阅读说明：本技术 Pear1基因突变试剂盒及其应用 (PEAR1 gene mutation kit and application thereof ) 是由 崔一民 向倩 王哲 胡琨 常国栋 于 2020-12-29 设计创作，主要内容包括：本发明涉及PEAR1基因突变试剂盒及其应用,所述试剂盒中包括TALEN内切酶或者编码TALEN内切酶的质粒。本发明的PEAR1基因突变试剂盒能够成功地对PEAR1基因进行突变,通过突变能够降低PEAR1蛋白活性,通过降低PEAR1蛋白活性,有助于提高肺栓塞的存活率。(The invention relates to a PEAR1 gene mutation kit and application thereof, wherein the kit comprises TALEN endonuclease or a plasmid for coding TALEN endonuclease. The PEAR1 gene mutation kit can successfully mutate the PEAR1 gene, can reduce the activity of PEAR1 protein through mutation, and is favorable for improving the survival rate of pulmonary embolism by reducing the activity of PEAR1 protein.)

The kit comprises TALEN endonuclease or plasmids for coding the TALEN endonuclease, wherein the target position of the TALEN endonuclease is selected from PEAR1-T1 and/or PEAR 1-T4;

PEAR1-T1：

TCACCACGACCACTAAGG agtcccacctgcgcccctt CAGCCTGCTCCCAGCTG A；

PEAR1-T4

TGGACTCCCGCCCACGC ctgcagtgctgtagg GGTTACTACGAGAGCAGA。

2. the kit of claim 1, wherein said PEAR1 gene mutation is deletion of two bases CC or 11 bases TCCCACCTGCG before TGCGCCCTTCAG.

3. The kit of claim 1, further comprising a primer set for successful gene mutation identification, said primer set comprising:

PEAR1-sens：TGAGTACTGATTCTCTCCATGGTG；

PEAR1-anti：AACTGAAGGAGCAGACAGTAGC。

4. use of the kit of any one of claims 1-3 in the preparation of a mouse with a mutant of the PEAR1 gene.

5. A pharmaceutical kit for treating pulmonary embolism, the kit comprising the kit of any one of claims 1-3 and a medicament for treating pulmonary embolism.

6. The pharmaceutical kit according to claim 5, wherein the treatment for pulmonary embolism is selected from one or more of ticagrelor, clopidogrel, rivaroxaban, dabigatran, apixaban antithrombotic agent.

7. Use of a pharmaceutical kit according to claim 5 or 6 for the manufacture of a medicament for the treatment of pulmonary embolism and/or for the inhibition of blood coagulation.

8. The use of claim 7, comprising reducing pulmonary embolism while increasing survival.

9. Application of a kit taking a PEAR1 gene and a receptor thereof as targets in preparation of medicines for treating pulmonary embolism and/or inhibiting blood coagulation.

Use of a PEAR1 gene mutant mouse for screening a medicament for treating pulmonary embolism.

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a PEAR1 gene mutation kit and application thereof.

Background

Platelet endothelial aggregation receptor-1 (PEAR 1) is a transmembrane protein containing 1034 amino acids and is expressed predominantly on megakaryocytes, platelets, and endothelial cells. PEAR1 contains an EMI domain (protein-protein interaction region) outside the cell, 15 repetitive sequences resembling epidermal growth factor, and a plurality of tyrosine and proline residues within the cytoplasm.

In multiple researches based on population, multiple independent researches find that the PEAR1 gene can regulate and control blood volumeThe plate functions and participates in the occurrence of thrombus-related events. A plurality of Genome-Wide-Association-Studies (GWAS) find that mutation of the PEAR1 gene can influence the aggregation capability of platelets. Juraj Sokol et al found that Single Nucleotide Polymorphisms (SNPs) of PEAR1 increased the incidence of sticky platelet syndrome, and another study included 101 pulmonary embolism patients and 132 matched healthy people, and found that the rs778026543 mutation of the PEAR1 gene was significantly different between pulmonary embolism patients and healthy people. In animal level studies, Maarten et al found that dextran sulfate could directly activate PEAR1 in vitro to cause concentration-dependent platelet aggregation through PEAR1 gene knockout mice experiments, but PEAR1 gene did not show obvious difference in tail bleeding and venous thrombosis in vivo. The PEAR1 gene knockout mouse adopts an international mouse phenotype alliance PEAR1 gene knockout mouse Pear1 based on C57BL/6N as background^{tm1a(KOMP)Wts}The exon 7 and 8 of PEAR1 gene are knocked out by using Cre/loxP and Flp/FRT systems to form a PEAR1 gene frameshift knockout mouse model, which is shown in figure 1. Therefore, no in vitro model of the PEAR1 gene mutation can simulate the effect of the PEAR1 gene mutation on thrombotic diseases in human.

