattcc accactttct gtttgtatgg tttcgcagat actcatcttc ctttgaagca 17340

gacagaggag atatgtttat ctccttctcc acttgaagag aatctgctct ttacactggt 17400

taggtgattt ctcacagtct catggctccg tagcagctga attgggttta aaatgcaggt 17460

ttctggactc ctggtcctgg cattgagaag agaaggagaa aatcagatta ttttcctatc 17520

atttacttac catgggaact taggcatttt gaactttaat agttattttt tggactctta 17580

ctttgtgtct ggcatttttt atacatcatg caaattgctt attataatga acctttaatg 17640

aggtactatt acatctgttt tacagctgaa ggaactgagg ctcagaagaa gttaaataat 17700

ttgcctgagt ccaccaaact agtaaggggt agaaatgaga tttgaaccca agtctgtctg 17760

acacaaaaca caattgtttt caccaaaaca ttctgctttg agttactaaa tcattctgat 17820

ttacattctc atgtaaaatg ggggtaataa tacttgcctc tcaggcttgt catgaggatt 17880

aactgagata atttgtgtaa aatgactttc cccaagcctg gcacatgata agtgctcaat 17940

acatgataat tctcttcccc aagacctaag gatagaaagg agtggttaat gaacttgaat 18000

taaaacattc tcagaataca ccaaatgaca caataaattt taggtctcca aaacaaacct 18060

ttacaatggg ttttctgtgt cttttcttct tatatattct gaagatgctg tcatttatgt 18120

tccttgaagt ctactcaacg ttgggccttc ctctctctat caccaataat tgtcttatga 18180

tttggtagtt gctcaactag catttattga attgaaatga atgggctctg agcaattcaa 18240

ggtacacact attagtgttg atgtctgtga gaatgttata atccctatat agttaagtat 18300

ctcaaactgg tttcaaaatt tggtttgatt tagataattt ccaaacccac aaataaggca 18360

cttcttgtaa gcttcagggc tactgtatat gactgtctca gttgtctact atagtgggtg 18420

cctggccaag gacaataaag ttagcccaca ctttgatgat tgagcccttt gcttatatct 18480

tcataggaag ggtaccattt tctaatttgc acaaaggcac tgtaggggcc agcagtcact 18540

ctgttagatt tgcaattttt ctgcttttgt ttgtttgtaa atgaaaatga tacttgagac 18600

agaagtagaa attctccctt aagagaattt gatccaacac ttaccctcta taatgttaca 18660

tgtaaatatc cctttggtaa ttgcacatat attttttctg ttgctgagtg ttatgcattt 18720

tctttccttt catctattca gagggagcaa taagctatcg cttttaagtg aaaagtacag 18780

ggcctacatc agagcactta aaatatatgc agaatctttt aataaaacaa tttaatttcc 18840

tattactaaa tgatctggac ttacattttt cacccagacg aattgtacgt gggcagaccg 18900

cagagagttt ggctgtgcat aatataacag tttgtgaaca aaaaatctca gaatggggaa 18960

aaataaagga atgcccaatc cctcagtttg ctggaaaccc tcctatggta tgtacaattc 19020

attgttgtta ttacagtttc attactgaca atctttaacc tgtgtctaag aaacatgtac 19080

agatgttata catctatata gatgtccatt acaaatgtca tggaacagct aaaacatgtg 19140

tctacttttc tctgctatac ttattggata gaattgtttc ttgaaaacta agctttgcat 19200

tgttctgtta ttaacatcct gatataaaac ttgggaaaat agtgttttta gaagtgctgt 19260

tttggttcaa gaagttccat ctcttttctt catgacgacg ccagctaatg atttttaggg 19320

ggacacttgg gattccatct tgagctgagt tggatagctc aaataaatca cttataagga 19380

gcaaagggcc tcttcagata ccagcacata atactttcta tacagctttc caatttgaaa 19440

