阅读说明：本技术 一种快速有效的鉴定活体斑马鱼胚胎基因型的方法 (Method for rapidly and effectively identifying embryo genotype of living zebra fish ) 是由 不公告发明人 于 2019-10-23 设计创作，主要内容包括：本发明涉及一种快速有效的鉴定活体斑马鱼胚胎基因型的方法,具体步骤包括将将单个活体斑马鱼胚胎放至一种含蛋白酶的DNA收集液中,转移至适当的环境温度条件下在具一定转速摇动或震动的情况下孵育一段时间,然后收取DNA收集液,同时在单个胚胎中加入胚胎恢复液。收集到的DNA收集液中含从活体胚胎中分离出的含核上皮细胞,经加入裂解处理后可直接用作基因组DNA模板用于未来的基因型鉴定；加入胚胎恢复液的斑马鱼胚胎可正常发育与生长。本发明进一步提供了可用于快速有效鉴定包括斑马鱼活体胚胎在内的行体外发育的动物活体胚胎的基因型鉴定的试剂盒,其特征在于所述试剂盒包括本发明中所述的各种溶液和蛋白酶。(The invention relates to a method for quickly and effectively identifying living zebra fish embryo genotype, which comprises the following specific steps of putting a single living zebra fish embryo into DNA collecting liquid containing protease, transferring the living zebra fish embryo into a proper environment temperature condition, incubating for a period of time under the condition of shaking or shaking at a certain rotating speed, then collecting the DNA collecting liquid, and simultaneously adding embryo recovery liquid into the single embryo. The collected DNA collecting fluid contains the epithelial cells containing nuclei separated from the living embryo, and the cells can be directly used as a genome DNA template for future genotype identification after being added with lysis treatment; the zebra fish embryo added with the embryo recovery liquid can normally develop and grow. The present invention further provides a kit for rapid and efficient genotyping of in vitro developing live animal embryos, including zebrafish live embryos, characterized in that the kit comprises various solutions and proteases as described herein.)

1. A method for quickly and effectively identifying the genotype of living zebra fish embryo is characterized in that a single living zebra fish embryo is put into DNA collecting liquid containing protease, then the living zebra fish embryo is transferred to a proper temperature condition and incubated for a period of time under the condition of shaking or vibration at a certain rotating speed, then the DNA collecting liquid is collected, and simultaneously embryo recovery liquid is added into the single embryo. The collected DNA collecting solution contains the epithelium cells containing nucleus separated from the living embryo, and after being treated by adding lysis solution, the DNA collecting solution can be directly used as a genome DNA template for future genotype identification, and the zebra fish embryo added with the embryo recovery solution can normally develop and grow.

2. The method according to claim 1, wherein the animal is other aquatic animals with embryos developed in vitro, such as medaka, yellow catfish, carp, grouper, and rana grahami, in addition to zebrafish. The embryo stage may be from fertilized egg to 120hpf (hours after fertilization), with a preferred development stage of 24 to 96 hpf.

3. The method of claim 1, wherein said protease comprises trypsin, protease (protease), Collagenase Type I (collagen Type I), and protease K (protease K). Preferably the protease is proteinase K.

4. The method of claim 1, wherein the DNA harvest buffer used to prepare the DNA harvest is Phosphate Buffered Saline (PBS), fish saline (0.68% sodium chloride), Tris solution or E3 medium and the tricaine solution is added to either solution simultaneously. Preferably, the DNA collection buffer is a Tris solution and a tricaine solution. Wherein the tricaine is used as anesthetic only for anesthetizing animal embryo, and has concentration of 20-200 mg/L, preferably 160 mg/L.

5. The method of claim 4, wherein the Tris solution is at a concentration of 1mM to 100mM, preferably at a concentration of 30mM Tris. The pH value of the Tris solution is 6.5 to 8.5, and the preferable pH value is pH 8.0.

6. The method of claim 1, wherein the temperature condition is an incubation of live embryos in the DNA harvest at an ambient temperature of 23 ℃ to 42 ℃, wherein the preferred ambient temperature is 37 ℃, and is typically provided by a water-proof incubator.

7. The method of claim 1, wherein the rotation speed is 50 to 1,000 revolutions per second (rpm), preferably 500 rpm.

8. The method of claim 1, wherein the incubation time is 5 to 60 min. Wherein the preferred incubation time for embryos varies during different developmental stages. Specifically, the method comprises the following steps: the preferred incubation time for 24hpf embryos is 15 min; the preferred embryo incubation time for 48hpf embryos is 20 min; the preferred incubation time for 72hpf embryos is 30 min; the preferred incubation time for 96hpf embryos is 30 min.

9. The method of claim 1, wherein said embryo recovery fluid is formulated with 0.00% to 0.68% NaCl, 0.00% to 0.68% KCl, 0.00% to 0.68% CaCl₂.2H₂O, and 0.00% to 0.68% MgSO₄7H₂O, pH 6.5 to 8.5. Wherein the preferable compatibility is that each liter of solution contains 294mg NaCl, 513mg KCl and 49mg CaCl₂.2H₂O, and 81mg MgSO₄.7H₂O; wherein the preferred pH is 7.2.

10. The method of claim 1, wherein the genomic DNA template for genotyping is prepared by adding 0.1 to 1 volume of lysate (preferably containing 10mM Tris-HCl (pH8.0), 50mM KCl, 0.3% Tween 20, 0.3% NP40 and 1mM EDTA) after 10% to 75% of the DNA pool is removed, incubating at 90-100 ℃ for 1-15 minutes to inactivate proteinase K, wherein the preferred method is adding 15. mu.l lysate to 30. mu.l of the collected DNA pool, incubating at 98 ℃ for 5 minutes to inactivate proteinase K and release genomic DNA, and finally using as the genomic DNA template for genotyping.

Technical Field

The invention belongs to the technical field of biology, and relates to a method for obtaining a genome DNA template of a living zebra fish embryo cell for identifying the genotype of the living zebra fish embryo based on protease restriction, which is characterized in that a single living zebra fish embryo is placed into a DNA collecting solution containing protease, the DNA collecting solution is transferred to a proper environment temperature condition for shaking or vibrating incubation for a period of time, and simultaneously an embryo recovery solution is added into the single embryo. The collected DNA collecting liquid contains cells (nuclei) separated from living embryos, and the cells (nuclei) can be directly used as a genome DNA template for future genotype identification after being treated by adding lysis liquid, and zebra fish embryos added with the embryo recovery liquid can normally develop and grow.

Technical Field

Zebrafish, a powerful vertebrate model animal, is widely used in many different research fields ranging from animal development, to disease models, and drug screening. One important advantage of zebrafish as a model animal is the ability to perform a variety of genetic manipulations. The newly invented CRISPR technology greatly improves the convenience of zebra fish genetic modification.