Disclosure of Invention

In order to mutate the PEAR1 gene and provide a pharmaceutical kit for treating pulmonary embolism, the invention provides a PEAR1 gene mutation kit and application thereof. Specifically, in order to achieve the purpose of the present invention, the following technical solutions are proposed:

one aspect of the invention relates to a PEAR1 gene mutation kit, which comprises a TALEN endonuclease or a plasmid for coding the TALEN endonuclease, wherein the target position of the TALEN endonuclease is selected from the following PEAR1-T1 and/or PEAR 1-T4;

PEAR1-T1：

TCACCACGACCACTAAGG agtcccacctgcgcccctt CAGCCTGCTCCCAGCTG A；

PEAR1-T4

TGGACTCCCGCCCACGC ctgcagtgctgtagg GGTTACTACGAGAGCAGA。

in a preferred embodiment of the invention, the mutation of the PEAR1 gene refers to the deletion of two bases CC before TGCGCCCTTCAG or the deletion of 11 bases TCCCACCTGCG.

In a preferred embodiment of the present invention, the kit further comprises a primer set for successfully identifying gene mutation, wherein the primer set comprises:

PEAR1-sens：TGAGTACTGATTCTCTCCATGGTG；

PEAR1-anti：AACTGAAGGAGCAGACAGTAGC。

the invention also relates to application of the kit in preparation of a PEAR1 gene mutation mouse.

The invention also relates to a drug kit for treating pulmonary embolism, which comprises the PEAR1 gene mutation kit and a drug for treating pulmonary embolism. Preferably, the therapeutic pulmonary embolism is selected from one or more of ticagrelor, clopidogrel, rivaroxaban, dabigatran, apixaban antithrombotic agents.

The invention also relates to the application of the pharmaceutical kit in preparing medicines for treating pulmonary embolism and/or inhibiting blood coagulation.

In a preferred embodiment of the invention, the medicament is capable of reducing pulmonary embolism while increasing survival.

The invention also relates to application of the PEAR1 gene mutation reagent or the PEAR1 gene knockout reagent in preparing a medicament for treating pulmonary embolism and/or inhibiting blood coagulation. For the PEAR1 gene mutation reagent or the PEAR1 gene knock-out reagent of the present invention, those skilled in the art can determine the gene sequence according to PEAR1 by using a known method.

In a preferred embodiment of the present invention, the PEAR1 gene mutation agent or the PEAR1 gene knock-out agent is capable of reducing pulmonary embolism while increasing survival.

The invention also relates to application of a kit taking the PEAR1 gene and a receptor thereof as targets in preparation of medicines for treating pulmonary embolism and/or inhibiting blood coagulation.

In another aspect, the invention relates to the use of a PEAR1 gene mutant mouse in screening drugs for treating pulmonary embolism.

Advantageous effects

The PEAR1 gene mutation reagent or gene knockout provided by the invention can successfully mutate the PEAR1 gene, the activity of PEAR1 protein can be reduced through mutation, and the survival rate of pulmonary embolism can be improved through reducing the activity of PEAR1 protein.

Drawings

Fig. 1 is a schematic diagram showing a TALEN plasmid.

FIG. 2(a) is a diagram showing (a) the principle of Luciferase SSA for detecting TALEN activity; fig. 2(b) is a graph showing the TALEN activity ratio compared to the reference.

Fig. 3 is a graph showing the SSA activity results of PEAR1 TALEN.

FIG. 4 is a graph showing that the Western blotting method detects the expression of PEAR1 in WT, fountain 1 line, and fountain 7 line.

FIG. 5 is a graph showing the results of gene detection of a PEAR1 gene frameshift mutant mouse.

Fig. 6 is a graph showing the results of immunoblotting of the PEAR1 gene knock-out mouse.

FIG. 7 is a graph showing the comparison of survival rates of PEAR 1-/-mice and WT mice in pulmonary embolism experiments.