aggaaattga tgaggtggta cataaggcta cctttaggca ttaggagttt tctgtttatg 19500

aggcataaag gaggctggac ggcgaggttc ataccaacat cccaatggca tcatgtggtg 19560

ggcagaagtg tggcaagggt gaccaaggaa atacatggtg aaatactttc ttccttctat 19620

tgggagctct gaagggttcc attttgtgta ttctcataac actgctccat agagtaagat 19680

gtgggccttg taatcttcat atcattttcc ccattggcag atggtatact ttgttggtta 19740

ttgtgctagc cattggtata aaactaggca aaaatcaaca tttgtgcagg gcttctgaag 19800

aggattattt ttttttcctt aggcacagta taacataaag gcaaattttc cattccattt 19860

tctcctttct tttttcctac tctcttagca taggagcact cttactctag acacagcata 19920

ctatatgaag acgtaggatc tttaagcatc ttttcccatt aatggaagca accagacata 19980

tcagtgaatt ggctccacta catgcagaca tcaatagaaa ggataaaaag ggaactgtat 20040

tgccaatcct cttgtgggca ggggaaggca catttcctcg atgacagctg gagtcagagt 20100

actagtacct tagcagaaac ctacctcaaa gaatttctag gtatactagc agcaatatcc 20160

aaatctggct ccattcagtg gggctccatg gtagcactca ggaaacagat agatgatttg 20220

agactgtttt atatatctat cccattaaaa caaaggccaa caacagaaca ttgtttatat 20280

ttggggcaaa tattcttcaa gtttggctga agatggagag attcaggtgc tctcaatttc 20340

caacagtaag tttcctataa aagtaatcta gtagaaagat tatatgtgag actatcggaa 20400

gcactctctt atcttttccc ccttagaata cattccggaa agtcattttt tagataatat 20460

tgctgtctaa aattctttgc tagtttaggt attaaactag aagtccaatt ggctgagttt 20520

caggatggat ctgtttgacc tcaatgtttt tatatggcca ataatgctac agagtaattc 20580

cagtgttcag aaacactgca tgttctgacc caagaaatag ctaaagaagt ctgaaaagct 20640

ctaggtttgt ctccattcag caagtgcatt gcatactccc agaatttctc agaatattgg 20700

agaaacagcc aaactcttgc ataaaatttg tcatcttgca aatttgtcac tgtgactaca 20760

taactaagag aaagcaatca cagtgttgca ttaaaaatat tgtgttgctg aaatgttatc 20820

ctttaaagaa atgttaattc tgaaaccaac cttgctttgt tatagggtta ctgcaactgt 20880

agttgcaaca ctgagaggaa atcccattct tgtgaggagt tcctcttggg aaagttttat 20940

cttgtcagta cagttcccca ttgtgactaa ggagaatgtt tacttttact ggctcaaaat 21000

tatcttagtt tcagatattt tcatatattc cattgtagaa gaaatttatt tatctaatgt 21060

caaatattta agcaagccta caaagattaa cttggcttct aaaatttttc tccctctgaa 21120

tattttgtta tctattacca cttaatgtat ctcattttca tttttgctct gattacagac 21180

ttggaaatgg atagtgggtc ccatgtttct gtatctctgt gagaggttgg tgcggttttg 21240

gcgatctcaa cagaaggtgg tcatcaccaa ggtactgatt ggtttagtaa ttactagtgg 21300

tcagtgtcta actatatcat ggacaagtct tcccaactcc tctatatcat tgatcagatg 21360

ttacaacaga gagaagacct acaatttatt tcaatttact tagctcaata atcaaatgtt 21420

tgagccttta actggggaaa ctacaagtta ccatttttga tgttaaaatg aagccaagtt 21480

ctttctggac atcaatctcc cccacccatt gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt 21540

