Optimal index sequences for multiple massively parallel sequencing
阅读说明:本技术 用于多重大规模平行测序的最佳索引序列 (Optimal index sequences for multiple massively parallel sequencing ) 是由 瑞恩·凯利 戈登·比恩 埃里克·弗马斯 于 2018-05-01 设计创作,主要内容包括:所公开的实施方案涉及被配置成鉴定核酸样品的来源的索引寡核苷酸,以及用于鉴定和制备索引寡核苷酸的方法、设备、系统和计算机程序产品。在一些实施方式中,索引寡核苷酸包含索引序列集,该索引序列集中的任何两个索引序列之间的汉明距离满足一个或更多个标准。还提供了用于使用索引寡核苷酸确定感兴趣的序列的系统、设备和计算机程序产品。(The disclosed embodiments relate to index oligonucleotides configured to identify the source of a nucleic acid sample, and methods, apparatus, systems, and computer program products for identifying and preparing index oligonucleotides. In some embodiments, the index oligonucleotide comprises a set of index sequences, the hamming distance between any two index sequences in the set of index sequences satisfies one or more criteria. Systems, devices, and computer program products for determining a sequence of interest using an indexing oligonucleotide are also provided.)
1. A set of oligonucleotides comprising a plurality of subsets of oligonucleotides, wherein:
the set of oligonucleotides is configured to identify a source of nucleic acid samples in multiplexed massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules;
the set of oligonucleotides comprises a set of index sequences comprising at least 6 different index sequences, each of a plurality of subsets of the oligonucleotides comprising a plurality of index sequences of the set of index sequences;
a hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is at least 2; and
the set of index sequences comprises a plurality of pairs of color balanced index sequences, wherein any two bases at respective sequence positions of each pair of color balanced index sequences comprises both: (i) an adenine (A) base or a cytosine (C) base, and (ii) a guanine (G) base, a thymine (T) base or a uracil (U) base.
2. The set of oligonucleotides of claim 1, wherein each of the plurality of subsets of oligonucleotides comprises one or more pairs of color-balanced index sequences.
3. The set of oligonucleotides of any one of the preceding claims, wherein the set of oligonucleotides comprises (a) double-stranded or Y-shaped sequencing adaptors each strand of each double-stranded or Y-shaped sequencing adaptor comprising an index sequence of the set of index sequences or the reverse complement thereof; or (b) pairs of single stranded oligonucleotides, each pair being provided together in a reagent, each oligonucleotide of a pair comprising an index sequence of the set of index sequences or the reverse complement thereof.
4. The set of oligonucleotides of claim 3, wherein (a) each Y-shaped or double-stranded sequencing adaptor comprises a first strand comprising a first index sequence selected from a first subset of the set of index sequences and a second strand comprising a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset); or (b) each pair of oligonucleotides comprises a first oligonucleotide comprising a first index sequence selected from a first subset of the set of index sequences and a second oligonucleotide comprising a second index sequence selected from a second subset of the set of index sequences (or the reverse complement of the second subset).
5. The oligonucleotide set of claim 4, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.
6. The set of oligonucleotides of claim 4, wherein the first subset comprises the subset listed in Table 1 and the second subset comprises the subset listed in Table 2.
7. The set of oligonucleotides of claim 4, wherein said first index sequence and said second index sequence are, respectively: the nth 10-mer of SEQ ID NO. 10 and the nth 10-mer of SEQ ID NO. 11 or the reverse complement thereof; 12 and 13 or the reverse complement thereof; 14-th 10-mer of SEQ ID NO. 14 and the nth 10-mer of SEQ ID NO. 15 or the reverse complement thereof; the nth 10-mer of SEQ ID NO 16 and the nth 10-mer of SEQ ID NO 17 or the reverse complement thereof; the nth 10-mer of SEQ ID NO 18 and the nth 10-mer of SEQ ID NO 19 or the reverse complement thereof.
8. The set of oligonucleotides of claim 4, wherein the first subset and the second subset are the same.
9. The oligonucleotide set of claim 8, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.
10. The set of oligonucleotides of claim 8, wherein the subset is selected from one of the subsets of index sequences in Table 3.
11. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises the 10 mer of SEQ id No. 9.
12. The set of oligonucleotides of any one of the preceding claims, wherein each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to a 10 mer in one of: 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 SEQ ID NO.
13. The set of oligonucleotides of any one of the preceding claims, wherein each of the plurality of subsets of oligonucleotides comprises an index sequence corresponding to the reverse complement of a 10-mer in one of: 11, 13, 15, 17, or 19 SEQ ID NO.
14. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises a plurality of non-overlapping subsets of index sequences, the hamming distance between any two index sequences in any subset being not less than a second standard value.
15. The set of oligonucleotides of claim 14, wherein the second standard value is greater than the first standard value.
16. The set of oligonucleotides of claim 15, wherein said first standard value is 4 and said second standard value is 5.
17. The set of oligonucleotides of any one of the preceding claims, wherein oligonucleotides in the set of oligonucleotides comprise a primer having an index sequence on its 3 'end and an index sequence on its 5' end.
18. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences is comprised in Y-shaped sequencing adaptors, each Y-shaped sequencing adaptor comprising an index sequence on only one strand.
19. The set of oligonucleotides of any one of the preceding claims, wherein the set of oligonucleotides comprises Polymerase Chain Reaction (PCR) primers or reverse complements thereof.
20. The set of oligonucleotides of any one of the preceding claims, wherein said first standard value is 3.
21. The set of oligonucleotides of any one of the preceding claims, wherein said first standard value is 4.
22. The set of oligonucleotides of any one of the preceding claims, wherein the edit distance between any two index sequences in the set of index sequences is not less than a third standard value.
23. The set of oligonucleotides of claim 22, wherein the edit distance is a modified Levenshtein distance, wherein end gaps are not assigned penalties.
24. The set of oligonucleotides of claim 22, wherein said third standard value is 3.
25. The set of oligonucleotides of claim 22, wherein said third standard value is 2.
26. The set of oligonucleotides of claim 22, wherein:
each index sequence in the set of index sequences has 8 bases;
the first standard value is 3; and is
The third standard value is 2.
27. The set of oligonucleotides of claim 26, wherein the set of index sequences comprises the sequences listed under example 2.
28. The set of oligonucleotides of claim 22, wherein:
each index sequence in the set of index sequences has 10 bases;
the first standard value is 4; and is
The third standard value is 3.
29. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences does not comprise any subsequence of the sequence of an adaptor or primer in the sequencing platform, or the reverse complement of said subsequence.
30. The set of oligonucleotides of any one of the preceding claims, wherein the sequence of an adapter or primer in the sequencing platform comprises SEQ ID NO:1(AGATGTGTATAAGAGACAG), SEQ ID NO:3(TCGTCGGCAGCGTC), SEQ ID NO:5(CCGAGCCCACGAGAC), SEQ ID NO:7(CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO:8 (AATGATACGGCGACCACCGAGATCTACAC).
31. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 32 bases or less.
32. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 16 bases or less.
33. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 10 bases or less.
34. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 10 bases.
35. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 8 or fewer bases.
36. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 8 bases.
37. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 7 bases or less.
38. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 6 bases or less.
39. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 5 or fewer bases.
40. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of oligonucleotides has 4 or fewer bases.
41. The set of oligonucleotides of any one of the preceding claims, wherein the set of indexing sequences does not comprise indexing sequences empirically determined to have poor performance in multiple massively parallel sequencing in indexing the source of a nucleic acid sample.
42. The set of oligonucleotides of claim 41, wherein the non-included index sequences comprise the sequences in Table 4.
43. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 12 different index sequences.
44. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 20 different index sequences.
45. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 24 different index sequences.
46. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 28 different index sequences.
47. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 48 different index sequences.
48. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 96 different index sequences.
49. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises at least 384 different index sequences.
50. The set of oligonucleotides of any one of the preceding claims, wherein the set of indexed sequences does not comprise any homopolymer of four or more consecutive identical bases.
51. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences does not comprise an index sequence that matches or is reverse complementary to one or more sequencing primer sequences.
52. The set of oligonucleotides of claim 51, wherein the sequencing primer sequence is comprised in the sequence of the oligonucleotides.
53. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences does not comprise index sequences that match or are reverse complementary to one or more flow cell amplification primer sequences.
54. The set of oligonucleotides of claim 53, wherein the flow cell amplification primer sequence is comprised in a sequence of the oligonucleotides.
55. The set of oligonucleotides of any one of the preceding claims, wherein the set of index sequences comprises index sequences having the same number of bases.
56. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of index sequences has between 2 and 6 combined numbers of guanine bases and cytosine bases.
57. The set of oligonucleotides of any one of the preceding claims, wherein each index sequence in the set of index sequences has a guanine/cytosine (GC) content of between 25% and 75%.
58. The set of oligonucleotides of any one of the preceding claims, wherein the set of oligonucleotides comprises DNA oligonucleotides or RNA oligonucleotides.
59. The set of oligonucleotides of any one of the preceding claims, wherein the set of oligonucleotides is provided in a container comprising a plurality of separate compartments.
60. The set of oligonucleotides of claim 59, wherein the container comprises a multi-well plate.
61. The set of oligonucleotides of claim 59, wherein each compartment comprises a plurality of oligonucleotides comprising one index sequence in the set of index sequences that is different from the index sequences comprised in the other compartments.
62. The set of oligonucleotides of claim 59, wherein each compartment comprises (a) a first plurality of oligonucleotides comprising a first index sequence in the set of index sequences and (b) a second plurality of oligonucleotides comprising a second index sequence in the set of index sequences, the ordered combination of (a) and (b) in the compartment being different from the ordered combination of (a) and (b) in any other compartment.
63. The set of oligonucleotides of claim 62, wherein the first index sequence in each compartment is different from the first index sequence in any other compartment, and wherein the second index sequence in each compartment is different from the second index sequence in any other compartment.
64. The set of oligonucleotides of claim 62, wherein the first index sequence and the second index sequence in a compartment are, respectively: the nth 10-mer of SEQ ID NO:10 and the nth 10-mer of SEQ ID NO:11 (or the reverse complement thereof); 12 and 13 (or the reverse complement thereof); the nth 10-mer of SEQ ID NO:14 and the nth 10-mer of SEQ ID NO:15 (or the reverse complement thereof); the nth 10-mer of SEQ ID NO:16 and the nth 10-mer of SEQ ID NO:17 (or the reverse complement thereof); the nth 10-mer of SEQ ID NO:18 and the nth 10-mer of SEQ ID NO:19 (or the reverse complement thereof).
65. The oligonucleotide set of claim 62, wherein the first plurality of oligonucleotides comprises a P5 flow cell amplification primer binding site and the second plurality of oligonucleotides comprises a P7' flow cell amplification primer binding site.
66. The set of oligonucleotides of claim 62, wherein said first plurality of oligonucleotides comprises the i5 index sequence and said second plurality of oligonucleotides comprises the i7 index sequence.
67. The set of oligonucleotides of claim 62, wherein each index sequence contained in the first plurality of oligonucleotides is selected from a first subset of the set of index sequences and each index sequence contained in the second plurality of oligonucleotides is selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset.
68. The set of oligonucleotides of claim 67, wherein the Hamming distance between any two index sequences in the first subset or the Hamming distance between any two index sequences in the second subset is not less than a second standard value.