Whether the zebra fish genome is successfully genetically engineered needs to be determined by genotyping. Genotyping necessarily involves the drawing of biological samples to prepare genomic DNA templates. For zebrafish embryos in the early stages of development, most genotyping methods have heretofore involved the use of biological specimens which require the sacrifice of the zebrafish embryo itself, or which otherwise require breeding of the zebrafish embryo to an age of more than 1 month to harvest part of the tail fin without the need to sacrifice zebrafish larvae (para et al, 2009).

Although methods have been reported for direct genotyping of live zebrafish embryos (without sacrificing zebrafish embryos), these methods either require the use of special instruments (Samuel et al, Lambert et al, 2018) or require lengthy surgery (Xing et al, 2014; Kosuta et al, 2018). These limitations increase the experimental time and cost, and are not conducive to the development of subsequent large-scale experiments, particularly phenotypic screening efforts. Therefore, the invention of a rapid genotype identification method aiming at the living zebra fish embryo is urgently needed.

Zebrafish embryos were shown to possess a strong regenerative capacity. In this regard, the present invention describes the establishment of an inexpensive and relatively simple to operate method for genotyping living embryos by using limited protease cleavage.

In the invention, the types of protease and the conditions for enzymolysis of the living embryos are optimized, so that the problem that the survival capability of the embryos is not damaged when the cells containing the nucleuses are separated from the living embryos of the zebra fish is effectively solved, and the separated cells containing the nucleuses are enough for the subsequent PCR amplification, thereby realizing the genotype identification of the living embryos.

Reference to the literature

KOSUTA，C.，DANIEL，K.，JOHNSTONE，D.L.，MONGEON，K.，BAN，K.，LEBLANC，S.，MACLEOD，S.，ET-TAHIRY，K.，EKKER，M.，MACKENZIE，A.&PENA，I.2018.High-throughput DNA Extraction and Genotyping of 3dpf Zebrafish Larvae by Fin Clipping.J Vis Exp.

LAMBERT，C.J.，FRESHNER，B.C.，CHUNG，A.，STEVENSON，T.J.，BOWLES，D.M.，SAMUEL，R.，GALE，B.K.&BONKOWSKY，J.L.2018.An automated system for rapid cellular extraction from live zebrafish embryos and larvae：Development and application to genotyping.PLoS One，13，e0193180.

PARANT，J.M.，GEORGE，S.A.，PRYOR，R.，WITTWER，C.T.&YOST，H.J.2009.A rapid and efficient method of genotyping zebrafish mutants.Dev Dyn，238，3168-74.

SAMUEL，R.，STEPHENSON，R.，ROY，P.，PRYOR，R.，ZHOU，L.，BONKOWSKY，J.L.&GALE，B.K.2015.Microfluidic-aided genotyping of zebrafish in the first 48h with 100％viability.Biomed Microdevices，17，43.

XING，L.，QUIST，T.S.，STEVENSON，T.J.，DAHLEM，T.J.&BONKOWSKY，J.L.2014.Rapid and efficient zebrafish genotyping using PCR with high-resolution melt analysis.J Vis Exp，e51138.

Disclosure of Invention

One of the purposes of the invention is to establish a method for quickly and effectively identifying the embryo genotype of the living zebra fish. For genotyping of live zebrafish embryos, it is necessary to isolate the nuclear zebrafish cells from the live embryos. In the present invention, a single live zebra fish embryo is placed in a protease-containing DNA pool, transferred to a suitable ambient temperature condition for incubation with shaking for a period of time, and the DNA pool is then harvested while an embryo recovery solution is added to the single embryo. The collected DNA collecting solution contains cells separated from living embryos, the cells can be directly used as a genome DNA template for future genotype identification after being added with lysate for treatment, and zebra fish embryos added with the embryo recovery solution can normally develop and grow.

In order to separate the zebra fish cells containing nuclei from the living embryos, in one embodiment of the present invention, 4 different DNA pools containing 0.25% Trypsin (Trypsin), 0.1% protease (protease), 0.3% Collagenase Type I (Collagenase Type I) and 0.001% protease K (procase K) were prepared from E3 culture medium (formulation see embodiment), and then the effect of the 4 different DNA pools on genotyping of the cells separated from the living embryos in a 37 ℃ water-insulated incubator was compared, and as a result, it was found that the effect of genotyping using the DNA pool containing 0.001% protease K as a genomic DNA template (greater than 30%) was the best (greater than 75%) when the embryos treated with the recovery solution were further added.

Having identified the preferred proteinase K, in another embodiment of the invention, we evaluated the effect of different embryo collections on the collection of nucleated cells from live embryos for genotyping. We prepared 0.001% proteinase K-containing DNA collection solutions with commonly used PBS (phosphate buffered saline), fish normal saline, 30mM Tris (pH8.0) and E3 culture solutions, and then compared the effect of the 4 different DNA collection solutions on genotyping of cells isolated from live embryos in a water-proof incubator at 37 ℃, and found that the genotyping effect of 0.001% proteinase K-containing DNA collection solution prepared with 30mM Tris (pH8.0) as a genomic DNA template is the best (the success rate of genotyping is almost 100%), and the proportion of further survival of embryos treated with recovery solution is more than 90%.

Having determined appropriate proteases and culture fluids, in another use example of the present invention, we evaluated the effect of DNA collections prepared with varying concentrations of proteinase K on the collection of nucleated cells from live embryos for genotyping. We formulated DNA pools containing 1. mu.g/ml, 5. mu.g/ml, 12.5. mu.g/ml, 25. mu.g/ml and 75. mu.g/ml proteinase K in 30mM Tris (pH8.0), and compared the results of genotyping the cells isolated from live embryos in these 4 different DNA pools in a water-insulated incubator at 37 ℃ and found that when the proteinase K concentration was 12.5. mu.g/ml, 25. mu.g/ml and 75. mu.g/ml, the genotyping effect of the corresponding DNA pools as genomic DNA templates was the best (100% success rate of genotyping), and that the embryos treated with the addition of the recovery solution survived further more than 80%.

Having determined the appropriate collection of DNA, in another embodiment of the invention, we evaluated the effect of collecting nuclear-containing cells from live embryos for genotyping at different incubation times. We prepared DNA collection liquid containing 25 mug/ml proteinase K with 30mM Tris (pH8.0), then compared the effect of the DNA collection liquid on genotyping of cells separated from live embryos after co-incubation with 96hpf zebra fish embryos for 5min, 10min, 15min, 20min and 30min respectively at 37 ℃, and found that when the co-incubation time is 10min, 15min, 20min and 30min, the genotyping effect of the genomic DNA templates collected from the corresponding DNA collection liquid is sequentially increased, the genotyping success rate is increased from 75% to 100%, and the survival rate of the embryos treated by adding recovery liquid is more than 90%.