gtgtgtgtgt gtttgtgtct gtgtgtctgt gtgtttgtgg aggggaaggc gacagaggca 21600

ttatttggtt agttaagagc agaaaagaaa aagaggtgag ttcaaagggg cataaattga 21660

gtcttaaaat tttcagatgc caaaagaacc agagatctaa gggtaggtct cactgaggct 21720

gagctagttt ttcaggttgt ctttaccacc ttttctgtgc tgtgtatgta ataatctaat 21780

aggaaagttg aagtgcccaa aatttcaaca agttagtaaa taagctgcct ctcaaatttg 21840

ctctcctaat tccaagtcta gagtggcttt tcctgaactc taatctgttt ctcatcacaa 21900

aataaataaa tatccaacta aataaatgta aatggaactc cttgttataa tttcaggaaa 21960

cactaggaaa gtctatcttt atcaaataaa atttaattca attcaactca gttcaaaaag 22020

tatttgccaa aaccctactg tgggttattt ttgcaaaaca cacaaattct tcctgtcctc 22080

caccctatct ttcctcattt gctgtctatg gtgggtcata gtaaagttag ttcagctggc 22140

tttggaagtc ttgaaatata ggaaaccaca acagttctcc ttttgtgata tttatattgc 22200

attataagaa caatcccaca gatcagcaaa aacagttgct gcaaaatttc ccttactaga 22260

ctagagatga ctgagtcaga caagtatttt tcttaaacat acctttaagg aaaacttgtt 22320

ttcctttgaa gaaaatagat atttgttttc ttctcatata aataaatatg agaaacaaga 22380

tgttatccaa aagtattcca atgagaatgc tgtccactta tttagttaca tctcatttgt 22440

gcctatgata gcaaaattgt aatatggtaa aaattttttc cacaacacaa aattgcaaca 22500

tggtaaacaa ttttcaacat aattttaatt ttctgttttc aaaatgaagc tttacaactc 22560

cttatttcag aacagaaggg aagtttgtta tagtttttat catgtaagat gcatttaaat 22620

cacaagttct ggaaacgttt gacatttttt taaaaaagaa tttttcactc ttccacaact 22680

ccctgttcga gaaaagccca gcaatatcag ttaacattag gaagctgcta ttttatttct 22740

attgattttt ctttcctttg atgtcccttg gtttgtcttt aattatacat ataaggttct 22800

tctagaagtc ttaggaatca tcaaagaaac agtatattac tttctgtatt gctcttcact 22860

gtgttctatt ttttaaaaaa attatccagt caatagttga tggacatttg gattgtttcc 22920

tgttttttgc tattatgaat aaagctgtta taaacgtgtg tacgtagaca gatgaggatg 22980

gcaatgggtg ggtagaaaag atggtgtact ccccaggtag ggagaaatgt agaaataacg 23040

catggaatca ggcagattca aggtgtgatt caggacaaag atagaccaac ttagttagtc 23100

ttgttttggg gaatgttgct acataactag tcaatgggat ctccttcttc tggccagcta 23160

ttaggttggt gcaaaagtta ttgcggtttt tgccattaaa atatggcaaa actgcaataa 23220

tttttgcacc aacctaatac taaggccctc tctcatcctc ttgggggata ggaaggctga 23280

gcaggaaaca tcagtttttg taaatttttt agcacttttt tgacttctga gaggaaaaaa 23340

aaatcacaat aggctgattt cttatgttgg attccctggt aaagactgag aaataactgc 23400

atgcagaagg tttctaagga attctataag agataaacct ggaaaggaag taagaaaggc 23460

aggaatgggg agagagaaaa gctgatcctc tttctagttg taactgtggc ctcagctgat 23520

actacaggga gtgtggaaat tgagatggcc tcttggagtt aacctaagtt aaggaaaagg 23580

gactaggcct tagtatccct taatcagccc atcattagta atgggctaca actgagggca 23640

attccctgtg acagacacat ctgctggagg aactcctgtg ttgtccctaa agcagagatc 23700

taagtgggcc aatttagctc agttttttat ccatatggac actaaaaagg caagtattta 23760

ggaaaaatgt catttccaga catatgtttt attctatagg tggtcactca ccctttcaaa 23820

accatcgagc tacagatgaa gaagaagggg ttcaaaatgg aagtgggaca atacattttt 23880

gtcaagtgcc caaaggtgtc caagctggag tggcaccctt ttacactgac atccgcccct 23940

gaggaagact tctttagtat ccatatccgc atcgttgggg actggacaga ggggctgttc 24000