Figure 8(a) is a graph showing pulmonary embolism mouse lung pathology (a) WT mouse normal lung; FIG. 8(b) is a diagram showing the normal lung of a PEAR 1-/-mouse; FIG. 8(c) is a diagram showing pulmonary embolism in WT mice; fig. 8(d) is a graph showing pulmonary embolism 1 hour after administration of ticagrelor to WT mice; FIG. 8(d) is a diagram showing pulmonary embolism of PEAR 1-/-mice; fig. 8(e) is a graph showing pulmonary embolism 1 hour after administration of ticagrelor to PEAR 1-/-mice.

FIG. 9 is a graph showing a comparison of tail bleeding times of PEAR 1-/-mice and WT mice in a tail bleeding experiment.

Detailed Description

In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available.

Example 1

PEAR1 gene knockout mouse construction strategy and plasmid construction

Referring to the genomic data of PEAR1, a plurality of transcription products of the PEAR1 gene are found, the transcription products and a protein conserved region are analyzed, a TALEN endonuclease capable of specifically recognizing DNA of an exon functional region of the PEAR1 gene is designed, the TALEN endonuclease is used for shearing the genomic DNA of the PEAR1 gene to induce DNA damage, and mutation positions are formed in the homologous recombination repair process, and the TALEN plasmid is shown in figure 1.

SSA Activity detection of TALEN

TALEN plasmid construction, according to the analysis of transcription products of PEAR1 gene and protein conserved regions, frame shift mutation design is started before the first conserved region EMI, so TALEN target is designed on common exon 2 or 3 of ATG start.

After the construction of the TALEN plasmid is completed, the activity of the TALEN plasmid is detected by adopting a gene method reported by SSA Luciferase. The principle of detecting TALEN activity by LuciferassSA: the terminator is located in the center of the coding region of luciferase (see FIG. 2), which is not active. The target sequence of the TALEN is placed behind the terminator and the activity of the target sequence is detected. Through TALEN, the DNA of the cell is subjected to homologous recombination, and a new active luciferase is formed. And calculating activity data/activity of a control group, and judging the activity state of TALEN shearing according to the ratio. Meanwhile, the plasmid was subjected to SSA activity assay, and the assay results are shown in FIG. 3. According to the SSA activity detection result of TALEN, TALEN with higher activity is selected to be injected into fertilized eggs of mice in a microscopic mode, so that the PEAR 1-/-mice (PEAR1-T1 and PEAR1-T4 are constructed, and target sequences and positions are as follows).

TALEN design target site position 1: PEAR1-T1

tcaccacgaccactaagg agtcccacctgcgcccctt cagcctgctcccagctg a

TALEN design target site position 4: PEAR1-T4

tggactcccgcccacgc ctgcagtgctgtagg ggttactacgagagcaga

Construction of PEAR1 Gene knockout Founder mouse (fountain)

After the TALEN plasmids are linearized for PEAR1-T1 and PEAR1-T4, a corresponding kit is selected according to a promoter carried by the vector for in vitro transcription, and after the transcription is carried out to mRNA, the mRNA is microinjected into mouse fertilized eggs (total 80), and 14 births are obtained. After two weeks of age, rat tail DNA was extracted for sequencing, and mouse genotype was determined according to the sequencing results. A total of 2 mice (fountain 1 and fountain 7) underwent frameshift mutations, as shown in Table 1.

TABLE 1 construction of Founder mice (Foundatier)

Founder 1(m-pe-1, female) mice are selected to mate with wild type C57BL/6 female mice, and Founder 7(m-pe-7, female) mice are selected to mate with wild type C57BL/6 male mice. The born mice were genotyped two weeks old and F1-generation mice were established. Mice with the genotypes of PEAR1 (line 1, line K01) and PEAR1 (line 7, line K07) required for the experiments were bred by mating mice of the line farm 1 +/-heterozygous and the line farm 1 +/-heterozygous, respectively. Meanwhile, protein levels are identified, and the western blotting result shows that the expression of the PEAR1 protein is weaker in both a fountain 1(K01) mouse and a fountain 7(K07) mouse than that of a Wild Type (WT) mouse, so that the mouse strain with the lowest expression of the PEAR1 protein (K07) is selected as the experimental mouse strain, and the western blotting result is shown in a figure 4.