Having determined the appropriate DNA harvest and incubation time, in another embodiment of the invention, we evaluated the effect of different rotational speeds during incubation on the effect of nucleated cells collected from live embryos for genotyping. We prepared a DNA collection containing 25. mu.g/ml proteinase K in 30mM Tris (pH8.0), and compared the effect of the DNA collection on genotyping of cells isolated from live embryos after incubation of 96hpf zebrafish embryos for 30min at 0, 50, 100, 500 and 1,000rpm at 37 ℃ for 30min, and found that when the incubation time at the co-rotation speed was 500 and 1000rpm (revolutions per second), the success rate of genotyping using genomic DNA templates collected from the corresponding DNA collection was 100%, and the rate of further survival of embryos treated with addition of recovery fluid was 90% and 60%, respectively.

Having determined the appropriate DNA harvest and co-incubation time, in another embodiment of the invention, we evaluated the effect of collecting nuclear-containing cells from live embryos at different developmental stages for genotyping. We prepared DNA collection liquid containing 15 or 25 mug/ml proteinase K with 30mM Tris (pH8.0), then compared the effect of the DNA collection liquid on the genotype identification of cells separated from living embryos after respectively co-incubating the DNA collection liquid with 24hpf, 48hpf, 72hpf, 96hpf and other zebra fish embryos in different development periods for 15min (24hpf embryos), 20min (48hpf embryos) and 30min (72-96hpf) at 37 ℃ and found that the genotype identification effect of the cells collected from 24-96hpf embryos by the DNA collection liquid in different development periods is better when the cells are used as genome DNA templates, the success rate of the genotype identification is over 85%, and the proportion of the embryos treated by adding recovery liquid is over 80%.

To further enhance the utility of this method in high throughput screening of live mutant zebrafish embryos, in another example, we established a two-round approach to genotype identification of live embryos. Specifically, when the embryos developed to 48hpf, up to 8 embryos were placed together in one culture well of a 24-well plate, a DNA harvest was added (the amount of DNA harvest added was a multiple of the amount of solution added for a single embryo) according to the method described above, after shaking culture, the DNA harvest was collected, and a recovery solution was added to the embryos to allow the embryos to continue to grow. The embryo is genotyped by PCR using the embryo collection liquid treated by the lysis solution as a genome template according to the method. When positive results (e.g., carrying a mutant allele of interest) were obtained in genotyping, embryos developed to 96hpf in the first round of the group were individually genotyped to determine the embryos carrying the gene of interest. The method is particularly suitable for large-scale screening of embryos subjected to genome modification with low germ line genetic efficiency, such as gene knock-in, base editing, large fragment deletion of a target gene and the like. Each individual can easily perform one round of screening for up to 800 embryos.

The second object of the present invention is to provide a kit for rapidly and efficiently identifying the genotype of a live zebrafish embryo, characterized in that the kit comprises various solutions and proteases as described in the present invention.

The method and the kit provided by the invention can be used for the genotype identification of other in vitro-developed living aquatic or terrestrial animal embryos, such as medaka, yellow catfish, carp, grouper, rana nigromaculata and other living embryos.

Advantageous results of the invention

The invention provides a rapid (including PCR in less than 3 hours), low-cost, high-throughput method for genotyping in vitro embryo-developing live embryos of animals, such as fish. The method is particularly useful for screening for live embryos carrying SNPs, transgenes, and mutant alleles (including single base pair changes, insertions, or deletions), among others. Is beneficial to the application of living animal embryos such as zebra fish and the like in the research of biological medicines.

Drawings

FIG. 1 shows the basic process of rapid and efficient genotyping of live zebrafish embryos. (A) Placing single living zebra fish embryo into a DNA collecting solution containing protease, transferring to proper environment temperature condition, shaking or shaking for incubation for a period of time, collecting DNA collecting solution, and adding embryo recovering solution into single embryo. The collected DNA collecting liquid contains cells (nuclei) separated from living embryos, and the cells (nuclei) can be directly used as a genome DNA template for future genotype identification after being treated by adding lysis liquid, and zebra fish embryos added with the embryo recovery liquid can normally develop and grow. (B) Representative images of zebra fish fries developed to 7dpf after gene identification (without any visible dysplasia); the juvenile fish is in a side view, and the head of the juvenile fish faces to the left; (C) taking the DNA collecting solution treated by adding the lysis solution as a representative PCR product electrophoresis result obtained by carrying out PCR amplification on the genome DNA; NC, negative control, PC, positive control.

FIG. 2 shows the system optimization scheme of the zebra fish living embryo genotype identification method. (A) Comparing the results of genotype identification using different proteases at the initial test; the different proteases were diluted in E3 medium. 96hpf embryos in protease solution were incubated at 37 ℃ for 20 minutes at ambient conditions. (B) Screening a proper buffer solution capable of improving genotype identification sensitivity and survival rate; the concentration of proteinase K was 100. mu.g/ml. 96hpf zebrafish embryos were incubated at 37 ℃ for 20 minutes with shaking at 500 rpm. (C) And (D) and (E) optimization experiments for proteinase K concentration, treatment time and rotational shaking speed, respectively, required for genotyping of 96hpf embryos; (F) evaluating the genotype identification effect of embryos at different development stages; a to F: at least 48 embryos were tested per experimental condition. Survival was judged at 7 dpf.

FIG. 3 shows a two-step strategy for high throughput in vivo embryo genotyping. (A) A representation of the electrophoresis result of the PCR product of the representative table for the first round genotype identification of the living embryo; when embryos developed to 2dpf (2 days post fertilization), 7 wild type embryos were mixed with 1 Tg (blf: RF2) embryo in a set and placed in one well of a 24-well plate (containing 280. mu.l of DNA harvest). The same experiment was repeated for 6 groups. Each set of embryos was placed in a 37 ℃ water-proof incubator and incubated at 500rpm for 20 minutes. Mu.l of the DNA pool was taken as a genomic DNA template, and 800. mu.l of a recovering solution was added to the embryo to terminate the enzyme reaction. When PCR-amplifying the genomic DNA fragment of interest, the embryos are placed in a 28 ℃ environment for growth. After the first round of PCR product electrophoresis, the group of embryos with the corresponding target band was washed 3 times with E3 culture solution, and then each embryo was placed in 96 well plates for genotyping of live embryos according to standard procedures. NC: negative control; PC: and (4) positive control. (B) Electrophoresis result chart of second round PCR amplification product for genotype identification. After two days of recovery, individual embryos were genotyped according to standard protocols for in vivo embryo genotyping. Indicates that Tg (blf: RP2) embryos were successfully identified. (A) The primers and PCR conditions involved are listed in the examples (C) two rounds of in vivo embryo genotyping relate to embryo genotyping success (sensitivity) and survival (survival) of embryos developing to 7 days.