aatgcttgtg gctgtgataa gcaggagttt caagatgcgt ggaaactacc taagtgagta 24060

aaaagtacat attaccaacg tatatgagtt caggaaaaat ggcactaaat agctcctctt 24120

cctccatgtt ttactaagtc tccaacaaaa cacacaggtt ctaagaatat aggtagctat 24180

ttctgtggtc accgtttcat atgtgtagtg tgtttatgca tattttcata aatcttatgt 24240

gaaatatgaa aaccttgaat caaatattag aaataaatac tcccaaattc ctttaaatat 24300

gtaagggtca aggccaagtt atattaactt tcctaacaaa tataattgta gtgtatcaaa 24360

aatattctta aattttcatt ggcataattt atttgaggtt aaatgccata tattagcccc 24420

tttgcctcct tttccctgca tgcctaacat gctataaggc acttagtagg tgctaaagaa 24480

aggtttgaga gtttgttgaa taactcaatg aatagataaa tgaaaagtgg agacattaaa 24540

tctacaagat gtaatgatgc agcaaatcct cacttcaggg tgcaccgtat gcaagaattt 24600

caagagtggg atgtcctggc aagacatagg gtgtgtgtgg agggggcgtt gttgtgtgtg 24660

aagaggggtg gggagattaa aaaaaaaaaa aacttgttct gagttaccga atgtttttgg 24720

ttagccaaat atttctcttt ttacttccaa acccaacgtt ggcactaagt ttggttactt 24780

gaaagctatt tcatagaagg aagcacccaa tagatacatt attccaattt gaattaacat 24840

gttgcacatc cccaataatt atgggtgccc catctcactc tgaagagcaa gacatctctg 24900

taactatctc ctccccattt cccttcagga tagcggttga tgggcccttt ggcactgcca 24960

gtgaagatgt gttcagctat gaggtggtga tgttagtggg agcagggatt ggggtcacac 25020

ccttcgcatc cattctcaag tcagtctggt acaaatattg caataacgcc accaatctga 25080

agctcaaaaa ggtaagtcct ttcatttatc ggagggcctt agagcagtaa ccatactctg 25140

ccatgtgagg cctgagagtg ctttcagggc taaggttggc agagaccatg ggaagtgaag 25200

aaaagcttcc ggtggttcca gagagacagg cttttcttca aaagaatatt tgttaaatct 25260

aatgtgcttc tagataagta ggcctattag tgaagggaat atattgtatt tgtatagtgt 25320

tgctggaaat tcagaagaaa gaaagttggg aaagtattca cagccccaac ttaatagctg 25380

taatttttgt atattctctt ctaatatttt ccatgtttac atatttttag aaggttgtaa 25440

atattaagta tgtataattt catgtcctgc ttttaaaaaa acattataga aagtgttttt 25500

caatgtcttc acaggcttta taatgatgac tttaaatgat ctcttcatgt tctattgaga 25560

ggatattgaa taatttttct ttcatcttgt gttagatact gagattgatt caatttccag 25620

ccgcgcccca ccccctccac tcacccaata ctttttttgc aaagggagga gaggagacct 25680

gaaactctac ttatgaatat ctcctcagga tcaattcaca ggagattttt tggttaccta 25740

taaatttggt tttattgtgt aataaagggc atcctaaata aacctcaggc cattctaata 25800

actgtaaaga taaactctaa tagggacatt aagcctacct tgacttttca ttctccctgt 25860

acctcttttc catgtggagg agatgtgcat agaaccttat ttttcccctc ggaactcatg 25920

aatgtctggc agtagcagcc agggaagaat ttctgtggca atccctgcta gtctagattc 25980

catcaggctt tctgagaaga ggttcgaagg aagccagaga ttctgggaga gtaagagcag 26040

actcagaggg aaatttggtg ggctaatagt tttttcttaa gttgtgtatt tctgaggtca 26100

agttacttat ttactgccct gctagagtga aggccagagc aggttcatgt aaactaccct 26160

gtgaaatgtc cagagccttc tgaaaatcta tgtttctagg cattctgagc atcaagaaaa 26220

agtttaggtg acagaaagtg gaattccaca tggtaatgct gatagggcct gccaaatata 26280

atctgcttca tgatccaccc cattttcaga tctacttcta ctggctgtgc cgggacacac 26340

atgcctttga gtggtttgca gatctgctgc aactgctgga gagccagatg caggaaagga 26400

acaatgccgg cttcctcagc tacaacatct acctcactgg ctgggatgag tctcaggtaa 26460