69. The set of oligonucleotides of claim 67, wherein said second standard value is greater than said first standard value.
70. The set of oligonucleotides of claim 69, wherein said first standard value is 4 and said second standard value is 5.
71. The set of oligonucleotides of claim 70, wherein the first subset is a subset selected from Table 1 and the second subset is a subset selected from Table 2.
72. The set of oligonucleotides of claim 62, wherein the index sequences comprised in said first plurality of oligonucleotides and said second plurality of oligonucleotides are selected from a subset of said set of index sequences.
73. The set of oligonucleotides of claim 72, wherein the Hamming distance between any two index sequences in the subset is not less than a second standard value.
74. The set of oligonucleotides of claim 73, wherein said second standard value is greater than said first standard value.
75. The set of oligonucleotides of claim 74, wherein said first standard value is 4 and said second standard value is 5.
76. The set of oligonucleotides of claim 75, wherein said subset is selected from the subsets in Table 3.
77. The set of oligonucleotides of claim 62, wherein the plurality of individual compartments are arranged in an array of one or more rows of compartments and one or more columns of compartments.
78. The set of oligonucleotides of claim 77, wherein every 1/n row and/or every 1/m column of compartments comprises oligonucleotides comprising at least one pair of color-balanced index sequences, wherein n and m are each selected from integers in the range of 1 to 24.
79. The set of oligonucleotides of claim 77, wherein the plurality of individual compartments are arranged in an array of 8 rows and 12 columns or in an array of 16 rows and 24 columns.
80. The oligonucleotide set of claim 79, wherein each 1/4 rows of compartments comprises oligonucleotides comprising at least one pair of color balanced index sequences, and wherein each 1/4 columns of compartments comprises oligonucleotides comprising at least one pair of color balanced index sequences.
81. The oligonucleotide set of claim 80, wherein the plurality of individual compartments are arranged in an array of A-H rows and 1-12 columns, and wherein for the nth compartment on lists A1, A2, A3, … …, A12, B1, B2, … …, B12, … …, H1, H2, … …, H12, the first and second index sequences are: the nth 10-mer of SEQ ID NO:10 and the nth 10-mer of SEQ ID NO:11 (or the reverse complement thereof); 12 and 13 (or the reverse complement thereof); the nth 10-mer of SEQ ID NO:14 and the nth 10-mer of SEQ ID NO:15 (or the reverse complement thereof); or the nth 10-mer of SEQ ID NO:16 and the nth 10-mer of SEQ ID NO:17 (or the reverse complement thereof).
82. The set of oligonucleotides of claim 62, wherein the plurality of individual compartments comprise oligonucleotides comprising a first plurality of index sequences arranged in the layout shown in FIG. 4B, and the plurality of individual compartments further comprise oligonucleotides comprising a second plurality of index sequences arranged in the layout shown in FIG. 4C.
83. A set of oligonucleotides consisting essentially of a plurality of subsets of oligonucleotides, wherein:
the set of oligonucleotides is configured to identify a source of nucleic acid samples in multiplexed massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules;
each of a plurality of subsets of the oligonucleotides comprising a unique index sequence, the index sequences in the plurality of subsets consisting of a set of index sequences;
a hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is at least 2; and
the set of index sequences comprises a plurality of pairs of color balanced index sequences, wherein any two bases at respective sequence positions of each pair of color balanced index sequences comprises both: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base.
84. A method for preparing a plurality of oligonucleotides for multiplex massively parallel sequencing, the method comprising:
(a) selecting a set of index sequences from a pool of different index sequences, wherein
The set of index sequences comprises at least 6 different sequences;
a hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is at least 2; and
the set of index sequences comprises a plurality of pairs of color balanced index sequences, wherein any two bases at respective sequence positions of each pair of color balanced index sequences comprises both: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; and
(b) synthesizing the plurality of oligonucleotides comprising the set of index sequences.
85. The method of any one of claims 84-85, wherein the plurality of oligonucleotides comprise double-stranded or Y-shaped sequencing adaptors, each strand of each sequencing adaptor comprising an index sequence of the set of index sequences.
86. The method of claim 85, wherein each Y-shaped sequencing adaptor comprises a first strand comprising an index sequence selected from a first subset of the set of index sequences and a second strand comprising an index sequence selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset.
87. The method of claim 86, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.
88. The method of claim 86, wherein one or more of the first subsets comprise index sequences listed in Table 1 and one or more of the second subsets comprise index sequences listed Table 2.
89. The method of 85, wherein each double-stranded or Y-shaped sequencing adaptor comprises a first strand comprising an index sequence selected from a subset of a plurality of the set of index sequences and a second strand comprising an index sequence selected from the subset.
90. The method of claim 89, wherein the first strand of each Y-shaped sequencing adapter comprises a P5 flow cell amplification primer binding site and the second strand of each Y-shaped sequencing adapter comprises a P7' flow cell amplification primer binding site.
91. The method of claim 89, wherein the set of index sequences comprises the index sequences in Table 3.
92. The method of any one of claims 84-91, wherein an oligonucleotide of the plurality of oligonucleotides comprises an index sequence on its 3 'end and an index sequence on its 5' end.
93. The method of any one of claims 84-92, wherein the set of index sequences are contained in double-stranded or Y-shaped sequencing adaptors, each sequencing adaptor comprising an index sequence in only one strand.
94. The method of any one of claims 84-93, wherein the plurality of oligonucleotides comprise Polymerase Chain Reaction (PCR) primers or reverse complements thereof.
95. The method of any one of claims 84-94, wherein the set of index sequences does not comprise any subsequences of the sequences of adaptors or primers in the sequencing platform, or the reverse complements of the subsequences.
96. The method of any one of claims 84-95, wherein the sequence of adapters or primers in the sequencing platform comprises SEQ ID NO:1(AGATGTGTATAAGAGACAG), SEQ ID NO:3(TCGTCGGCAGCGTC), SEQ ID NO:5(CCGAGCCCACGAGAC), SEQ ID NO:7(CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO:8 (AATGATACGGCGACCACCGAGATCTACAC).
97. The method of any one of claims 84-96, wherein step (a) comprises:
(i) selecting a candidate set of index sequences from the pool of index sequences;
(ii) separating the selected candidate sets into groups of color-balanced index sequence pairs; and
(iii) each group is divided into two subgroups of color-balanced pairs using a bipartite graph matching algorithm, where each color-balanced pair is a node in the bipartite graph.
98. The method of claim 97, wherein two nodes are connected if the hamming distance between their index sequences is less than a second criterion value, wherein the second criterion value is greater than the first criterion value.
99. The method of claim 98, wherein the first standard value is 4 and the second standard value is 5.
100. The method of claim 97, wherein step (i) comprises:
(1) adding to the candidate set color-balanced index sequence pairs randomly selected from a pool of the index sequences, wherein the pool comprises all possible n-mers;
(2) sorting index sequences remaining in the pool of index sequences based on minimum Hamming distances from members of the candidate set;
(3) removing any remaining index sequences for which the minimum hamming distance to members of the candidate set is less than a first criterion value or for which the minimum edit distance to members of the candidate set is less than a third criterion value; and
repeating steps (1) - (3) to maximize the size of the candidate set.
101. The method of claim 100, wherein the first standard value is 4 and the third standard value is 3.
102. The method of claim 100, wherein the n-mer comprises an 8-mer, a 9-mer, or a 10-mer.
103. The method of claim 100, wherein the first standard value is 3, the third standard value is 2, and the n-mers comprise 8-mers.
104. The method of claim 97, wherein step (ii) comprises:
(1) randomly selecting a seed for each of the plurality of groups; and
(2) greedily extending each of the plurality of groups.
105. The method of claim 97, further comprising, prior to step (i), removing a subset of index sequences from the pool of index sequences.
106. The method of claim 105, wherein the subset of removed index sequences comprises index sequences having four or more consecutive identical bases.
107. The method of claim 105, wherein the removed subset of index sequences comprises index sequences having a combined number of guanine bases and cytosine bases that is less than 2 or greater than 6.
108. The method of claim 105, wherein the removed subset of index sequences comprises index sequences having a G/C content of less than 25% or greater than 75%.
109. The method of claim 105, wherein the subset of removed index sequences comprises index sequences having sequences that match or are reverse complementary to one or more sequencing primer sequences.
110. The method of claim 109, wherein the sequencing primer sequence is comprised in the sequence of an indexing oligonucleotide.
111. The method of claim 105, wherein the subset of removed index sequences comprises index sequences having sequences that match or are reverse complementary to one or more flow cell amplification primer sequences.
112. The method of claim 111, wherein the flow cell amplification primer sequence is comprised in the sequence of an index oligonucleotide.
113. The method of claim 105, wherein the subset of removed index sequences comprises index sequences empirically determined to have poor performance in indexing the source of nucleic acid samples in multiplex massively parallel sequencing.
114. The method of claim 113, wherein the removed subset of index sequences comprises the sequences in table 4.
115. A computer program product comprising a non-transitory machine-readable medium storing program code that, when executed by one or more processors of a computer system, causes the computer system to implement a method for selecting a set of index sequences to be incorporated into a set of oligonucleotides configured for multiple massively parallel sequencing, the program code comprising:
(a) code for adding to a candidate set of index sequences pairs of color-balanced index sequences randomly selected from a pool of different index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences comprises both: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base;
(b) code for sorting index sequences remaining in a pool of the index sequences based on a minimum Hamming distance to members of the candidate set;
(c) code for removing any remaining index sequences for which the minimum hamming distance to members of the candidate set is less than a first criterion value or for which the minimum edit distance to members of the candidate set is less than a second criterion value;
(d) code for repeating (a) - (c) to maximize a size of the candidate set; and
(e) code for selecting the set of index sequences to be incorporated into the set of oligonucleotides from the candidate set, the set of oligonucleotides configured for multiplex massively parallel sequencing.
116. The computer program product of claim 115, the program code further comprising:
code for separating the candidate set into a plurality of groups; and
code for dividing each group into two subgroups using a bipartite graph matching algorithm, wherein each index sequence is a node.
117. The computer program product of any one of claims 115-116, the program code further comprising code for controlling a nucleic acid synthesizer to synthesize the set of oligonucleotides configured for multiplex massively parallel sequencing.
Brief Description of Drawings
FIGS. 1A-1C illustrate an exemplary workflow for sequencing nucleic acid fragments using index oligonucleotides.
Figure 1D illustrates a process for sequencing a target nucleic acid derived from a plurality of samples, according to some embodiments.
Fig. 1E and 1F show the process of performing transposome (transposome) -mediated fragmentation and applying index primers to nucleic acids with double-stranded short universal adaptors attached to both ends.
Figure 1G shows a sequence of a target nucleic acid having a double-stranded short universal adaptor attached to both ends, according to some embodiments.
Fig. 1H shows a sequence contained in a Y-shaped universal adaptor according to some embodiments, a sequence of a target nucleic acid having a Y-shaped short universal adaptor attached to two ends according to some embodiments.
Fig. 1I shows the sequence in the I7 index primer according to some embodiments.
Fig. 1J shows sequences in the i7 index primer according to some embodiments.
Figure 1K illustrates a process of adding an index sequence to a nucleic acid with Y-shaped short universal adaptors on both ends, according to some embodiments.