4. Breeding and experimental ethics of mice

The product line of the constructed gene knockout mouse is C57BL/6J Beijing. The mice were managed and raised by the experimental animal center of the first hospital, Beijing university, both of SPF grade (Specific Pathologen Free, no Specific Pathogen). The mice identified as the PEAR 1-/-type by the gene are matched with cages according to the male parent and the female parent in the ratio of 1:2, so that the mice breed in large quantities, the offspring mice are separated from the parents after weaning for 3 weeks, and the males and females of the mice are separated into cages for genotype identification. The resulting PEAR 1-/-mice were identified as experimental mice, and C57BL/6J wild-type mice (WT) of the same week age were purchased as a control group by the laboratory animal technology of Weitonghua, Beijing.

The scissors are disinfected by alcohol, and the young mouse is numbered by using a toe shearing method.

The experiment was approved by the welfare ethics examination committee of laboratory animals in north hospital (acceptance numbers 201548, 201746).

PEAR1 Gene and protein level detection

5.1PEAR1 Gene extraction and detection

5.1.1 Experimental methods

5.1.1.1 lysing rat tails and extracting genomic DNA

(1) Mice were numbered and then cut about 0.5cm long rat tail into 1.5ml EP tubes. The scissors which cut the tail of the mouse are wiped by alcohol, so that the cross contamination is avoided. Mouse tail gene extraction was performed according to the instructions of the Tiangen mouse tail genome extraction kit.

(2) To an EP tube containing rat tail, 200. mu.l of buffer GA was added.

(3) Mu.l of protease K solution was added to soak the rat tail in the solution.

(4) The rat tail was lysed in an oven at 56 ℃ overnight.

(5) Adding 200 μ l buffer solution GB into the lysed rat tail EP tube, reversing and mixing, carrying out water bath at 70 ℃ for 10min, and centrifuging for 30s to remove water drops on the tube wall.

(6) Adding 200 μ l of anhydrous ethanol, mixing on a shaker for 15s, centrifuging for 30s, and removing water drops on the tube wall. Transferring all liquid in the EP tube into an adsorption column, placing the adsorption column into a collecting tube, centrifuging at 12000rpm for 30s, pouring off waste liquid, and placing the adsorption column back into the collecting tube.

(7) Add 500. mu. lGD (ethanol added as confirmation) to the adsorption column, centrifuge at 12000rpm for 30s, and discard the waste.

(8) 600. mu. lPW (ethanol added was confirmed) was added to the adsorption column, centrifuged at 12000rpm for 30s, and the waste liquid was discarded.

(9) And (5) repeating the step (8).

(10) Putting the adsorption column into a collecting tube, centrifuging at 12000r for 2min, taking out, and discarding the waste liquid. Placing the adsorption column in a new 1.5ml EP tube, opening the cover of the adsorption column, and drying in an oven for 2-5 min.

(11) Adding 50 μ l TE into the adsorption column, closing the adsorption column cover, and placing in an oven for 2-5min for dissolving completely.

(12) Centrifuging at 12000rpm for 2min, taking out, randomly measuring the concentration of several genomes, and if no problem exists, abandoning the adsorption column.

5.1.2PCR amplification and sequencing

(1) PEAR 1-/-PCR primers for mouse genotype identification: the PCR fragment was 710bp in length.

PEAR1-sens：tgagtactgattctctccatggtg

PEAR1-anti：aactgaaggagcagacagtagc

(2) And (3) PCR reaction system: the reaction system for PEAR1 genotyping is shown in Table 2.

TABLE 2 PEAR1 Gene identification PCR reaction System

(3) PCR procedure for gene identification:

1)94℃2min

2)98℃10sec

3)60℃30sec

4)68℃1min

5) repeating 2) -4)35 cycles

6)68℃10min

7)16℃2min

(4) Sequencing was performed after storage at 4 ℃.

5.1.3 results of the experiment

The PEAR1 knockout mouse has frame shift mutation after 11 base knockouts of exon No. 5, tcccacctgcg, and the gene detection result is shown in figure 5.

5.2 protein level detection

5.2.1 Experimental methods

5.2.1.1 sample preparation

(1) Spleens of WT mice and PEAR1 knock-out mice were weighed at about 20mg, and 100. mu.l of protein lysate was added to each 10mg of spleens. Grind on ice with a glass grinder.

(2) The liquid was transferred to a new 1.5ml pre-cooled centrifuge tube and placed on ice for 15min to allow for adequate lysis of the protein.

(3) Centrifuge at 12000rpm for 10min at 4 ℃.

(4) The supernatant solution was aspirated by pipette and dispensed into new 0.5ml EP tubes and frozen at-20 ℃.