FIG. 4 shows the evaluation of normal development and growth of live embryos after genotyping. (A) And (B) the behavioral analysis that the living embryo grows to 120hpf by genotype identification and treatment with a recovery solution. (A) Swimming trajectories of live embryos and control embryos that have been genotyped to develop to 120 hpf. Color indicates a swimming trajectory, black indicates a speed of less than or equal to 2.2 mm/sec; green indicated swimming speed greater than 2.2mm/s but less than 6.6 mm/s; the swimming speed indicated in red is greater than or equal to 6.6 mm/s. (B) Quantitative analysis of cumulative movement distance to 120hpf for control and genotype-identified treated embryos. During the test recording, the genotype identification treated embryos did not differ significantly in distance of movement from the control embryos; likewise, the cumulative movement time is the same (no significant difference). n.s. no significant difference. (A) And (B) the movement locus of 12 fish larvae per group was recorded for 1 hour by ZebraBox (product of ViewPoint Behavior Technology, France) and then analyzed by a facility-equipped zebrafish locus analysis software. (C) The control and genotype-identified embryos developed to 60dpf (photographs of live young fish 60 days after fertilization, side view, head left. (D) shows Kaplan-Meier survival curves of the development and growth of the control and genotype-identified embryos, the total amount of samples observed was 32 control and genotype-identified embryos, respectively, (E) fertility and mating efficiency comparisons of the development to sexual maturity of the genotype-identified embryos, 16 control mating efficiency (fertilization potency) and egg production (fertilization egg quantity) of wild-type zebra fish of the same age after development to sexual maturity of the genotype-identified embryos.

FIG. 5 is a photograph showing the result of agarose gel electrophoresis of a PCR product obtained after amplification using genomic DNA collected from a live embryo as a template. All the electrophoresis photographs were obtained by electrophoresis of amplified products of genomic DNA fragments from embryos of different live bodies in lane 1, which is a DNA standard. (A) Amplification results of Ocean pout terminator gene fragment: a transgenic fish Gt (blf: RP2) obtained by gene trapping (gene trapping) using pGBT-RP2.1 as a trap was used as an experimental subject, and amplification primers were designed on pGBT-RP2.1, with a forward primer sequence of ATCGTGGAACAGTACGAGCG and a reverse primer sequence of TACACCAGACAGGTTTGGCTC. The annealing temperature for PCR was 63 ℃ and 34 cycles. The target amplicon was 1228bp in size. (B) Amplification result of mRFP gene fragment: transgenic fish Gt (blf: RP2) was used as the subject, and the amplification primers were designed on the CDS of mRFP with a forward primer sequence of GTCCCCTCAGTTCCAGTACG and a reverse primer sequence of TCAGTTAACGGTGGCTGAGAC. The annealing temperature for PCR was 66 ℃ and 33 cycles. The target amplicon is 534bp in size. (C) Zebra fish mvp gene amplificationAs a result: wild zebra fish is taken as an experimental object, a primer is designed on an mvp gene (GeneID: 373081, Chr 3: 15, 722, 418-15, 723, 110), the sequence of a forward primer is GGTATGTCTAACCTGACCTGTGTT, and the sequence of a reverse primer is CAGCCGCCTTTACTTTGATTTAC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 630bp in size. (D) mCherry gene amplification results: tg (UAS: nfsb-mCherry) transgenic zebra fish is taken as an experimental object, a primer is designed on CDS of mCherry gene, the sequence of a forward primer is AGTTCATGTACGGCTCCAAGG, and the sequence of a reverse primer is GTTAGCTGGTACCCACTTCTC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 426bp in size. (E) drl.3 Gene amplification results: wild zebra fish is taken as an experimental object, a primer is designed on a drl.3 gene (GeneID: 555591, Chr 5: 61, 609, 026-61, 609 and 441), the sequence of a forward primer is GGACCGAGTATCAGTAGTATGCA, and the sequence of a reverse primer is CAGCCGCCTTTACTTTGATTTAC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 416bp in size. (F) E) drl-drl.3 Gene amplification results: mutant zebra fish is taken as an experimental object, a primer is designed on a 49kbp genome fragment (related GeneID is 30167, 555453, 555524, 555591, the position of a chromosome is Chr 5: 61, 602, 035-61, 652 and 332) which comprises genes such as drl, drll.1, drll.2 and drll.3 and the like which are deleted by a CRISPR/Cas9 technology, a forward primer sequence is GAGTGGCGTTTTAACGGTTTG, and a reverse primer sequence is CCCAAAGAGCTGTGTCAAGAAAT. The annealing temperature for PCR was 67 ℃ and 34 cycles. The target amplicon is 485bp in size. (F) Cre (r. Cre. R. C)^ERTGene amplification results: tg (cmlc 2: CreERT2) transgenic zebra fish is used as an experimental object, and a primer is designed in Cre^ERTIn the CDS of the gene, the forward primer sequence was CCCGCAGAACCTGAAGATGT, and the reverse primer sequence was CAGCGTTTTCGTTCTGCCAA. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 417bp in size.

Detailed Description

The experimental procedures in the examples are conventional unless otherwise specified.

The reagent formulation involved in the method of the invention

E3 culture solution (60 ×): containing 0.3M NaCl、10 mM KCl、20mM CaCl₂·2H₂O and 24mM MgCl₂·6H₂And O. 34.8g NaCl, 1.6g KCl and 5.8g CaCl are respectively weighed₂.2H₂O、9.78g MgCl₂.6H₂O was dissolved in 1.8L of deionized water. The pH was adjusted to 7.2 with NaOH. Deionized water was added to a final volume of 2L. Storing at room temperature after high pressure damp-heat sterilization. 1 XE 3 culture medium (working concentration) was prepared, and 16.5ml of 60 Xstock solution was diluted to 1L.

1.5M Tris-HCl (pH8.0) stock: 181.71g Tris were weighed into 800ml deionized water and the pH was adjusted to 8.0 with concentrated HCl. The final volume was added to 1L using deionized water. Sterilizing under high pressure and moist heat, and storing at room temperature.

15mM tricaine stock solution (25X): 400mg of tricaine powder (tricaine) was weighed out and dissolved in 97.9ml of deionized water, 2.1ml of 1M Tris (pH 9) was added. The pH was adjusted to about 7.0. Stored in a 4 ℃ refrigerator.

Proteinase K stock (10 mg/ml): 500mg of proteinase K was weighed out and dissolved in 50ml of deionized water to prepare a stock solution of 10 mg/ml. Filtering with 0.22 μm filter membrane, sterilizing, subpackaging in 1.5ml plastic centrifuge tube, and storing at-20 deg.C (effective within one year).

DNA collection buffer: 10ml of the prepared 1.5M Tris-HCl stock solution and 20ml of the tricaine solution were measured and placed in 400ml of deionized water, and the pH was adjusted to 8.0 with hydrochloric acid. Deionized water was added to make the final volume 500 ml.