FIGS. 2A-2D illustrate various embodiments of indexing oligonucleotides.
FIG. 3 schematically illustrates an index sequence design that provides a mechanism for detecting errors occurring in an index sequence during a sequencing process.
FIGS. 4A-4C schematically illustrate example layouts of multi-well plates and index oligonucleotides in which the index oligonucleotides may be provided.
FIG. 5 shows a process for preparing indexing oligonucleotides, such as indexed adaptors.
FIG. 6 illustrates one embodiment of a dispensing system (dispersystem) for generating a decision (call) or diagnosis from a test sample.
FIG. 7 illustrates a computer system that may be used as a computing device, according to some embodiments.
Detailed Description
Numerical ranges include the numbers defining the range. It is intended that each maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
The headings provided herein are not intended to be limiting of the disclosure.
Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Various scientific dictionaries including terms contained herein are well known and available to those skilled in the art. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments disclosed herein, some methods and materials are described.
The terms defined immediately below are more fully described by reference to the specification as a whole. It is to be understood that this disclosure is not limited to the particular methodologies, protocols, and reagents described, as these may vary depending on the context in which they are used by those skilled in the art.
Definition of
As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.
As used herein, the term "comprises/comprising/including" encompasses the meaning of "comprising/including", "consisting of" or "consisting essentially of" where appropriate in context and unless otherwise specified.
Unless otherwise indicated, nucleic acids are written left to right in the 5 'to 3' direction and amino acid sequences are written left to right in the amino to carboxy direction, respectively.
Edit distance (edit distance) is a measure of how different two strings (e.g., words) differ from each other quantified by counting the minimum number of operations required to convert one string to another. In bioinformatics, it can be used to quantify the similarity of DNA sequences, which can be viewed as a string of letters A, C, G and T.
Different forms of edit distance use different sets of string operations. The Levenshtein distance is a common type of edit distance. The string operations of the Levenshtein distance account for the number of deletions, insertions, and substitutions of characters in the string. In some embodiments, other variations of edit distance may be used. For example, other variations of edit distance may be obtained by limiting the set of operations. The Longest Common Subsequence (LCS) distance is the edit distance with insertions and deletions as the only two edit operations, both in unit cost. The Jaro-Winkler distance can be obtained from an edit distance that allows only transposition. Similarly, by only allowing substitution, a hamming distance is obtained that is limited to equal length strings. The hamming distance between two strings of equal length is the number of positions where the corresponding symbols are different. In other words, it measures the minimum number of substitutions required to convert one string to another, or the minimum number of errors required to convert one string to another.
In some implementations, different string operations may have different weights for edit distance. For example, a replace operation may have a weight of 3, while an insert/delete (indel) may have a weight of 2. In some embodiments, different kinds of matches may have different weights. For example, A-A matches may have twice the weight of G-G matches.
As used herein, the term "universal sequence" refers to a sequence region that is common to two or more nucleic acid molecules (e.g., adaptor-target-adaptor molecules), wherein the molecules also have sequence regions that are different from one another. The universal sequences present in different members of the collection of molecules may allow for the capture of a plurality of different nucleic acids using a population of universal capture nucleic acids that are complementary to portions of the universal sequences (e.g., universal extension primer binding sites). Non-limiting examples of universal extension primer binding sites include sequences that are identical or complementary to the P5 primer and the P7 primer. Similarly, universal sequences present in different members of a collection of molecules can allow for the replication or amplification of multiple different nucleic acids using a population of universal primers that are complementary to portions of the universal sequences (e.g., universal primer binding sites). Thus, a universal capture nucleic acid or universal primer comprises a sequence that can specifically hybridize to a universal sequence. Target nucleic acid molecules can be modified, for example, by attaching adapters at one or both ends of different target sequences, as described herein.
When referring to amplification primers, such as universal primer extension primers, the terms "P5" and "P7" may be used. The terms "P5 '" (P5 primer) and "P7'" (P7 primer) refer to the complements of P5 and P7, respectively. It will be appreciated that any suitable amplification primer may be used in the methods presented herein, and that the use of P5 and P7 are merely exemplary embodiments. The use of amplification primers such as P5 and P7 on flow cells is known in the art, as exemplified by the disclosures of WO 2007/010251, WO 2006/064199, WO 2005/065814, WO 2015/106941, WO 1998/044151 and WO 2000/018957. For example, any suitable forward amplification primer, whether immobilized or in solution, can be useful for hybridization to a complementary sequence and amplification of the sequence in the methods presented herein. Similarly, any suitable reverse amplification primer, whether immobilized or in solution, can be useful for hybridization to a complementary sequence and amplification of the sequence in the methods presented herein. One skilled in the art will understand how to design and use primer sequences suitable for capturing and amplifying nucleic acids as presented herein.
The terms "upstream" and "5 ' (5 ' -of) at … are used interchangeably with respect to position in a nucleic acid sequence to refer to relative positions in the nucleic acid sequence further toward the 5' end of the sequence.
The terms "downstream" and "3 ' (3 ' -of) at …, with respect to position in a nucleic acid sequence, are used interchangeably to refer to relative positions in the nucleic acid sequence further toward the 3' end of the sequence.
One step in some embodiments of the methods of the present disclosure is fragmenting and tagging target DNA using an in vitro transposition reaction to generate tagged DNA fragments. In vitro transposition reactions require transposases, transposon end compositions and appropriate reaction conditions.
By "transposase" is meant an enzyme that is capable of forming a functional complex with a transposon end containing composition (e.g., transposon end composition) and catalyzing the insertion or transposition of the transposon end containing composition into a double stranded target DNA incubated therewith in an in vitro transposition reaction. Transposases also include integrases from retrotransposons (retrotransposposon) and retroviruses.
A "transposition reaction" is a reaction in which one or more transposon ends are inserted into a target DNA at random or nearly random sites. In some embodiments, the transposition reaction causes the target DNA or RNA to be fragmented at random positions. Important components in the transposition reaction are the transposase and DNA oligonucleotides exhibiting the nucleotide sequence of the transposon ends (including transferred transposon end sequences and their complements, non-transferred transposon end sequences) and other components required for the formation of a functional transposition complex. The methods of the invention are exemplified by using a transposition complex formed by a hyperactive (superactive) Tn5 transposase and Tn5 type transposon ends (Goryshin, I. and Reznikoff, W.S., J.biol.chem.,273:7367,1998) or a transposition complex formed by a MuA transposase and a Mu transposon end comprising an R1 end sequence and an R2 end sequence (Mizuuchi, K., Cell,35:785,1983; Savilahti, H, et al, EMBO J.,14:4893,1995). However, any transposition system capable of inserting transposon ends in a random or nearly random manner and with sufficient efficiency to tag and fragment the target DNA 5' for its intended purpose may be used in the present invention. Examples of transposition systems known in the art that may be used include, but are not limited to, Staphylococcus aureus (Staphylococcus aureus) Tn552 (Colego O R et al, J Bacteriol, 183: 2384-Across 8, 2001; Kirby C et al, Mol Microbiol, 43:173-86,2002), Ty1(Devine S E and Boeke J D., Nucleic Acids Res.,22:3765-72,1994 and International patent application No. WO 95/23875), transposon 7(Craig, N L, Science,271:1512,1996; Craig, N L, Review: Curr TopMicrobiol Immunol,204: 27-48,1996), 5636 and IS10(Kleckner N, et al, Curr TopMobiol, 204: 82,1996), Marbil J49, Escherichia coli J., 1996, Escherichia coli J.11, Escherichia coli J., Metr J. 1996, Escherichia coli J.11, Escherichia coli J., 1996, Escherichia coli J., 260:97-114,2004), Tn3(Ichikawa H, and Ohtsubo E., JBiol chem.265:18829-32,1990), bacterial inserts (Ohtsubo, F and Sekine, Y, Curr. Top. Microbiol. Immunol.204:1-26,1996), retroviruses (Brown P O, et al, Proc Natl Acad Sci USA,86:2525-9,1989), and retrotransposons of yeast (Boeke J D and Corces V G, Annulrev Microbiol.43:403-34, 1989).
Methods for inserting transposon ends into target sequences can be performed in vitro using any suitable transposon system for which suitable in vitro transposition systems are available or can be developed based on the knowledge in the art. In general, suitable in vitro transposition systems for use in the methods of the invention require: a transposase enzyme of sufficient purity, sufficient concentration, and sufficient in vitro transposition activity; and transposon ends with which the transposases form functional complexes with the respective transposases capable of catalyzing the transposition reaction. Suitable transposon end sequences that can be used in the present invention include, but are not limited to, wild type transposon end sequences, derived transposon end sequences or mutated transposon end sequences that form a complex with a transposase selected from the group consisting of a wild type transposase, a derived form of a transposase or a mutated form of a transposase. Exemplary transposases include the wild-type or mutant forms of Tn5 transposase and MuA transposase (although EZ-Tn5 transposase is significantly more effective in generating 5' -tagged DNA fragments in the methods of the invention than equivalent protein amounts of MuA transposase), any other transposase for which a defined transposon end is known or later developed for use in the methods of the invention may be usedCompositions and conditions effective for in vitro transposition of (a). Transposon end sequences recognized by either the wild-type or mutant forms of Tn5 transposase or MuA transposase are suitable in some embodiments, and those transposon end sequences that when complexed with a transposase result in the highest transposition efficiency, along with the corresponding optimally active transposase complexed therewith, are advantageous for some embodiments. In some embodiments, transposons are selected in which the transposon end sequences required for transposition by the transposase are not very large and the transposon end sequences are of the smallest size possible, which works well for the intended purpose, and are of sufficient size that the same sequences are only rarely or not present at all in the target DNA or sample DNA. For example, Tn 5-derived EZ-Tn5TMThe transposon end sequence of the transposon end sequence contains only 19 nucleotides, while some other transposases require a much larger end sequence for transposition (e.g., MuA transposase requires a transposon end sequence of about 51 nucleotides).
Suitable in vitro transposition systems that can be used to insert transposon ends into target nucleic acids include, but are not limited to, the use of EZ-Tn5 available from EPICENTRE Technologies, Madison, WisTMSuperactive Tn5 transposase, or HyperMu from EPICENTRETMA hyperactive MuA transposase, or another in vitro transposition system such as those available from Finnzymes Oy, Espoo, Finland.
In some embodiments, the insertion of transposon ends into target DNA according to the present invention can also be performed in vivo. If transposition is to be carried out in vivo, transposition into the target DNA is preferably achieved by electroporation into the host cell of a joint complex (synthetic complex) of transposase and a suitable transposon end composition, as described in U.S. Pat. No. 6,159,736 (incorporated herein by reference). The transposition method is exemplified by using the following transposition complexes: transposition complexes formed by a superactive Tn5 transposase and a suitable Tn5 type transposon end composition, or by HyperMu, using a method similar to that described by (Goryshin, i., and Reznikoff, w.s., j.biol.chem.,273:7367,1998)TMA hyperactive MuA transposase (EPICENTRE, Madison, Wis.) and a suitable MuA transposon end composition exhibiting a R1 end sequence and a R2 end sequence recognized by the transposase. Suitable association complexes or "transposomes" between transposon end compositions and transposasesTMComplexes (EPICENTRE) "may be prepared as described in U.S. patent No. 6,159,736 and related patents to Goryshin and Reznikoff, or as directed to the Tn5 type EZ-Tn5 from EPICENTRE Technologies, Madison, wisTMTransposomeTMComplex or HypermuTMMuA TransposomeTMPreparation of the composites is described in the product literature.