5.2.1.2 protein concentration determination

(1) According to the number of samples, the BCA reagent solution A and the solution B are mixed according to the proportion of 50:1 and shaken up. The BCA working solution is stable within 24 hours at room temperature.

(2) A protein standard was prepared at a concentration of 0.5 mg/ml. The prepared standard substance is added into a 96-well plate, the volume of each well is 0, 1, 2, 4, 8, 12, 16 and 20 mu l, and less than 20 mu l of wells are supplemented to 20 mu l by physiological saline.

(3) Add 2. mu.l protein sample to 96-well plate and then make up to 20. mu.l with physiological saline.

(4) To each well, 200. mu.l of BCA working solution was added and left at 37 ℃ for 30 min.

(5) The A562 wavelength was measured. Protein concentration was calculated from the standard curve.

5.2.1.3 Western blot experiment

(1) The gel plate is washed, the concentration of the gel is determined according to the molecular weight of the target protein, and the relative molecular weight of PEAR1 is 150kD, so that 10% separation gel and 4% concentrated gel are adopted in the experiment.

(2) And (3) fixing the prepared polyacrylamide gel, and loading a protein sample and a protein Marker, wherein each hole of the sample is 20 mu l, and each hole of the Marker is 3-5 mu l.

(3) Connecting an electrophoresis apparatus, wherein the electrophoresis condition is 80V and 30 min; the final volume was 120V, 75 min.

(4) The PVDF membrane with the size similar to that of the gel is cut by scissors and soaked in methanol for 10 min. Simultaneously, filter paper and sponge with the same size are prepared and soaked in the electrotransformation liquid.

(5) Taking off the gel, removing the redundant part, and putting the gel, the filter paper, the gel, the PVDF membrane, the filter paper and the sponge in order without generating air bubbles.

(6) Aligning the anode and the cathode, corresponding to the gel at the cathode, corresponding to the PVDF membrane at the anode, pouring the electrotransformation liquid, adjusting to constant current, and rotating the membrane for about 75 min.

(7) The membrane was removed and rinsed 1 time for 5min in TBST solution to remove the buffer.

(8) The membrane was immersed in the prepared blocking solution and incubated on a shaker for 1 hour at room temperature.

(9) The anti-PEAR 1 antibody was diluted 1:200 with blocking solution, and then the PVDF membrane was incubated with primary antibody overnight on a shaker at 4 ℃. After incubation, the cells were washed 3 times for 5min in TBST.

(10) The membrane was placed in HRP-labeled secondary antibody diluted with blocking solution (dilution ratio 1:10000) and incubated on a shaker at room temperature for 1 hour. The membrane was then removed and washed 3 times with TBST for 5min each.

(11) ECL exposure: ECL chemiluminescent color-developing solutions were used.

5.2.2 results of the experiment

The western blot results showed that the PEAR1 protein was not present in the offspring propagated in the PEAR1 knockout mice, and the results are shown in fig. 6.

Functional experiments with PEAR 1.

6.1 Experimental methods

(1) 20 mice of the 15-20w week-old experimental group PEAR 1-/-and the control group WT mice were prepared and weighed.

(2) 10 mice in each of the experimental group and the control group were subjected to intragastric administration at a concentration of 0.01ml/g using physiological saline. Taking 10 mice in each of the experimental group and the control group, and performing intragastric administration by using ticagrelor according to the dose of 27mg/kg and 0.01ml/g for 1 hour.

(3) The mouse eyeball is raised, and ADP 0.005ml/g is injected into orbital vein according to the dose of 250 mg/kg.

(4) The survival of the mice was observed after 30 minutes.

(5) The dead mice are fixed after being anesthetized by intraperitoneal injection of 0.01ml/g of 20% urethane, the dead mice are directly fixed, lung tissues of the mice are taken, surface blood is washed away in physiological saline, and the mice are stored in 4% paraformaldehyde solution.

(6) And (3) observing the thrombus condition in the pulmonary blood vessel of the mouse by using an HE staining method.

(7) Histogram was performed using Origin software, and the results were expressed as mean ± standard mean error (mean ± SD), and P values were calculated using Student's t-test method.

6.2 results of the experiment

The final inclusion group was 10 in the PEAR 1-/-mice ticagrelor dose group and 9 in the saline control group; WT mice were dosed with ticagrelor 10, and saline control group 10. The weight and week age of the PEAR 1-/-mouse saline group and the WT saline group were not statistically different.