DNA collection solution: proteinase K (for 24hpf embryos) 15. mu.g/ml; add 1.5. mu.l of proteinase K stock to 1ml of DNA collection buffer. Proteinase K25. mu.g/ml (for embryos older than 24 hpf); mu.l of proteinase K stock was added to 1ml of DNA collection buffer.

Recovering liquid: containing 0.5M NaCl, 0.68M KCl and 30mM CaCl₂.2H₂O and MgSO₄.7H₂And O. 29.4g NaCl, 51.3g KCl and 4.9g CaCl were weighed in sequence₂.2H₂O, and 8.1g MgSO₄.7H₂O was dissolved in 800ml of deionized water and the pH was adjusted to 7.2 with NaOH. Deionized water was added to bring the final volume to 1000 ml. The stock solution is 100 Xsterilized by conventional autoclaving and heat sterilization and stored at room temperature. Preparation of 1X workWhen the solution is used, 10ml of stock solution is diluted to 1000ml by deionized water.

Lysis solution: containing 10mM Tris-HCl (pH8.0), 50mM KCl, 0.3% Tween 20, 0.3% NP40, and 1mM EDTA. Stock solutions of 1M Tris-HCl (pH8.0), 1M KCl, and 0.5M EDTA were prepared, respectively. To prepare 50ml of lysate, 0.5ml of 1M Tris-HCl (pH8.0), 2.5ml of 1M KCl, 100. mu.l of 0.5M EDTA, 150. mu.l Tween 20, and 150. mu.l NP40 were sequentially added to 40ml of deionized water, and finally deionized water was added to make the total volume 50 ml.

Part of consumables and equipment involved in the method

Cell culture dishes with a diameter of 90mm or 30 mm; 96-well culture plates; 2ml 8-linked PCR tubes; a liquid transferring gun; a body microscope; a micro-culture plate mixing instrument; water proof formula constant temperature incubator.

Preparation of zebra fish embryos: in all examples, zebrafish embryos are collected in the morning as usual, the collected zygotes are washed, sorted and placed into a culture dish for conventional feeding (E3 culture solution), and when the nucleated cells are to be collected, the conventional aqueous solution is aspirated, and various DNA collection buffers or DNA collection solutions are added.

Example 1 basic Experimental procedure for the identification of Zebra fish Living embryo genotype

The preferred process is carried out as described in figure 1. Zebrafish embryos at a specific developmental stage were first harvested into petri dishes, washed 3 times with DNA collection buffer, and then transferred to 30mm petri dishes. For the experiment, the DNA harvest buffer was removed from the petri dish and then added to the DNA harvest (FIG. 1A).

Prepare 96-well culture plates or 24-well culture plates. At the same time, the tip of a 200. mu.l tip was cut off to make a "wide mouth" tip, which was used to transfer zebrafish embryos and 40. mu.l of DNA harvest to culture wells in 96-well plates, and embryos grouped (pooled) were transferred to culture wells in 24-well plates (FIG. 1A).

Fixing 96-well culture plate or 96-well culture plate on micro culture plate mixing instrument, placing the mixing instrument into incubator with specified environment temperature, shaking the mixing instrument at specified rotation speed to incubate embryos, and incubating embryos in different development periods on the mixing instrument for different incubation time (fig. 1A).

After incubation, the 96-well plate was removed and the DNA pool was gently mixed 10 times using a tip to avoid aspiration of the embryos, and manipulated under a stereomicroscope if necessary (FIG. 1A).

Mu.l of the above DNA pool was transferred to 200. mu.l of 8-linked PCR tubes or each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubated under the conditions specified for the specified time to inactivate proteinase K and release genomic DNA from the nuclei (FIG. 1A).

100 μ l of recovery solution was added to each culture well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the culture developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and then the embryo success rate (Survival) was calculated (fig. 1B).

And (3) genotype identification: 5-8 mul of DNA collecting solution treated by the cracking solution is taken as a genome DNA template to carry out PCR amplification so as to realize genotype identification. The composition of the PCR reaction (20. mu.l) was: 10. mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer, 1. mu.l of 10. mu.M reverse primer, 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. And carrying out PCR amplification according to specified requirements to amplify the target gene. The amplified PCR product was subjected to agarose gel electrophoresis according to a conventional method. From the appearance of the electrophoretic bands, the efficiency (called sensitivity) of successful genotyping of the live embryos was calculated (FIG. 1C).

EXAMPLE 2 optimization of proteases for in vivo embryo genotype identification

In order to separate zebra fish cells containing nuclei from living embryos, 4 different DNA collecting solutions respectively containing 0.25% of Trypsin (Trypsin), 0.1% of protease (protease), 0.3% of Type I collagen protease (collagen Type I) and 0.001% of protease K (protease K) are prepared from E3 culture solution; when the Gt (blf: RP2) transgenic zebrafish embryos to be tested developed to 96hpf, the embryo-feeding E3 medium was changed to the corresponding 4 different DNA pools, and then 40. mu.l of the DNA pool containing a single embryo was transferred to a single culture well of a 96-well plate using a "wide tip" for a total of 48 embryos per DNA pool. Next, the 96-well culture plate containing the embryos was fixed to a microplate mixer, the mixer was placed in a water-proof incubator at 37 ℃ and the embryos were incubated for 20 minutes by shaking the mixer at 500 rpm.

After incubation was complete, the 96-well plate was removed and the DNA pool was gently mixed 10 times under a stereomicroscope using a tip (to avoid aspiration of the embryos by the tip). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysate was added, and incubated at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus to be used as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification is completed, the PCR product is electrophoresed according to a conventional method, the electrophoresis result is recorded by photographing, the amplification condition of an expected target amplicon (with the size of 1228bp) is observed (FIG. 5A), the efficiency (called sensitivity) of successfully carrying out the genotype identification on the living embryo is calculated, and the success rate of the genotype identification carried out by using the DNA collecting solution containing 0.001% of proteinase K as a genome DNA template is found to be more than 30% and the best effect is obtained (FIG. 2A).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and as a result, the survival rate of the embryos treated with 3 different DNA pools containing 0.25% Trypsin (Trypsin), 0.3% Collagenase Type I (collagen Type I) and 0.001% proteinase K (protease K) was found to be more than 75% (FIG. 2A).

Example 3 optimization of DNA pools to increase susceptibility and survival for genotyping

Having determined the preferred proteinase K, we compared the effect of different embryo collections of nucleated cells from live embryos for genotyping. We prepared DNA pools containing 100. mu.g/ml proteinase K in PBS, fish saline, 30mM Tris (pH8.0) and E3, respectively. When the Gt (blf: RP2) transgenic zebrafish embryos to be tested developed to 96hpf, the embryo-feeding E3 medium was changed to the corresponding 4 different DNA pools, and then 40. mu.l of the DNA pool containing a single embryo was transferred to a single culture well of a 96-well plate using a "wide tip" for a total of 48 embryos per DNA pool. Next, the 96-well culture plate containing the embryos was fixed to a microplate mixer, the mixer was placed in a water-proof incubator at 37 ℃ and the embryos were incubated for 20 minutes by shaking the mixer at 500 rpm.