The term "transposon end" means a double-stranded DNA that exhibits only nucleotide sequences ("transposon end sequences") that are necessary for forming a complex with a transposase or integrase that is functional in an in vitro transposition reaction. The transposon ends form a "complex" or "association complex" or "transposome composition" with a transposase or integrase that recognizes and binds to the transposon ends, and the complex is capable of inserting or transposing the transposon ends into the target DNA with which the complex is incubated in an in vitro transposition reaction. The transposon ends exhibit two complementary sequences consisting of a "transferred transposon end sequence" or "transferred strand" and a "non-transferred transposon end sequence" or "non-transferred strand". For example, a superactive Tn5 transposase active in an in vitro transposition reaction (e.g., EZ-Tn 5)TMTransposase, epicentre biotechnology, Madison, wis., USA) includes a transferred strand exhibiting a "transferred transposon end sequence" as follows:
and non-transferred strands exhibiting "non-transferred transposon end sequences" as follows:
the designation "pMETS" refers to a 19 base, 5' -phosphate-containing, single-stranded transposon end oligonucleotide exhibiting EZ-Tn5TMTransposon end sequences:
the designation "METS" refers to a 19 base single stranded transposon end oligonucleotide exhibiting EZ-Tn5TMTransposon end sequences:
the designation "pMENTS" refers to a 19 base, 5' -phosphate-containing, single-stranded transposon end oligonucleotide exhibiting EZ-Tn5TMTransposon end sequences:
the designation "pMEDS" refers to a 19 base pair double-stranded EZ-Tn5TMTransposon ends, wherein both 5' ends comprise a phosphate:
pMEDS EZ-Tn5TMtransposon ends were prepared by annealing pMETS transposon end oligonucleotides to pMENTS transposon end oligonucleotides.
The designation "MEDS" refers to a 19 base pair double stranded EZ-Tn5TMTransposon ends, where only the non-transferred strand (pMENTS) comprises 5' -phosphate:
MEDS EZ-Tn5TMtransposon ends were prepared by annealing METS transposon end oligonucleotides to pMENTS transposon end oligonucleotides.
The 3' end of the transferred strand is ligated or transferred to the target DNA in an in vitro transposition reaction. Non-transferred strands exhibiting transposon end sequences complementary to the transferred transposon end sequences are not ligated or transferred to the target DNA in an in vitro transposition reaction.
In some embodiments, the transitional and non-transitional strands are covalently linked. For example, in some embodiments, the transferred strand sequence and the non-transferred strand sequence are provided on a single oligonucleotide, e.g., in the form of a hairpin configuration. Thus, although the free end of the non-transferred strand is not directly linked to the target DNA by transposition reaction, the non-transferred strand becomes indirectly attached to the DNA fragment because the non-transferred strand is linked to the transferred strand through the loop of the hairpin structure.
By "transposon end composition" is meant a composition comprising transposon ends (i.e., the smallest double stranded DNA segment capable of interacting with a transposase to undergo a transposition reaction), optionally plus one or more additional sequences 5 'to the transferred transposon end sequence and/or 3' to the non-transferred transposon end sequence. For example, transposon ends attached to a tag are "transposon end compositions". In some embodiments, the transposon end compositions comprise or consist of two transposon end oligonucleotides consisting of a "transferred transposon end oligonucleotide" or "transferred strand" and a "non-transferred strand end oligonucleotide" or "non-transferred strand" that in combination exhibit a sequence of transposon ends, and wherein one or both strands comprise additional sequences.
The terms "transferred transposon end oligonucleotide" and "transferred strand" are used interchangeably and refer to the transferred portion of both "transposon end" and "transposon end composition", i.e., regardless of whether the transposon end is attached to a tag or other portion. Similarly, the terms "non-transferred transposon end oligonucleotide" and "non-transferred strand" are used interchangeably and refer to the non-transferred portions of both "transposon end" and "transposon end composition". In some embodiments, the transposon end composition is a "hairpin transposon end composition".
As used herein, a "hairpin transposon end composition" means a transposon end composition consisting of a single oligodeoxyribonucleotide exhibiting a non-transferred transposon end sequence at its 5 'end, a transferred transposon end sequence at its 3' end, and an intervening arbitrary sequence between the non-transferred transposon end sequence and the transferred transposon end sequence, the intervening arbitrary sequence being sufficiently long to allow intramolecular stem loop formation such that the transposon end portion can function in a transposition reaction. In some embodiments, the 5' end of the hairpin transposon end composition has a phosphate group in the 5' position of the 5' nucleotide. In some embodiments, any sequence intervening between the non-transferred transposon end sequences and the transferred transposon end sequences of the hairpin transposon end composition provides a tag (e.g., comprising one or more tag domains) for a particular use or application.
In some embodiments, the methods of the present disclosure produce tagged circular ssDNA fragments. In some embodiments, the tagged circular ssDNA fragments exhibit only the sequences of the transferred strands of the transposon end composition, while the tagged circular ssDNA fragments do not exhibit the sequences of the non-transferred strands of the transposon end composition.
In some embodiments, the transposon end oligonucleotides used in the methods of the invention exhibit only transposon end sequences required in the transposition reaction. However, in some embodiments, at least one of the transposon end oligonucleotides additionally exhibits one or more other nucleotide sequences 5' to the transposon end sequence. Thus, in some embodiments, the methods use a transferred strand having a3 'portion and a 5' portion, wherein the 3 'portion exhibits a transferred transposon end sequence and the 5' portion exhibits one or more additional sequences that do not participate in forming a functional complex with a transposase. There is no limitation on which additional sequences can be used to transfer one or more additional sequences in the 5' portion of the strand, which can be used to achieve any desired purpose. For example, in some embodiments, the 5' portion of the transferred strand exhibits one or more additional tag sequences. In some embodiments, the tag sequence can be an index sequence associated with a particular sample. In some embodiments, the tag sequence allows capture by annealing to a specific sequence on the surface. In some embodiments, the tag sequence allows 5' tagged target fragments to be captured on a flow cell substrate for next generation sequencing; such as a P5 tag or a P7' tag for being captured on the flow cell of an Illumina sequencing platform, or a 454A tag or 454B tag sequence for being captured on beads for sequencing using a Roche 454 next generation sequencer.
In some embodiments, the tag sequence may be one or more sequences used for identification, detection (e.g., fluorescence detection), or sorting of the products of the methods. In some other embodiments, the 5' portion of the transfer strand exhibits one or more additional nucleotides or sequences or chemical groups or moieties comprising or consisting of affinity binding molecules, e.g., tag sequences that allow capture by annealing to specific sequences on a surface such as a bead or probes on a microchip or array. In some preferred embodiments, the size of one or more additional sequences in the 5' portion of the transfer strand is minimized in order to minimize the probability or frequency of transfer strand insertion into itself during the in vitro transposase reaction. For example, in some embodiments, the 5' portion of the transferred strand is less than about 150 nucleotides in size, less than about 100 nucleotides in size, less than about 75 nucleotides in size, less than about 50 nucleotides in size, less than about 25 nucleotides in size, or less than about 15 nucleotides in size.
In some embodiments, the 5 'terminus of the transfer strand has a 5' monophosphate group. In some embodiments, both the transferred and non-transferred strands have a 5' monophosphate group. In some preferred embodiments, only the 5 'end of the non-transferred strand has a 5' monophosphate group. In some other embodiments, no 5 'monophosphate group is present on the 5' end of the transfer strand.
In some embodiments, the transposon end compositions used in the methods of the present disclosure comprise a transposon end oligonucleotide that exhibits only transposon end sequences that form a complex with a transposase or integrase and are required for a transposition reaction; in these embodiments, the tags in the tagged circular ssDNA fragments generated using the methods exhibit only transferred transposon end sequences. However, in some embodiments, the transposon end composition comprises or consists of at least one transposon end oligonucleotide that exhibits one or more other nucleotide sequences in addition to the transposon end sequence. Thus, in some embodiments, the transposon end composition comprises a transferred strand that exhibits one or more other nucleotide sequences 5' of the transferred transposon end sequence, which are also exhibited by the tag. Thus, the tag may have one or more other tag portions or tag domains in addition to the transferred transposon end sequences.
As used herein, a "tag" is a nucleic acid sequence that is associated with or can be associated with one or more nucleic acid molecules.
As used herein, "tag portion" or "tag domain" means a portion or domain of a tag that exhibits a sequence for a desired intended purpose or application. One tag portion or tag domain is a "transposon end domain", which exhibits a transferred transposon end sequence. In some embodiments, wherein the transferred strand further exhibits one or more other nucleotide sequences 5 'to the transferred transposon end sequences, the tag further has one or more other "tag domains" in the 5' portion, each of which is provided for any desired purpose. For example, some embodiments of the present disclosure comprise or consist of a transposon end composition comprising or consisting of: (i) a transferred strand exhibiting one or more sequences 5' to the transferred transposon terminal sequence, the one or more sequences comprising or consisting of a tag domain selected from one or more of a sample-specific index sequence, a primer binding sequence, a restriction site tag domain, a capture tag domain, a sequencing tag domain, an amplification tag domain, a detection tag domain, and a transcription promoter domain; and (ii) non-transferred strands exhibiting non-transferred transposon end sequences. The present disclosure includes embodiments of methods of using any one or more of the transposon end compositions.
In some embodiments, the transposon end composition comprises a transferred strand comprising a primer binding sequence that is reverse complementary to a sequence in the PCR primer. In some embodiments, the PCR primer is an index primer that comprises a sample-specific index sequence. In some embodiments, after transposing and attaching the transfer strand to the target polynucleotide, the sample-specific index primer hybridizes to the primer binding sequence in the transfer strand attached to the target polynucleotide.
As used herein, "restriction site tag domain" or "restriction site domain" means a tag domain exhibiting a sequence for the purpose of facilitating cleavage using a restriction endonuclease. For example, in some embodiments, the restriction site domain is used to generate a di-tagged (di-tagged) linear ssDNA fragment. In some embodiments, the restriction site domain is used to generate a compatible double stranded 5' end in the tag domain, such that the end can be ligated to another DNA molecule using a template-dependent DNA ligase. In some preferred embodiments, the restriction site domain in the tag exhibits a sequence of restriction sites (e.g., restriction sites for rare-cutting restriction endonucleases such as NotI or AscI) that are only rarely, if at all, present in the target DNA. In some preferred embodiments, the restriction site in the restriction site domain is for a type II restriction endonuclease, such as a fokl restriction endonuclease.
In some embodiments, wherein the transferred strands of the transposon end composition comprise one or more restriction site domains 5' of the transferred transposon end sequence, the method further comprises: the oligodeoxyribonucleotides complementary to the single-stranded restriction sites of the tagged circular ssDNA fragments are annealed and the tagged circular ssDNA fragments are then cleaved at the restriction sites using a restriction endonuclease that recognizes the restriction sites. Thus, in some embodiments, the method comprises linearizing the tagged circular ssDNA fragments to generate di-tagged linear ssDNA fragments.