ggacaagact ccaaggctca ggtccttccc atagtgtaca gggcttacga acttcccctt 26520

ggttattggt gtgtcttgtg tactattttt tctaagtatg tttagtggat ttggtgatcc 26580

ggtccattca ctctcattta gtatcgccac attatattta gactgctcag attagaatca 26640

aagccaagga gcctgtgagg gaataaaagc catcactttg acattattag agcaattctc 26700

ccaccaggca ctctgaaacc aggtgattga gatgatgcac agggttattt tggggaaaat 26760

ttagctttct ctttctctct gtctctctct ctgtctctct gtctctctct ctctgtctct 26820

gtgtgtgtgt gtgtgtgtgt gtaaaacaga cactccccaa cttaataatg gttcaactta 26880

tgatttttca actttacaat gaagtgaaag caatatgcat tcagtagaag ccatacttca 26940

gtacaagcca tacttcagta ctgtattcaa taaattacat gtggtcttaa accttttatt 27000

ataaataggg ttcatgttag atgattttgt gcaattgtag gctaatataa gtgttctgag 27060

cacatttaag gtagtctaga ctaaactaac tatgatgttt attaagttag atgtattaaa 27120

cccattttag acttatggta ttttcaattt agtgatggtt ttatcaggat ataacaccat 27180

tgtaagctga ggagcatctg tttatataac atacataagc atataaagga ttctgtatat 27240

atatatttta atatgtattt atatatgtat catatatatt tatatgtact atgtatatat 27300

gtatttataa aatcatttaa tttatatgct tttgtatgtt ttataatata ctcactacat 27360

ttataattat tatgcatata tattgccagg tattattctt atgtatctag tcacatagat 27420

tgtctaattt tatcatgtca ccaaccctat gaagtagctc ttattatttt ccacacttta 27480

cagatgaaaa aactcagacc aggttaggtc attttcctaa gagcacccaa caagtaagtg 27540

acagagacag aatgtgccag agcctgtcct ttcagcatct tgcagtagtt catgattatc 27600

atttataaat aaattactat atatctaatg aatgtgatat atatgcatgt atgtgtgtgt 27660

gtatgtgtgt gtacaatgag agtgctcttt caaaaatgtt tggagaccac tataataaag 27720

tagccaatag ttctcaactg ggacaatttt gctctgctcc tccccaagac acacaccaga 27780

gacagttggc aatgtaaata tcctacaatt aaaaagacag ccccccacaa caaagaatta 27840

tacagtccca aatatcaaca gtgctgaaat tgacaaaccc tgaaacaagg taatgattcc 27900

tggagtggta acatctttgt aagtaagcaa acgttaatga cttggcctgg aagcagcata 27960

agctatcacc atgagtgagg agctaaggca agagtctctg catatttctg tccagtgtct 28020

cagctggtgt cttagtccat ttgtgctgct ataacaaaac acccaagact gggtagtttg 28080

taaagaacag aaatttattt tctcaaagtt ctggaggctg gcaagtccaa gatcaagaca 28140

ccaacaggtt tggttgtcta gcaaaggctg catcttctgg gtgggagaaa tactgtgttt 28200

tcacatggtg gaaagaaaaa gggaaggctc gtcaaatact gtgtgatgac tcttttccaa 28260

agcccttaac tcattcataa gggatgatcc ttcatgtctt aatcaccttt ttaaggctcc 28320

acttcttaat gctatcacat aggcaacatc tgaattttgg agaggataca ttcaaactgt 28380

agcaactggg catacataga cattgactcc acaaccctgg gaatcttcca tgtgcaccct 28440

gtcactgtga agactgaatt cccatttggg tttcaacata ttgtttatca cagattctcc 28500

aagtcttaaa ggaatcttgt agcaaatata gattagggaa acataacgat aagaattgtt 28560

gctccataaa aagtggtttc aaaatgccag ttctgcaatt taaaaacaaa acaaaaatgc 28620

tttgataaaa ataaaactca ggaaaaaaat ctatagtata taaattgctt tactgttctg 28680

ttattttaaa agccatgcac aggtttcttt tttaaatcag ttatttattt gtattgaaaa 28740

agtaattatt ttgctttgca aaactgatat ctatagaatt attaaattgg agtgcccacc 28800

tttcttaacc tcctctatga ccatcatcca tctagtgaat ttcaaatctg atttgctttt 28860

taaaaataaa tttaattaac cacttttatg aaaaatacct gttgctcaaa ctgaagcctc 28920