After incubation was complete, the 96-well plate was removed and the DNA pool was gently mixed 10 times under a stereomicroscope using a tip (to avoid aspiration of the embryos by the tip). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysate was added, and incubated at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus to be used as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification, the PCR product was electrophoresed according to a conventional method, the result of the electrophoresis was photographed, the amplification of a desired target amplicon (1228 bp in size) was observed (FIG. 5A), and the efficiency (referred to as sensitivity) of successful genotyping of the living embryo was calculated, and as a result, it was found that the genotyping effect was best when the DNA collected as a genomic DNA template from a DNA collection containing 100. mu.g/ml proteinase K prepared in 30mM Tris (pH8.0) and the success rate of genotyping was almost 100% (FIG. 2B).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and it was found that the proportion of normal developmental growth (survival) of the embryos treated with 0.001% proteinase K-containing DNA harvest in 30mM Tris (pH8.0) was more than 90% (FIG. 2B).

Example 4 optimization of proteinase K concentration in DNA pools to increase genotype determination sensitivity and survival

After the DNA harvest buffer was determined, we compared the effect of embryo harvests containing different concentrations of proteinase K on the collection of nucleated cells from live embryos for genotyping. We prepared DNA pools containing 1. mu.g/ml, 5. mu.g/ml, 12.5. mu.g/ml, 25. mu.g/ml and 75. mu.g/ml proteinase K in 30mM Tris (pH 8.0). When the Gt (blf: RP2) transgenic zebrafish embryos to be tested developed to 96hpf, the embryo-feeding E3 medium was changed to the corresponding 5 different DNA pools, and then 40. mu.l of the DNA pool containing a single embryo was transferred to a single culture well of a 96-well plate using a "wide tip" for a total of 48 embryos per DNA pool. Next, the 96-well culture plate containing the embryos was fixed to a microplate mixer, the mixer was placed in a water-proof incubator at 37 ℃ and the embryos were incubated for 20 minutes by shaking the mixer at 500 rpm.

After incubation was complete, the 96-well plate was removed and the DNA pool was gently mixed 10 times under a stereomicroscope using a tip (to avoid aspiration of the embryos by the tip). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysate was added, and incubated at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification, the PCR product was electrophoresed according to a conventional method, the electrophoresis result was photographed and recorded, the amplification of the expected target amplicon (1228 bp in size) was observed (FIG. 5A), and the efficiency (referred to as sensitivity) of successful genotyping of the live embryos was calculated, and as a result, it was found that when the concentrations of proteinase K were 12.5. mu.g/ml, 25. mu.g/ml and 75. mu.g/ml, the genotyping effect using the collected DNA pools as genomic DNA templates was the best, and the genotyping success rate was 100% (FIG. 2C).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days post-fertilization), the number of normal embryos was counted and the percentage of embryos surviving was found to be greater than 80% for DNA pools with proteinase K concentrations of 12.5. mu.g/ml, 25. mu.g/ml and 75. mu.g/ml (FIG. 2C).

Example 5 optimization of treatment time of DNA pools to increase susceptibility and survival in genotyping

Having determined the DNA pools, we compared the effect of nuclear-containing cells obtained by treating live embryos with DNA pools at different incubation times for genotyping. We prepared a DNA pool containing 25. mu.g/ml proteinase K in 30mM Tris (pH 8.0). When the subject Gt (blf: RP2) transgenic zebrafish embryos developed to 96hpf, the embryo-feeding E3 culture was replaced with the corresponding DNA harvest, and 40. mu.l of the DNA harvest containing a single embryo was transferred to a single culture well of a 96-well culture plate using a "wide tip" for a total of 5 x 48 embryos. Next, the 96-well culture plate containing the embryos was fixed on a microplate mixer, the mixer was placed in a water-proof incubator designated 37 ℃ and the embryos were incubated for 5, 10, 15, 20 and 30 minutes (48 embryos were tested per treatment time) by shaking the mixer at 500 rpm.

After the corresponding incubation time was completed, the 96-well plate was removed and the DNA pool was gently mixed 10 times using a tip under a stereomicroscope (to avoid the tip from sucking into the embryo). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubation was performed at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification was completed, the PCR product was electrophoresed according to a conventional method, the electrophoresis result was photographed and recorded, the amplification of the desired target amplicon (1228 bp in size) was observed (FIG. 5A), and the efficiency (referred to as sensitivity) of successful genotyping of the live embryos was calculated, and as a result, it was found that when the treatment time (incubation time) was 15, 20 and 30 minutes, the genotyping effects of the genomic DNA template collected from the corresponding DNA pools reached 80%, 90% and 100%, respectively (FIG. 2D).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and it was found that 100% of the embryos survived normally in a proportion of 90% except for 30 minutes of treatment (FIG. 2D).

Example 6 optimization of embryo rotational Shake speed to improve genotype identification sensitivity and survival

After the DNA pools and treatment times were determined, we compared the effect of nucleated cells obtained by treating live embryos with DNA pools at different rotational shaking speeds for genotyping. We prepared a DNA pool containing 25. mu.g/ml proteinase K in 30mM Tris (pH 8.0). When the subject Gt (blf: RP2) transgenic zebrafish embryos developed to 96hpf, the embryo-feeding E3 culture was replaced with the corresponding DNA harvest, and 40. mu.l of the DNA harvest containing a single embryo was transferred to a single culture well of a 96-well culture plate using a "wide tip" for a total of 5 x 48 embryos. Next, the 96-well culture plate containing the embryos was fixed on a microplate mixer, and the mixer was placed in a water-proof incubator set at 37 ℃ and the embryos were incubated for 30 minutes (48 embryos per rotation speed test) with shaking at 0, 50, 100, 500, and 1000rpm, respectively.

After the corresponding incubation was completed, the 96-well plate was removed and the DNA pool was gently mixed 10 times using a tip under a stereomicroscope (to avoid the tip from sucking into the embryo). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysate was added, and incubated at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTERMix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification, the PCR product was electrophoresed according to a conventional method, the electrophoresis result was photographed and recorded, the amplification of the expected target amplicon (1228 bp in size) was observed (FIG. 5A), and the efficiency (referred to as sensitivity) of successful genotyping of the live embryos was calculated, and as a result, it was found that the genotyping effect of the genomic DNA template collected from the corresponding DNA collection reached 100% when the rotation speed was 500rpm and 1000rpm (FIG. 2E).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and as a result, it was found that the normal survival rate of the embryos was 90% and 60% when the rotation speed was 500 and 1000rpm (FIG. 2E).