In some other embodiments, wherein the transferred strand of the transposon end composition comprises one or more restriction site domains 5' to the transferred transposon end sequence, the transferred strand of the transposon end composition comprises a double-stranded hairpin comprising a restriction site, and the method further comprises the step of cleaving the tagged linear ssDNA fragments at the restriction site using a restriction endonuclease that recognizes the restriction site; however, in some embodiments, this approach is not preferred because the double-stranded hairpin provides a site for dsDNA into which the transposon end composition can be transposed by the transposase or integrase.
In some preferred embodiments, comprising (i) generating a double-stranded restriction site by annealing oligodeoxyribonucleotides complementary to single-stranded restriction sites or by using a transfer strand comprising a double-stranded hairpin, and (ii) then cleaving the restriction site using a restriction endonuclease that recognizes the double-stranded restriction site, the method further comprises the step of ligating the restriction endonuclease cleaved tagged linear ssDNA fragments to another DNA molecule having a compatible 3' end.
As used herein, "capture tag domain" or "capture tag" means a tag domain exhibiting a sequence for the purpose of facilitating capture of ssDNA fragments to which the tag domain is attached (e.g., providing an annealing site or affinity tag for capturing tagged circular ssDNA fragments or di-tagged linear ssDNA fragments on a bead or other surface, e.g., where the annealing site of the tag domain sequence allows capture by annealing to a specific sequence on the surface, such as a probe on a bead, or on a microchip or microarray, or on a sequencing bead). In some embodiments, a "capture tag" comprises a flow cell amplification primer binding sequence. In some embodiments, the flow cell amplification primer binding sequence comprises a P5 sequence or a P7' sequence. In some embodiments of the methods, after the tagged circular ssDNA fragments or di-tagged linear ssDNA fragments are captured by the complementary probes annealed onto the surface, the capture tag domain provides a site for priming DNA synthesis using the tagged circular ssDNA fragments or the di-tagged linear ssDNA fragments (or the complement of the tagged circular ssDNA fragments or di-tagged linear ssDNA fragments) as a template. In some other embodiments, the capture tag domain comprises a 5 'portion of a transfer chain that is linked to a chemical group or moiety that comprises or consists of an affinity binding molecule (e.g., where the 5' portion of the transfer chain is linked to a first affinity binding molecule, such as biotin, streptavidin, an antigen, or an antibody that binds the antigen, which allows capture of a cyclic tagged ssDNA fragment or a di-tagged linear ssDNA fragment on a surface to which a second affinity binding molecule is attached that forms a specific binding pair with the first affinity binding molecule).
As used herein, "sequencing tag domain", "sequencing tag" or "sequencing primer binding sequence" means a sequence for facilitating sequencing of the ssDNA fragment to which the tag is attached (e.g., providing a priming site for sequencing by synthesis, or providing an annealing site for sequencing by ligation, or providing an annealing site for sequencing by hybridization). For example, in some embodiments, a sequencing tag domain or sequencing primer binding sequence provides a site for priming DNA synthesis of the ssDNA fragment or the complement of the ssDNA fragment. In some embodiments, the sequencing tag domain or sequencing primer binding sequence comprises an SBS3 sequence, SBS8 ' sequence, SBS12 ' sequence, or SBS491 ' sequence.
As used herein, "amplification tag domain" means a tag domain exhibiting a sequence for the purpose of facilitating amplification of a nucleic acid to which the tag is attached. For example, in some embodiments, the amplification tag domain provides a priming site for a nucleic acid amplification reaction using a DNA polymerase (e.g., a PCR amplification reaction or a strand displacement amplification reaction or a rolling circle amplification reaction), or a ligation template for ligating probes in a nucleic acid amplification reaction (e.g., a ligation chain reaction) using a template-dependent ligase.
As used herein, a "detection tag domain" or "detection tag" means a tag that exhibits a sequence or detectable chemical or biochemical moiety (e.g., where the sequence or chemical moiety comprises or is linked to a detectable molecule; a detectable molecule such as one selected from a visible dye, a fluorescent dye, a chemiluminescent dye or other detectable dye; an enzyme detectable in the presence of a substrate, such as alkaline phosphatase with NBT plus BCIP, or peroxidase with a suitable substrate; a detectable protein, such as a green fluorescent protein; and an affinity binding molecule that binds to or can form an affinity or specific binding pair with another detectable affinity binding molecule; or any of a number of other detectable molecules or systems known in the art) for the purpose of facilitating detection of tagged circular ssDNA fragments or di-tagged linear ssDNA fragments A tag domain.
As used herein, "transcriptional promoter domain" or "promoter domain" means a tag domain exhibiting the sequence of a sense promoter sequence or an antisense promoter sequence of an RNA polymerase promoter.
As used herein, "DNA fragment" means a portion, fragment (piece), or segment (segment) of a target DNA that is cleaved from, or released or fragmented from, a longer DNA molecule such that it is no longer attached to a parent molecule. The DNA fragments may be double stranded ("dsDNA fragments") or single stranded ("ssDNA fragments"), and the process of generating DNA fragments from target DNA is referred to as "fragmenting" the target DNA. In some preferred embodiments, the method is used to generate a "DNA fragment library" comprising a collection or population of tagged DNA fragments.
As used herein, "target DNA" refers to any DNA of interest that is subjected to processing, e.g., for generating a library of tagged DNA fragments (e.g., 5 '-and 3' -tagged or ditag linear ssDNA or dsDNA fragments or tagged circular ssDNA fragments).
"target DNA" may be derived from any in vivo or in vitro source (including from one or more cells, tissues, organs or organisms, whether living or dead), or from any biological or environmental source (e.g., water, air, soil). For example, in some embodiments, the target DNA comprises or consists of eukaryotic and/or prokaryotic dsDNA derived or derived from a human, animal, plant, fungus (e.g., mold or yeast), bacterium, virus, viroid, mycoplasma, or other microorganism. In some embodiments, the target DNA comprises or consists of: genomic DNA, subgenomic DNA, chromosomal DNA (e.g., from an isolated chromosome or portion of a chromosome, such as from one or more genes or loci of a chromosome), mitochondrial DNA, chloroplast DNA, plasmid or other episomal (episomal) derived DNA (or recombinant DNA contained therein), or double-stranded cDNA prepared by reverse transcribing RNA using an RNA-dependent DNA polymerase or reverse transcriptase to generate a first-strand cDNA, and then extending a primer that anneals to the first-strand cDNA to generate a dsDNA. In some embodiments, the target DNA comprises a plurality of dsDNA molecules in or prepared from nucleic acid molecules (e.g., a plurality of dsDNA molecules in or prepared from genomic DNA or cDNA prepared from RNA in or from biological (e.g., cells, tissues, organs, organisms) or environmental (e.g., water, air, soil, saliva, sputum, urine, stool) sources). In some embodiments, the target DNA is from an in vitro source. For example, in some embodiments, the target DNA comprises or consists of dsDNA prepared in vitro from single-stranded DNA (ssdna) or from single-stranded or double-stranded RNA (e.g., using methods well known in the art, such as primer extension using a suitable DNA-dependent and/or RNA-dependent DNA polymerase (reverse transcriptase)). In some embodiments, the target DNA comprises or consists of dsDNA prepared from all or part of one or more double-stranded or single-stranded DNA or RNA molecules using any method known in the art, including methods for: DNA or RNA amplification (e.g., PCR or reverse transcriptase-PCR (RT-PCR), transcription-mediated amplification methods, and amplification of all or part of one or more nucleic acid molecules); molecular cloning of all or part of one or more nucleic acid molecules in a plasmid, a fuss plasmid (fosmid), a BAC or other vector, followed by replication in a suitable host cell; or capture one or more nucleic acid molecules by hybridization, such as by hybridization to a DNA probe on an array or microarray (e.g., by "sequence capture"; e.g., using a kit and/or array from ROCHE NIMBLEGEN, AGILENT, or FEBIT).
In some embodiments, "target DNA" means dsDNA or ssDNA that is prepared or modified (e.g., prepared or modified using various biochemical or molecular biology techniques) prior to being used to generate a library of tagged DNA fragments (e.g., 5 '-and 3' -tagged or ditag linear ssDNA or dsDNA fragments or tagged circular ssDNA fragments).
As used herein, "amplification", "amplifying" or "amplification reaction" and derivatives thereof generally refer to any action or process by which at least a portion of a nucleic acid molecule is replicated or copied to at least one other nucleic acid molecule. The additional nucleic acid molecule optionally comprises a sequence that is substantially identical or substantially complementary to at least some portion of the template nucleic acid molecule. The template nucleic acid molecule may be single-stranded or double-stranded, and the further nucleic acid molecules may independently be single-stranded or double-stranded. Amplification optionally includes linear or exponential replication of the nucleic acid molecule. In some embodiments, such amplification may be performed using isothermal conditions; in other embodiments, such amplification may comprise thermal cycling. In some embodiments, the amplification is a multiplex amplification comprising simultaneously amplifying multiple target sequences in a single amplification reaction. In some embodiments, "amplifying" includes amplifying at least some portions of DNA and RNA based nucleic acids, either individually or in combination. The amplification reaction may include any amplification process known to one of ordinary skill in the art. In some embodiments, the amplification reaction comprises a Polymerase Chain Reaction (PCR).
As used herein, the term "polymerase chain reaction" ("PCR") refers to the method of Mullis U.S. patent nos. 4,683,195 and 4,683,202, which describe methods for increasing the concentration of a segment of a polynucleotide of interest in a mixture of genomic DNA without cloning or purification. This process for amplifying a polynucleotide of interest consists of the following steps: a large excess of two oligonucleotide primers is introduced into a DNA mixture containing the desired polynucleotide of interest, followed by a series of thermal cycles in the presence of a DNA polymerase. Both primers are complementary to their respective strands of the double-stranded polynucleotide of interest. The mixture is first denatured at higher temperatures and the primers are then annealed to complementary sequences within the polynucleotide molecule of interest. After annealing, the primers are extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (known as thermal cycling) to obtain a high concentration of the desired amplified segment of the polynucleotide of interest. The length of the desired amplified segment (amplicon) of the polynucleotide of interest is determined by the relative positions of the primers with respect to each other and, therefore, is a controllable parameter. By repeating this process, the method is called "polymerase chain reaction" (hereinafter referred to as "PCR"). Since the amplified segments of the desired polynucleotides of interest become the predominant nucleic acid sequence (in terms of concentration) in the mixture, they are said to be "PCR amplified". In a modification of the methods discussed above, the target nucleic acid molecules can be PCR amplified using a plurality of different primer pairs (in some cases, one or more primer pairs for each target nucleic acid molecule of interest) to form a multiplex PCR reaction.
As defined herein, "multiplex amplification" refers to the selective and non-random amplification of two or more target sequences in a sample using at least one target-specific primer. In some embodiments, multiplex amplification is performed such that some or all of the target sequences are amplified in a single reaction vessel. A given multiplex "repeat" or "repeat" refers generally to the number of different target-specific sequences that are amplified during this single multiplex amplification. In some embodiments, the weight may be about 12, 24, 48, 96, 192, 384, 768, 1536, 3072, 6144, or more. It is also possible to detect the amplified target sequence by several different methodologies (e.g., gel electrophoresis followed by densitometry, quantification with a bioanalyzer or quantitative PCR, hybridization with a labeled probe; incorporation of a biotinylated primer followed by detection of an avidin-enzyme conjugate; incorporation of 32P-labeled deoxynucleotide triphosphate (deoxynuleotide triphosphate) into the amplified target sequence).