The pulmonary embolism results are shown in table 3 and fig. 7, and the lung tissue pathology results are shown in fig. 8. As a result, it was found that:

the big blood vessel and the small blood vessel of the normal lung of the WT group of mice have no obvious thrombus, and the big blood vessel is spread over the thrombus after pulmonary embolism molding, so the mice die.

② after the WT mice are given ticagrelor, pulmonary embolism modeling is carried out, the survival rate is obviously improved, and partial thrombus can be seen in the large pulmonary blood vessels.

③ the PEAR 1-/-mice can see partial thrombus in the pulmonary great vessels under the normal condition, the great vessels are spread over the thrombus after pulmonary embolism modeling, but the survival rate of the mice is obviously higher than that of the WT mice.

And fourthly, after the PEAR 1-/-mice are given ticagrelor, pulmonary embolism modeling is carried out, and compared with a group without the drug, the survival rate is not obviously improved, and the pulmonary thrombosis is reduced.

TABLE 3 pulmonary embolism experiments in PEAR 1-/-and WT mice

7. Tail bleeding test

7.1 Experimental methods

(1) 16 mice each of 14-19w week-old experimental group PEAR 1-/-mice and control group WT mice were prepared and weighed.

(2) 8 mice in the experimental group and the control group were each collected and gavaged with physiological saline at 0.01 ml/g. Taking 8 mice in each of the experimental group and the control group, and performing intragastric administration by using ticagrelor according to the concentration of 27mg/kg and 0.01ml/g for 30 min.

(3) Mice were anesthetized with intraperitoneal injection of 20% urethane at 0.01ml/g and fixed appropriately.

(4) Measurements were started at the tail root with a ruler and marked at 2cm with a marker. A sharp scalpel was used to cut a wound of about 2mm depth at the mark, and the time for blood to naturally flow out was used as a zero point.

(5) And (5) observing the tail bleeding condition of the mouse, lightly rubbing the tail shearing position of the mouse with filter paper every 30s, and taking the time when no mouse blood exists on the filter paper as the end time.

(6) The time to rat tail bleeding was recorded for the PEAR 1-/-and WT mice, respectively, and histogram was performed using Origin software, with the results expressed as mean + -standard mean error (mean + -SD), and P-values were calculated using Student's t-test method.

7.2 results of the experiment

7 mice were finally included in the PEAR 1-/-mice ticagrelor administration group, and 8 saline control groups; the WT mice were given 8 Ticagrelor groups, and the saline control group was 8. The body weight of the PEAR 1-/-mouse saline group was statistically different from that of the WT saline group.

The tail bleeding time is shown in table 4 and fig. 9. As a result, it was found that:

TABLE 4 PEAR1^-/-Tail bleeding test of mice and WT mice

Compared with a WT normal saline group and a ticagrelor administration group, the bleeding time is remarkably prolonged, and the success of constructing a ticagrelor administration model is proved.

② the bleeding time of the PEAR 1-/-mouse physiological saline group is obviously prolonged compared with the WT physiological saline group, which indicates that the PEAR1 gene can promote the blood coagulation process in the mouse body, and the blood coagulation function of the mouse is reduced due to the gene knockout.

③ compared with the normal saline group, the bleeding time of the PEAR 1-/-mice ticagrelor administration group is prolonged, but no significant difference is seen, which indicates that the PEAR1 gene may influence the drug effect of ticagrelor.

The foregoing describes preferred embodiments of the present invention, but is not intended to limit the invention thereto. Modifications and variations of the embodiments disclosed herein may be made by those skilled in the art without departing from the scope and spirit of the invention.

Sequence listing

<110> first Hospital of Beijing university

<120> PEAR1 gene mutation kit and application thereof

<130> CP20790

<141> 2020-12-29

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 55

<212> DNA

<213> TALEN

<400> 1

tcaccacgac cactaaggag tcccacctgc gccccttcag cctgctccca gctga 55

<210> 2

<211> 50

<212> DNA

<213> TALEN

<400> 2

tggactcccg cccacgcctg cagtgctgta ggggttacta cgagagcaga 50

<210> 3

<211> 24

<212> DNA

<213> PEAR1

<400> 3

tgagtactga ttctctccat ggtg 24

<210> 4

<211> 22

<212> DNA

<213> PEAR1

<400> 4

aactgaagga gcagacagta gc 22

<210> 5

<211> 11

<212> DNA

<213> PEAR1

<400> 5

tcccacctgc g 11