Example 7 evaluation of the Effect of genotyping Living embryos at different developmental stages

After determining the DNA harvest and treatment time and rotation speed, we used the effect of genotyping on nucleated cells collected from live embryos at different developmental stages. We prepared DNA pools containing 15 or 25. mu.g/ml proteinase K in 30mM Tris (pH 8.0). When the Gt (blf: RP2) transgenic zebrafish embryos to be tested developed to 24, 48, 72 and 96hpf, the E3 medium feeding the embryos was changed to the corresponding DNA pools (24hpf embryos with DNA pools containing 15. mu.g/ml proteinase K; 48-96hpf embryos with DNA pools containing 25. mu.g/ml proteinase K) and then 40. mu.l of DNA pools containing individual embryos were transferred to individual culture wells of a 96-well culture plate using a "wide tip". Next, 24hpf embryos were incubated with shaking at 500rpm for 15 minutes, 48hpf embryos for 20 minutes, and 72-96hpf embryos for 30 minutes (48 embryos were tested for each developmental period), respectively.

After the corresponding incubation was completed, the 96-well plate was removed and the DNA pool was gently mixed 10 times using a tip under a stereomicroscope (to avoid the tip from sucking into the embryo). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubation was performed at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTERMix, 1. mu.l of 10. mu.M forward primer (ATCGTGGAACAGTACGAGCG), 1. mu.l of 10. mu.M reverse primer (TACACCAGACAGGTTTGGCTC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The reaction conditions for PCR amplification were 95 ℃ for 2min, 34 × (95 ℃ for 1min, 63 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification is finished, the PCR product is electrophoresed according to a conventional method, the electrophoresis result is recorded by photographing, the amplification condition of an expected target amplicon (with the size of 1228bp) is observed (FIG. 5A), the efficiency (called sensitivity) of successfully carrying out the genotype identification on the living embryo is calculated, and the genotype identification effect of the embryo at each development stage is found to reach more than 85 percent (FIG. 2F).

In addition, while 30. mu.l of the DNA harvest was taken for genotyping, 100. mu.l of the recovery solution was added to each well containing zebrafish embryos to terminate the enzymatic reaction, and then the embryos were kept at 28 ℃ in a conventional manner. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and it was found that the rate of normal survival of the embryos at each development stage was 80% or more after treatment (FIG. 2F).

Example 8 two-step strategy for high throughput in vivo embryo genotype identification

If the pretreatment for genotyping is carried out on the living embryos with extremely low genome transformation efficiency one by one according to the method, the time and labor are wasted and the cost is high. To improve its detection efficiency, we tried to establish a two-step strategy. Briefly, when embryos developed to 2dpf (2 days post-fertilization), we exchanged E3 medium from the fed embryos for the corresponding DNA pools (DNA pools containing 15. mu.g/ml proteinase K) and then transferred a total of 7 wild type embryos to one well of a 24-well plate (containing 280. mu.l DNA pool buffer) using a "wide tip" in tandem with 1 Tg (blf: RF2) transgenic fish embryo. The same experiment was repeated for 6 groups. Each set of embryos was placed in a 37 ℃ water-insulated incubator and incubated at 500rpm for 20 minutes.

After the corresponding incubation was completed, the 24-well plate was removed and the DNA pool was gently mixed under a stereomicroscope 10 times with a tip (to avoid aspiration of the embryo by the tip). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubation was performed at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTER Mix, 1. mu.l of 10. mu.M forward primer (GTCCCCTCAGTTCCAGTACG), 1. mu.l of 10. mu.M reverse primer (TCAGTTAACGGTGGCTGAGAC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The PCR amplification reaction conditions were 95 ℃ for 2min, 33 × (95 ℃ for 1min, 66 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification is completed, the PCR product is electrophoresed according to a conventional method, and the result of the electrophoresis is photographed and recorded, and the amplification of the expected target amplicon (with the size of 534bp) is observed (FIG. 3A). The results showed that the genomic DNA template from each group of embryos had a success rate of amplifying the target gene fragment of 80% or more (fig. 3C).

While 30. mu.l of the DNA pool was taken out as a genomic DNA template, 800. mu.l of a recovery solution was added to the embryos to terminate the enzymatic reaction, and then the embryos were raised by a conventional method. The normal survival rate of the embryos reached more than 90% when the embryos developed to 96hpf (FIG. 3C). The E3 culture medium from which the embryos were raised was replaced with the corresponding DNA harvest (DNA harvest containing 25. mu.g/ml proteinase K), and then 40. mu.l of the DNA harvest containing a single embryo was transferred to a single culture well of a 96-well plate using a "wide tip". Next, the cells were incubated at 37 ℃ in a water-proof incubator at 500rpm for 30 minutes with shaking.

After the corresponding incubation was completed, the 24-well plate was removed and the DNA pool was gently mixed 10 times under a stereomicroscope using a tip (to avoid aspiration of the embryo by the tip). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubation was performed at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. The composition of the PCR reaction (20. mu.l) used for genotyping was: mu.l of 2 XMASTERMix, 1. mu.l of 10. mu.M forward primer (GTCCCCTCAGTTCCAGTACG), 1. mu.l of 10. mu.M reverse primer (TCAGTT, AACGGTGGCTGAGAGAGAC), 2. mu.l of genomic DNA template, and 6. mu.l of ultrapure water. The PCR amplification reaction conditions were 95 ℃ for 2min, 33 × (95 ℃ for 1min, 66 ℃ for 30sec, 72 ℃ for 1min) and 72 ℃ for 5 min. After the amplification is completed, the PCR product is electrophoresed according to a conventional method, and the result of the electrophoresis is photographed and recorded, and the amplification of the expected target amplicon (with the size of 534bp) is observed (FIG. 3B). The results showed that only 1 live embryo of the genomic DNA template from each group of 8 embryos amplified the target gene fragment (FIG. 3B), and that each group of embryos contained only one live transgenic fish embryo of interest, with a 100% success rate (FIG. 3C).

While 30. mu.l of the DNA pool was taken out as a genomic DNA template, 100. mu.l of a recovery solution was added to the embryos to terminate the enzymatic reaction, and then the embryos were raised by a conventional method. When the embryos developed to 7dpf (7 days after fertilization), the number of normal embryos was counted, and it was found that the normal survival rate of the embryos treated by the two-step method was 80% or more (FIG. 3C).