As used herein, the term "primer" and derivatives thereof generally refers to any polynucleotide that can hybridize to a target sequence of interest. Typically, the primer functions as a substrate on which nucleotides can be polymerized by a polymerase; however, in some embodiments, a primer may become incorporated into a synthetic nucleic acid strand and provide a site to which another primer can hybridize to prime synthesis of a new strand complementary to the synthetic nucleic acid molecule. The primer may include any combination of nucleotides or analogs thereof. In some embodiments, the primer is a single stranded oligonucleotide or polynucleotide.
In various embodiments, the primer has a free 3' -OH group that can be extended by a nucleic acid polymerase. For a template-dependent polymerase, typically at least the 3 'portion of the primer oligonucleotide is complementary to a portion of the template nucleic acid to which it "binds" (or "complexes", "anneals", or "hybridizes") by hydrogen bonding and other molecular forces to the template to give a primer/template complex for initiating synthesis by the DNA polymerase, and is extended (i.e., "primer extension") during DNA synthesis by the addition of covalently bound bases complementary to the template that are attached at their 3' ends. As a result, a primer extension product was obtained. Template-dependent DNA polymerases, including reverse transcriptases, typically require complexation of oligonucleotide primers to single-stranded templates to initiate DNA synthesis ("priming"), but RNA polymerases typically do not require primers complementary to DNA templates for RNA synthesis (transcription).
A "template" is a nucleic acid molecule that is copied by a nucleic acid polymerase, such as a DNA polymerase. Whether a nucleic acid molecule comprises two strands (i.e., "double-stranded") or only one strand (i.e., "single-stranded"), the strand of the nucleic acid molecule used to specify the sequence of nucleotides exhibited by the synthesized nucleic acid is a "template" or "template strand". The nucleic acid synthesized by the nucleic acid polymerase is complementary to the template. Both RNA and DNA are always synthesized in the 5' -to-3 ' direction starting from the 3' end of the template strand, and the two strands of the nucleic acid duplex are always matched such that the 5' ends of the two strands are at opposite ends of the duplex (and necessarily, so is the 3' end). For both RNA and DNA templates, a primer is required to initiate synthesis by a DNA polymerase, but a primer is not required to initiate synthesis by a DNA-dependent RNA polymerase, which is often referred to simply as "RNA polymerase".
The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. In some cases, the term "polynucleotide" may refer to a nucleotide polymer having a relatively large number of nucleotide monomers, while the term "oligonucleotide" may refer to a nucleotide polymer having a relatively small number of nucleotide monomers. However, unless indicated, this distinction is not applicable herein. Rather, the terms "polynucleotide" and "oligonucleotide" should be understood to include analogs of DNA or RNA made from nucleotide analogs as equivalents, and apply to single-stranded (such as sense or antisense) polynucleotides and double-stranded polynucleotides. The term as used herein also encompasses cDNA, i.e., complementary or copy DNA produced from an RNA template, e.g., by the action of a reverse transcriptase. The term refers only to the primary structure of the molecule. Thus, the term includes triple-, double-and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double-and single-stranded ribonucleic acid ("RNA").
Furthermore, the terms "polynucleotide", "nucleic acid" and "nucleic acid molecule" are used interchangeably and refer to a covalently linked sequence of nucleotides (i.e., ribonucleotides for RNA and deoxyribonucleotides for DNA) in which the 3 'position of the pentose of one nucleotide is linked to the 5' position of the pentose of the next nucleotide by a phosphodiester group. Nucleotides include sequences of any form of nucleic acid, including but not limited to RNA molecules and DNA molecules, such as cell-free DNA (cfdna) molecules. The term "polynucleotide" includes, but is not limited to, single-stranded polynucleotides and double-stranded polynucleotides.
As used herein, the terms "linking", and derivatives thereof generally refer to a process for covalently linking two or more molecules together, e.g., two or more nucleic acid molecules to each other. In some embodiments, ligating comprises ligating the gaps between adjacent nucleotides of the nucleic acid. In some embodiments, linking comprises forming a covalent bond between an end of the first nucleic acid molecule and an end of the second nucleic acid molecule. In some embodiments, ligation may comprise forming a covalent bond between a 5 'phosphate group of one nucleic acid and a 3' hydroxyl group of a second nucleic acid, thereby forming a ligated nucleic acid molecule. Generally for the purposes of the present disclosure, amplified target sequences can be ligated to adaptors to generate adaptor-ligated amplified target sequences.
As used herein, "ligase" and derivatives thereof generally refer to any agent capable of catalyzing the attachment of two substrate molecules. In some embodiments, the ligase comprises an enzyme capable of catalyzing the ligation of a gap between adjacent nucleotides of the nucleic acid. In some embodiments, a ligase comprises an enzyme capable of catalyzing the formation of a covalent bond between a 5 'phosphate of one nucleic acid molecule and a 3' hydroxyl of another nucleic acid molecule, thereby forming a ligated nucleic acid molecule. Suitable ligases may include, but are not limited to, T4 DNA ligase, T4 RNA ligase, and escherichia coli (e.
As used herein, the term "adaptor" generally refers to any linear oligonucleotide that can be ligated to a nucleic acid molecule, thereby generating a nucleic acid product that can be sequenced on a sequencing platform, such as various Illumina sequencing platforms. In some embodiments, the adaptor includes two reverse complementary oligonucleotides that form a double-stranded structure. In some embodiments, the adaptor comprises two oligonucleotides that are complementary at one portion and mismatched at another portion, forming a Y-shaped adaptor or a forked adaptor that is double stranded at the complementary portion and has two soft overhangs at the mismatched portion. Since the Y-adapters have complementary double stranded regions, they can be considered to be a special form of double stranded adapter. When the present disclosure compares a Y-shaped adaptor to a double stranded adaptor, the term "double stranded adaptor" is used to refer to an adaptor having two strands that are fully complementary, substantially (e.g., greater than 90% or 95%) complementary, or partially complementary.
In some embodiments, the adapters comprise sequences that bind to sequencing primers (e.g., SEQ ID NO:3 and SEQ ID NO: 5). In some embodiments, the adaptor comprises a sequence that binds to a flow cell oligonucleotide (e.g., SEQ ID NO:7 and SEQ ID NO:8 or P7 sequence and P5 sequence).
In some embodiments, the adapter is not substantially complementary to the 3 'end or the 5' end of any target sequence present in the sample. In general, the adapter may comprise any combination of nucleotides and/or nucleic acids. In some aspects, the adaptor may comprise one or more cleavable groups at one or more positions. In another aspect, the adapter can comprise a sequence that is substantially identical or substantially complementary to at least a portion of a primer (e.g., a universal primer). In some embodiments, the adapters may comprise an indexing sequence (also referred to as a barcode or tag) to aid in downstream error correction, identification, or sequencing.
The terms "adaptor" and "linker" are used interchangeably herein.
The term "flow cell" or "flow cell" as used herein refers to a chamber comprising a solid surface through which one or more fluidic reagents may flow. Examples of flow cells and related fluidic systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al, Nature 456:53-59 (2008); WO 04/018497; US 7,057,026; WO 91/06678; WO 07/123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and
As used herein, the term "amplicon" when used in reference to a nucleic acid means the product of copying the nucleic acid, wherein the product has a nucleotide sequence that is identical or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicons may be generated by any of a variety of amplification methods using nucleic acids or amplicons thereof as templates, including, for example, polymerase extension, Polymerase Chain Reaction (PCR), Rolling Circle Amplification (RCA), ligation extension, or ligation chain reaction. An amplicon may be a nucleic acid molecule having a single copy of a particular nucleotide sequence (e.g., a PCR product) or multiple copies of a nucleotide sequence (e.g., concatamer (concatamer) product of RCA). The first amplicon of the target nucleic acid is typically a complementary copy. The subsequent amplicons are copies produced from the target nucleic acid or from the first amplicon after the first amplicon is generated. The subsequent amplicons can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.
The term "paired-end reads" refers to reads obtained from paired-end sequencing, one read from each end of a nucleic acid fragment. Paired-end sequencing involves fragmenting DNA into sequences called inserts (insets). In some protocols, such as those used by Illumina, reads from shorter inserts (e.g., about tens to hundreds of bp) are referred to as short insert paired-end reads or simply paired-end reads. In contrast, reads from longer inserts (e.g., on the order of several kilobases) are referred to as matched pair (matepair) reads. In the present disclosure, both short insert paired-end reads and long insert matching pair reads can be used, and there is no difference with respect to the process for determining the sequence of the DNA fragments. Thus, the term "paired-end reads" may refer to both short insert paired-end reads and long insert matching pair reads, as will be described further below. In some embodiments, the paired-end reads comprise reads from about 20bp to 1000 bp. In some embodiments, paired-end reads comprise reads of about 50bp to 500bp, about 80bp to 150bp, or about 100 bp.
As used herein, the terms "alignment" and "aligning" refer to the process of comparing a read to a reference sequence, and thereby determining whether the reference sequence comprises a read sequence. As used herein, the alignment process attempts to determine whether a read can be mapped to a reference sequence, but does not always result in a read that matches the reference sequence. If the reference sequence contains a read, the read can be mapped to the reference sequence, or in some embodiments, to a specific location in the reference sequence. In some cases, the alignment simply determines whether the read is a member of a particular reference sequence (i.e., whether the read is present or absent in the reference sequence). For example, alignment of a read with a reference sequence of human chromosome 13 will determine whether the read is present in the reference sequence of chromosome 13.
Of course, the alignment tool has many additional aspects in bioinformatics and many other applications, which are not described in the present application. For example, an alignment can also be used to determine the degree of similarity of two DNA sequences from two different species, thereby providing a measure of how closely they are related on the evolutionary tree.
In some cases, the alignment additionally indicates the position in the reference sequence at which the read maps. For example, if the reference sequence is an entire human genome sequence, the alignment can indicate that the reads are present on chromosome 13, and can also indicate that the reads are on a particular strand and/or site of chromosome 13. In some cases, the alignment tool is imperfect because a) not all valid alignments are found, and b) some of the obtained alignments are invalid. This occurs for various reasons, for example, reads may contain errors, and sequenced reads may differ from the reference genome due to haplotype differences. In some applications, the alignment tools include built-in mismatch tolerance that tolerates some degree of base pair mismatch and still allows alignment of reads to reference sequences. This can help identify valid alignments for reads that would otherwise be missed.
The term "mapping" as used herein refers to the assignment of read sequences to larger sequences, such as reference genomes, by alignment.
The term "test sample" refers herein to a sample, typically derived from a biological fluid, cell, tissue, organ or organism, which sample comprises a nucleic acid or mixture of nucleic acids having at least one nucleic acid sequence to be analyzed. Such samples include, but are not limited to, sputum/oral fluid, amniotic fluid, blood fractions or fine needle biopsy samples, urine, peritoneal fluid, pleural fluid, and the like. Although the sample is typically obtained from a human subject (e.g., a patient), the assay can be used for samples from any mammal (including but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc.) as well as mixed populations (such as populations of microorganisms from the wild or viral populations from patients). The sample may be used directly as obtained from a biological source or after a pre-treatment to modify the characteristics of the sample. For example, such pre-processing may include preparing plasma from blood, diluting viscous fluids, and the like. Methods of pretreatment may also include, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, addition of reagents, lysis, and the like. If such a method of pretreatment is employed with respect to a sample, such a pretreatment method typically results in the retention of the nucleic acid of interest in the test sample, sometimes at a concentration proportional to the concentration in an untreated test sample (that is, a sample that has not been subjected to any such pretreatment method). With respect to the methods described herein, such "treated" or "processed" samples are still considered biological "test" samples.