ctagaatggt agcagaaaaa cagtatgtga ctatatacac atatgtgcgt gcacacacac 28980

acatacacac acactagctt taggcttgat ttgatgtctt atgctaccaa agtattgctg 29040

cattttagtc taaaattgtt acatctctta gtaattctcc caaaggagtg gaagtatatt 29100

agggtggaga gaaaaagtca aacatagagc agagagaaaa acagtgagac actattcatc 29160

catcaatgcc tgactcaaat actgcggccc taacccttcc cctattcttc cacttcacct 29220

tccttctttg ttctcattag gacgcttgtg cctccttcat gacacacatc ataccctgtt 29280

cgacatatgg gattatttat atttatactt cgaagtctcc ctttctagac tgtaaattgc 29340

ttgagagaga tccagtttat ttatctttgt ttacctttca gcatccagca gggtgccttg 29400

gttagaatag cttgtgaagg atgtaaatac attgtatgtg cttttacaga atgtctcttt 29460

tttttctgaa ttcatgtcct ttcctgtagg ccaatcactt tgctgtgcac catgatgagg 29520

agaaagatgt gatcacaggc ctgaaacaaa agactttgta tggacggccc aactgggata 29580

atgaattcaa gacaattgca agtcaacacc ctaagtaagg agtctgtcac caagatgttt 29640

ttgaggcttg catctgccta aagcggcagc ccctatacat atctaaactt atatatttta 29700

gaaactcaaa tatgtatatt actatataaa gattgaattc atgcccaaca gaagattcca 29760

gatatcttca actttaagaa ggatctttaa attataccaa attacctgga gattaattaa 29820

aaacaagtat ttccaggtcc ccatctcaga ttttctcaac ctgcctgtcc caagtagggc 29880

cacagcttag ttcttttctt tagtcaccta aatttcatta gtgtatctac ttcttttaaa 29940

gattcaatat aatttataca tattgttaag aagacactgt ccccactttc agttctaaaa 30000

gcttctgggt ctaaaatctt aagttgacag atgtctcaag gtgctttctg ctctcactaa 30060

aactttagtc attataaaac cttgaggggg atcccttatc ttgctagaac acctaagaaa 30120

ctcaagagat caccatacgt gtacccttca gactattgct ttttgcactg taaggagcat 30180

acaaagtgcc tggggatctc tttaaaatgc agataccaat ttagaagatt tgaggtaggg 30240

ccaggtaatc tgcatttttt aaaaagctga cgccaaggct actgatcaga aaccacactt 30300

tgaacagggc ttcagactct aaaatttaga gaaatgaagc cacactgagt ggttggcata 30360

gttagcttgt tcctaatttc aagatgccag ggggcacaga gccctgaagg aaagtagccc 30420

acggactcat gaattcacca ccattttctc tgtgatagaa gtttccaaaa accttggttg 30480

gattttactt ttgccaggga agtcaactac cttttgaact atccagatgc tcacacaaac 30540

aggctgaacc acactccctc tgagcaatat gatccctttg ctatttgtgg aaaagaaaaa 30600

ggagcagagg ggactctgcc ctggggcctc aaattaacgg gaaattcacc tacctgcttt 30660

gtagacatct catcccaaag cttgaaattg tctttttttt tctttcccaa aagtaccaga 30720

ataggagttt tcctctgtgg acctgaagcc ttggctgaaa ccctgagtaa acaaagcatc 30780

tccaactctg agtctggccc tcggggagtg catttcattt tcaacaagga aaacttctaa 30840

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

ccttcaggat agcggttgat 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

taaggccctc cgataaatga 20

<210> 4

<211> 18

<212> DNA

<213> Artificial sequence

<400> 4

atgcaggaaa ggaacaat 18

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence

<400> 5

ccttacctga gactcatc 18

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

aagactttgt atggacgg 18

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<400> 7

ggtgacagac tccttact 18

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

tggtgatgtt agtgggagca 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

gccctgttca aagtgtggtt 20