Example 9 evaluation of Normal development and growth to adults of Living embryos after genotyping

In order to comprehensively evaluate the normal development condition of embryos treated by DNA collection, wild zebra fish fertilized eggs are collected as research objects. When the embryos developed to 2dpf (2 days post-fertilization), we exchanged the E3 medium from the raised embryos for the corresponding DNA pools (containing 15. mu.g/ml proteinase K DNA pools) and transferred a single wild type embryo into one well of a 96-well plate (containing 40. mu.l DNA pool buffer) using a "wide tip". Each set of embryos was placed in a 37 ℃ water-insulated incubator and incubated at 500rpm for 20 minutes. A group of control embryos without any treatment was also set. After completion of the incubation, 100. mu.l of a recovery solution was added to the embryos to terminate the enzymatic reaction, and then the embryos were fed according to a conventional method.

When the embryos developed to 120hpf, 12 embryos were randomly selected from the embryos of the control group and the experimental group for behavioral analysis, the movement locus of each juvenile fish was recorded for 1 hour by ZebraBox (product of ViewPoint Behavior Technology, france), and then analyzed by zebrafish locus analysis software configured with equipment. FIG. 4A shows the swimming trajectories of live embryos that developed to 120hpf after genotyping treatment and control embryos. Color indicates a swimming trajectory, black indicates a speed of less than or equal to 2.2 mm/sec; green indicated swimming speed greater than 2.2mm/s but less than 6.6 mm/s; the swimming speed indicated in red is greater than or equal to 6.6 mm/s. FIG. 4B shows a quantitative analysis of the cumulative distance traveled to 120hpf for control and genotype-treated embryos. The results show that there was no significant difference in the distance of movement between the genotype-identified treated embryos and the control embryos during the test recording; likewise, the cumulative movement time is the same (no significant difference). Furthermore, there was no significant difference between control and live young fish with genotype-identified embryos developed to 60dpf (60 days post fertilization) (FIG. 4C). The survival conditions of the control embryos and the embryos subjected to genotype identification with the total amount of 32 samples respectively are depicted by a Kaplan-Meier survival curve, and the results show that the development and growth of the control embryos and the embryos subjected to genotype identification have no significant difference (FIG. 4D). The mating efficiency (mating efficiency) and the egg laying amount (fertilized egg amount) of the 16-tailed control and the wild zebra fish of the same age after the embryo is subjected to genotype identification and development to sexual maturity are observed, and no significant difference is found between the treated group and the control group (fig. 4E).

Example 10 genotyping results of Living embryos of various genotypes

In order to test the effectiveness of the established in vivo embryo genotype identification method, a plurality of zebra fish embryos with different genome modifications are selected as test objects. The basic processing method comprises the following steps: when the embryos developed to 3dpf, the E3 medium for the target identified embryos was replaced with the corresponding DNA pool (containing 25. mu.g/ml proteinase K), and then a single wild-type embryo was transferred to one well of a 96-well plate (containing 40. mu.l DNA pool buffer) using a "wide tip". Each group of embryos was placed in a 37 ℃ water-proof incubator and incubated at 500rpm for 30 minutes. After incubation was completed, the 24-well plate was removed and the DNA pool gently mixed with a tip of a pipette 10 times under a stereomicroscope (to avoid aspiration of the tip into the embryo). Then, 30. mu.l of DNA pool was aspirated from a single culture well and transferred to each well of a 96-well PCR plate, 15. mu.l of lysis buffer was added, and incubation was performed at 98 ℃ for 5min to inactivate proteinase K and release genomic DNA from the nucleus for use as a template for PCR amplification. Meanwhile, 100. mu.l of a recovery solution was added to the embryos to terminate the enzymatic reaction, and then the embryos were raised according to a conventional method.

The live embryos to be genotyped were F1 generation embryos derived from the founder of the mvp genome editing mutant. The PCR primers of the target genome fragment were designed on the mvp gene (GeneID: 373081, Chr 3: 15, 722, 418-15, 723, 110), with the forward primer sequence GGTATGTCTAACCTGACCTGTGTT and the reverse primer sequence CAGCCGCCTTTACTTTGATTTAC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 630bp in size. The electrophoresis result of the PCR product shows that the corresponding live embryos with the electrophoresis band less than 630bp are candidate embryos in which the mvp gene editing (fragment deletion) occurs (FIG. 5B).

The live embryos to be genotyped were F1 generation embryos derived from Tg (UAS: nfsb-mCherry) transgenic zebrafish founders. The PCR primer of the target genome segment is designed on the CDS of the mCherry gene, the sequence of the forward primer is AGTTCATGTACGGCTCCAAGG, and the sequence of the reverse primer is GTTAGCTGGTACCCACTTCTC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 426bp in size. The electrophoresis result of the PCR product shows that the corresponding live embryo with the electrophoresis band of 426bp is a candidate embryo of germ-line genetic Tg (UAS: nfsb-mCherry) transgenic zebra fish (FIG. 5C).

The live embryos to be genotyped are wild-type embryos. The PCR primers of the target genome segment are designed on a drl.3 gene (GeneID: 555591, Chr 5: 61, 609, 026-61, 609 and 441), the sequence of a forward primer is GGACCGAGTATCAGTAGTATGCA, and the sequence of a reverse primer is CAGCCGCCTTTACTTTGATTTAC. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 416bp in size. The electrophoresis result of the PCR product shows that the corresponding live embryo with the electrophoresis band of 416bp is the zebra fish embryo carrying the wild-type drl.3 gene (FIG. 5D).

The live embryos to be genotyped were F1 generation embryos derived from founders of genome editing mutants with deletion of the drl-drl.3 gene family by genome editing. The PCR primers of the target genome fragment are designed on a genome fragment of 49kbp (related to GeneID of 30167, 555453, 555524, 555591 and chromosome position of Chr 5: 61, 602, 035-61, 652 and 332), comprising genes of drl, drll.1, drll.2, drll.3 and the like, which are deleted by the CRISPR/Cas9 technology, wherein the sequence of the forward primer is GAGTGGCGTTTTAACGGTTTG, and the sequence of the reverse primer is CCCAAAGAGCTGTGTCAAGAAAT. The annealing temperature for PCR was 67 ℃ and 34 cycles. The size of the target amplicon is about 485 bp. The electrophoresis result of the PCR product shows that the corresponding living embryo with the electrophoresis band of about 485bp is the zebra fish embryo carrying the drl-drl.3 gene family deletion capable of germ line inheritance (FIG. 5E).

The live embryos to be genotyped were the Tg (cmlc 2: CreERT2) transgenic zebrafish offspring. The PCR amplification primer of the target genome segment is designed in Cre^ERTIn the CDS of the gene, the forward primer sequence was CCCGCAGAACCTGAAGATGT, and the reverse primer sequence was CAGCGTTTTCGTTCTGCCAA. The annealing temperature for PCR was 58 ℃ and 33 cycles. The target amplicon is 417bp in size. The electrophoresis result of the PCR product shows thatThe corresponding living embryo with about 417bp of swimming band carries the germ line genetic Cre^ERTGenetically zebrafish embryos (fig. 5F).