The term "Next Generation Sequencing (NGS)" refers herein to a sequencing method that allows massively parallel sequencing of clonally amplified molecules and individual nucleic acid molecules. Non-limiting examples of NGS include sequencing by synthesis and sequencing by ligation using reversible dye terminators.
The term "read" refers to a sequence read from a portion of a nucleic acid sample. Typically, although not necessarily, the reads represent short sequences of contiguous base pairs in the sample. Reads can be represented symbolically by the base pair sequences of A, T, C and G of the sample portion, along with a probabilistic estimate of base correctness (quality score). It may be stored in a memory device and processed as appropriate to determine whether it matches a reference sequence or meets other criteria. The reads may be obtained directly from the sequencing device or indirectly from stored sequence information about the sample. In some cases, a read is a DNA sequence that is sufficiently long (e.g., at least about 20bp) that it can be used to identify a larger sequence or region, e.g., that can be aligned and mapped to a chromosome or genomic region or gene.
The terms "site" and "aligned position" are used interchangeably to refer to a unique location (i.e., chromosome ID, chromosome position, and orientation) on a reference genome. In some embodiments, a site may be the position of a residue on a reference sequence, the position of a sequence tag, or the position of a segment.
As used herein, the term "reference genome" or "reference sequence" refers to any particular known gene sequence (whether partial or complete) of any organism or virus that can be used as a reference for an identified sequence from a subject. For example, reference genomes for human subjects and many other organisms can be found in the National Center for biotechnology Information of ncbi. "genome" refers to the complete genetic information of an organism or virus expressed as a nucleic acid sequence. However, it should be understood that "intact" is a relative concept, as even the gold standard reference genome is expected to contain gaps and errors.
In various embodiments, the reference sequence is significantly larger than the reads to which it is aligned. For example, it may be at least about 100 times greater, or at least about 1000 times greater, or at least about 10,000 times greater, or at least about 10 times greater5Times, or at least about 10 times, larger6Times, or at least about 10 times, larger7And (4) doubling.
In one example, the reference sequence is a sequence of a full-length human genome. Such a sequence may be referred to as a genomic reference sequence. In another example, the reference sequence is limited to a particular human chromosome, such as chromosome 13. In some embodiments, the reference Y chromosome is a Y chromosome sequence from human genome version hg 19. Such sequences may be referred to as chromosomal reference sequences. Other examples of reference sequences include genomes of other species, as well as chromosomes, sub-chromosomal regions (such as strands), etc., of any species.
The term "derived from" when used in the context of a nucleic acid or mixture of nucleic acids herein refers to the means by which the nucleic acid is obtained from the source from which it originates. For example, in one embodiment, a mixture of nucleic acids derived from two different genomes means that the nucleic acids, e.g., cfDNA, are naturally released by the cells via naturally occurring processes such as necrosis or apoptosis. In another embodiment, a mixture of nucleic acids derived from two different genomes means that the nucleic acids are extracted from two different types of cells from a subject.
The term "biological fluid" refers herein to a liquid obtained from a biological source and includes, for example, blood, serum, plasma, sputum, lavage, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like. As used herein, the terms "blood", "plasma" and "serum" expressly encompass fractions or treated portions thereof. Similarly, where a sample is taken from a biopsy, swab, smear, or the like, the "sample" expressly encompasses a processed fraction or portion derived from the biopsy, swab, smear, or the like.
The term "chromosome" as used herein refers to a genetic vector of living cells carrying genetic characteristics, which is derived from chromatin strands comprising DNA and protein components (in particular histones). The conventional internationally recognized individual human genome chromosome numbering system is employed herein.
Introduction and background
Next Generation Sequencing (NGS) technology has rapidly evolved, providing new tools for advancing research and science as well as healthcare and services that rely on genetic and relevant biological information. NGS methods are performed in a massively parallel manner, providing an increasingly high speed for determining sequence information of biomolecules. Index sequences have been used in the art to tag or identify the source of samples for multiplex NGS sequencing. However, many NGS methods and related sample manipulation techniques introduce errors such that the resulting sequences have relatively high error rates, ranging from one error in hundreds of base pairs to one error in thousands of base pairs. When such an error occurs in a read of the sample index sequence, the read cannot be correctly associated with the source of the sample, and can cause an erroneous association between the read and the source of the sample.
One source of sequencing errors is related to index hopping (index hopping). Index hopping or index jump (index jumping) is observed when the sequenced DNA library molecules contain an index sequence that is different from the index sequence present in the library adaptors during library preparation. Index jumping can occur during sample preparation or during cluster amplification of pooled multiplexed libraries. One mechanism that causes index hopping involves the presence of free unligated adaptor molecules present after library preparation.
Without intending to be limited by theory, the problem of index hopping has a variety of patterns, some of which involve the presence of residual unligated adaptor molecules left from library preparation. One type of index hopping can be caused by free unligated adaptor molecules with specific universal primer extension sequences (e.g., P7') present in the pool of libraries, which can facilitate the formation of libraries with exchanged index primers (index). This problem can be prevented by using 5 'exonucleases for degradation that specifically target the P7' adaptor strand. Such measures solve index jumps using biochemical methods. Some embodiments correct for index jumps using bioinformatics methods as described further below.
Some sequencing platforms use one color (e.g., green laser) to sequence two base types (e.g., G/T) and another color (e.g., red laser) to sequence two other base types (e.g., a/C). On some of these platforms, at least 1 of the 2 nucleotides of each color channel needs to be read in each cycle to ensure proper image registration. Importantly, the color balance of each base of the indexed reads being sequenced is maintained; otherwise index read sequencing may fail due to registration failure. This can be particularly a problem during low-re-sequencing, where a relatively small number of index sequences makes all nucleotides in a read cycle more likely to activate one color.
In various applications, it is desirable to layout the index plate so that the user can select 3 groups across rows (i.e., one quarter of a row) or 4 groups down the column (i.e., one half of a column) or other rearrangement such as 6, 8, and 9, without sacrificing color balance of oligonucleotides in the flow cell.
Various embodiments provide at least some of the following advantages.
Some embodiments using short universal adaptors and index primers can be easily scaled up to high sample numbers without the need for new adaptor designs. Only new index primers with new index sequences are needed.
Some embodiments using short universal adaptors and index primers are cost effective, involving 1 complex fraction instead of 40 complex fractions for 384 samples in a 16x24 multiwell plate with combinatorial index pairs.
Because oligonucleotide purification is expensive, the processing of shorter length (e.g., 33bp versus 70bp) adaptors is cheaper and provides higher yields. In addition, High Performance Liquid Chromatography (HPLC) purification columns of different oligonucleotides may be common across projects.
In some embodiments, universal adaptors can be prepared using simpler manufacturing processes. In embodiments involving Y-adapters and blunt-ended adapters, it is desirable to anneal 2 oligonucleotides to prepare one universal adapter. In embodiments involving double-stranded blunt-ended version a & B adaptors, it is necessary to anneal 4 oligonucleotides to prepare two universal adaptors.
Some embodiments provide a simpler Quality Control (QC) process. Various existing processes and tools are fully functional for adapters, including gravimetric (weighing of oligonucleotides), OD, mass spectrometry, and purity determination for index primers.
Assay performance can be improved due to smaller adaptor size, resulting in increased ligation efficiency and more efficient clean up to remove dimers (e.g., using SPRI beads).
Workflow for sequencing nucleic acid fragments using index sequences
FIGS. 1A-1C illustrate
In some embodiments,
In some embodiments, fragmented or damaged DNA may be processed without additional fragmentation. For example, formalin-fixed, paraffin-embedded (FFPE) DNA or certain cfDNA is sometimes fragmented sufficiently that no additional fragmentation step is required.
FIG. 1C shows the DNA fragments/molecules and adapters employed in the initial step of the
After end repair, the
After adenylating the 3' end, the
Returning to fig. 1A,
In some embodiments, the products of the ligation reaction are purified and/or size selected by agarose gel electrophoresis or magnetic beads. The size-selected DNA was then PCR amplified to enrich for fragments with adaptors on both ends. See
The
After cluster amplification, sequencing reads can be obtained by sequencing-by-synthesis on the Illumina platform. See
FIG. 1D illustrates a
In some embodiments, applying the index primers to the target nucleic acids of the plurality of samples can be accomplished by the second half of the
Similarly,
The transposase also transposes the transfer strand of the MEDS duplex to the 5' end of the nucleic acid fragment in the digestion site (167a-167 f). After fragmentation and transposition, the top strand of
FIG. 1F shows an additional downstream process of DNA fragments generated by transposome-mediated fragmentation to obtain target nucleic acid fragments with double-stranded universal adaptors on both ends. The figure also shows the addition of the index sequences (i5 index sequence and i7 index sequence) and the flow cell amplification primer binding sequences (P5 sequence and P7 sequence). After addition of a polymerase having strand displacement or 5 '-to-3' exonuclease activity, the 3 'end of the target nucleic acid is extended and the non-transferred strand of the MEDS duplex is removed (see arrows 173a and 173b, which indicate extension of the 3' end of the target nucleic acid fragment). The extension fills the gap between the 3' end of the target nucleic acid and the non-transferred strand of the MEDS duplex. Extension also generates nucleotides complementary to the 5' tag. As a result, a double stranded target nucleic acid fragment flanked by the MEDS sequence and the sequencing primer binding sequence is formed, having two complementary strands 174 and 175 a. The double-stranded nucleic acid comprises two double-stranded short universal adaptors, each adaptor comprising a sequencing primer sequence and an MEDS sequence. In some embodiments, the double-stranded nucleic acid has the nucleotides set forth in fig. 1G.
FIG. 1G shows the sequence of a target nucleic acid with double-stranded short universal adaptors attached to both ends. The sequencing primer binding sequence SP1 has the sequence TCGTCGGCAGCGTC (SEQ ID NO:3) at the top strand and the reverse complement at the bottom strand (GACGCTGCCGACGA (SEQ ID NO: 4). MEDS duplex has the sequences of SEQ ID NO:1 and SEQ ID NO: 2. the sequencing primer binding sequence (SP2) has the sequence CCGAGCCCACGAGAC (SEQ ID NO:5) at the top strand and the reverse complement GTCTCGTGGGCTCGG (SEQ ID NO:6) at the bottom strand.
FIG. 1I shows the sequence in the I7 index primer. In some embodiments, the i7 index primer (e.g., 178a) has, from 5 'to 3', a P7 flow cell amplification primer binding sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO:7), an i7 index sequence, and a SP2 sequencing primer binding sequence GTCTCGTGGGCTCGG (SEQ ID NO: 6).
Fig. 1J shows the sequence in the i5 index primer. In some embodiments, the i5 index primer (e.g., 176a) has, from 5 'to 3', a P5 flow cell amplification primer binding sequence AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO:8), an i5 index sequence, and a SP1 sequencing primer binding sequence TCGTCGGCAGCGTC (SEQ ID NO: 3).
In other embodiments, target inserts with Y-shaped universal adaptors can be used in a process such as that shown in fig. 1K. Figure 1H shows the sequence of a target nucleic acid with Y-shaped short universal adaptors attached to both ends, according to some embodiments. The Y-shaped universal adaptor has the sequence TCGTCGGCAGCGTC at the 5 'arm (SEQ ID NO:3) and the sequence CCGAGCCCACGAGAC at the 3' arm (SEQ ID NO: 5).
According to
In some embodiments, at least one transposome complex comprises a Tn5 transposase and a Tn5 transposon end composition. In some embodiments, at least one transposome complex comprises a Mu transposase and a Mu transposon end composition. Some embodiments include both Tn5 transposase and Mu transposase as well as transposon end compositions.
FIG. 1K shows a process 199 for adding an index sequence to a target nucleic acid with Y-shaped short universal adaptors at both ends. Process 199 is similar to process 160 of fig. 1E, using target nucleic acid fragments with double-stranded short universal adaptors attached to both ends. In process 199, a target nucleic acid with Y-shaped short adaptors attached to both ends is used. Because both strands of the Y-adapter have two different sequencing primer binding sequences, both strands of the nucleic acid can be used to generate downstream fragments that can be sequenced on the sequencing platform. In contrast, in embodiments using double-stranded adaptors, only one strand of the product of the double-stranded nucleic acid may be used for sequencing.
According to the embodiment illustrated in FIGS. 1H-1J, the nucleic acid sequences of the Y-shaped adaptors and the index primers are shown. Double stranded nucleic acids with two Y-shaped short universal adaptors attached to both ends are shown at the beginning of the process. The double stranded nucleic acid comprises a
Various sealants may be implemented. One possible form of blocking agent includes Phosphorothioate (PS) linkages. Phosphorothioate (PS) linkages replace non-bridging oxygens in the phosphate backbone of oligonucleotides with sulfur atoms. About 50% of the time (due to the 2 resulting stereoisomers that can be formed), PS modifications make the internucleotide linkages more resistant to nuclease degradation. Therefore, it is suggested to include at least 3 PS linkages at the 5 'oligonucleotide end and at the 3' oligonucleotide end to inhibit exonuclease degradation. Including PS linkages throughout the oligonucleotide will also help reduce endonuclease attack, but may also increase toxicity.
Another possible sealant form includes inverted dT and inverted ddT. An inverted dT can be incorporated at the 3 'end of the oligonucleotide, resulting in a 3' -3 'linkage that will inhibit degradation by 3' exonucleases and extension by DNA polymerases. Furthermore, placing an inverted 2 ', 3' dideoxy-dT base (5 'inverted ddT) at the 5' end of the oligonucleotide prevents spurious ligation and may protect against some form of enzymatic degradation.
Another possible form of the blocking agent includes phosphorylation. Phosphorylation of the 3 'end of the oligonucleotide will inhibit degradation by some 3' exonucleases.
Another possible blocker form includes LNA, where xGen-locked nucleic acid modification prevents endonuclease digestion and exonuclease digestion.
Returning to fig. 1D,
In some embodiments, the set of index sequences comprises a plurality of pairs of color balanced index sequences, wherein any two bases at the respective sequence positions of each pair of color balanced index sequences comprises both: (i) an A base or a C base, and (ii) a G base, a T base or a U base. In some embodiments, the set of index sequences comprises at least six different index sequences.
In some embodiments, the plurality of indexing polynucleotides include indexing primers that can hybridize to a universal adaptor. In some embodiments, the plurality of index primers comprise the index sequences of the set of index sequences. In some embodiments, each index primer further comprises a flow cell amplification primer binding sequence. In some embodiments, the flow cell amplification primer binding sequence comprises a P5 sequence or a P7' sequence. See fig. 2C and 2D. In some embodiments, target nucleic acids derived from multiple samples include nucleic acids with universal adaptors covalently attached to one or both ends. See nucleic acid with top strand 174 and bottom strand 175a in FIG. 1F and nucleic acid with
In some embodiments, contacting a plurality of index polynucleotides with a target nucleic acid derived from a plurality of samples comprises: hybridizing a plurality of index primers to universal adaptors covalently attached to one or both ends of the nucleic acids; and extending the plurality of index primers to obtain a plurality of index-adaptor-target polynucleotides. In some embodiments, the universal adaptor and the target nucleic acid are double-stranded, and hybridizing the plurality of index primers to the universal adaptor comprises hybridizing the plurality of index primers to only one strand of the universal adaptor.
In some embodiments, the universal adaptor and the target nucleic acid are double-stranded, and hybridizing the plurality of index primers to the universal adaptor comprises hybridizing the plurality of index primers to both strands of the universal adaptor. See fig. 1F and 1K.
In some embodiments, the index primer that hybridizes to the first strand of the universal adaptor comprises an index sequence selected from a first subset of the set of index sequences and the index primer that hybridizes to the second strand of the universal adaptor comprises a sequence selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset. In some embodiments, the first subset comprises the index sequences listed in table 1 and the second subset comprises the index sequences listed in table 2. In some embodiments, the index primers that hybridize to both strands of the universal adaptor comprise an index sequence selected from the same subset of the set of index sequences. In some embodiments, the subset of index sequences is selected from one of the subsets of index sequences in table 3.
In some embodiments, the universal adaptor comprises a double stranded adaptor. See, for example, fig. 2D. In some embodiments, the universal adaptor comprises a Y-shaped adaptor. See, for example, fig. 2C. In some embodiments, the universal adaptor comprises a single stranded adaptor. In some embodiments, the universal adaptor comprises a hairpin adaptor. In some embodiments, each of the universal adaptors comprises an overhang at one end to be attached to a nucleic acid prior to being attached to the nucleic acid. In some embodiments, the overhang is a T overhang. See fig. 1C and fig. 2A-2C. In some embodiments, each of the universal adaptors comprises a blunt end to be attached to a nucleic acid prior to being attached to the nucleic acid. See fig. 2D.
In some embodiments, the method comprises attaching universal adaptors to one or both ends of the nucleic acid prior to applying the index sequence to the target nucleic acid. In some embodiments, attaching comprises attaching a universal adaptor by transposome-mediated fragmentation.
In some embodiments, attaching comprises ligating a universal adaptor to one or both ends of the nucleic acid. In some embodiments, the linking comprises enzymatic linking or chemical linking.
In some embodiments, attachment is by amplification with target-specific primers comprising terminal universal adaptors.
Some embodiments employ a plurality of indexing polynucleotides comprising sample-specific adaptors. The adaptor includes an index sequence of the set of index sequences. See fig. 1C and fig. 2A-2C. In some embodiments, the sample-specific adaptor comprises two strands. In some embodiments, only one strand comprises an index sequence. In some embodiments, each strand of the sample-specific adaptors comprises an index sequence. In some embodiments, the first strand of sample-specific adaptors comprises an index sequence selected from a first subset of the set of index sequences and the second strand of sample-specific adaptors comprises an index sequence selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset. In some embodiments, the first subset of index sequences comprises the index sequences listed in table 1, and the second subset comprises the index sequences listed in table 2. In some embodiments, the first strand and the second strand of the sample-specific universal adaptor comprise an index sequence selected from the same subset of the set of index sequences. In some embodiments, the subset of index sequences is selected from one of the subsets of index sequences in table 3.
In some embodiments, each sample-specific adaptor comprises a flow cell amplification primer binding sequence. See fig. 1C, 2A, and 2B. In some embodiments, the flow cell amplification primer binding sequence comprises a P5 sequence or a P7' sequence.
In some embodiments, contacting the plurality of index polynucleotides with the target nucleic acid comprises attaching sample-specific adapters to the target nucleic acid by transposome-mediated fragmentation. In some embodiments, contacting the plurality of index polynucleotides with the target nucleic acid comprises ligating a sample-specific adapter to the target nucleic acid. In some embodiments, the linking comprises enzymatic linking or chemical linking. In some embodiments, the chemical (chemical) linkage comprises a chemical reaction (chemistry) linkage.
In some embodiments, the sample-specific adaptor comprises a Y-shaped adaptor having a complementary double-stranded region and a mismatched single-stranded region. In some embodiments, each strand of the sample-specific adaptor comprises an index sequence at the mismatched single-stranded region. In some embodiments, only one strand of the sample-specific adaptor comprises an index sequence at the mismatched single-stranded region. In some embodiments, the sample-specific adapter comprises a single-stranded adapter. In some embodiments, the sample-specific adapter comprises a hairpin adapter. In some embodiments, contacting the plurality of index polynucleotides with the target nucleic acid involves attaching the plurality of index polynucleotides to both ends of the target nucleic acid.
In some embodiments, contacting the plurality of index polynucleotides with the target nucleic acid comprises attaching the plurality of index polynucleotides to both ends of the target nucleic acid. In some embodiments, contacting the plurality of index polynucleotides with the target nucleic acid comprises attaching the plurality of index polynucleotides to only one end of the target nucleic acid.
In some embodiments, the combination of index sequences uniquely associated with the sample is an ordered combination of index sequences.
In some embodiments, the set of index sequences comprises a plurality of non-overlapping subsets of index sequences, a hamming distance between any two index sequences in any subset is not less than a second criterion value, wherein the second criterion value is greater than the first criterion value. In some embodiments, the first standard value is 4 and the second standard value is 5. In some embodiments, the first standard value is 3. In some embodiments, the first standard value is 4. Various other designs of indexing sequence sets may be applied as described further below.
In some embodiments,
In some embodiments, fragmentation is contact with a plurality of PCR primers that target a sequence of interest to obtain a target nucleic acid comprising the sequence of interest.
In some embodiments,
The
Index sequence design
In various embodiments, the index sequence or oligonucleotide is identified in view of various factors, including but not limited to means for detecting errors within the index sequence, transformation efficiency, assay compatibility, GC content, homopolymer and manufacturing considerations.
For example, the index sequence may be designed to provide a mechanism for facilitating error detection. Figure 3 schematically illustrates an index oligonucleotide design that provides a mechanism for detecting errors occurring in an index sequence during a sequencing process. According to this design, each of the index sequences has six nucleotides and differs from all other index sequences by at least two nucleotides. As illustrated in fig. 3,
Some embodiments apply i5-i7 index pairs to multiple samples, where each ordered index pair is unique. The hamming distance between any two index sequences in the complete set of index sequences is controlled to be above a threshold. In some embodiments, the hamming distance between ordered pairs of indices is also controlled to be above a threshold. Furthermore, in some embodiments, the edit distance between index sequences is also controlled. These and other elements of the index oligonucleotide allow detection and correction of index jumps by identifying errors that would otherwise be ambiguous and uncorrectable.
A typical calculation of the edit distance is the Levenshtein distance, where each insertion, deletion, or substitution will be treated as a single edit operation and scored equally. Consider the cases of "ACTGACTA" and "ACTACTAA". In this case, the Levenshtein edit distance would be 2, as shown in the following alignment.
ACTGACTA-
ACT-ACTAA
However, in the case of an index sequence, this may underestimate the true distance between the two sequences. In effect, the index sequence will be extended by bases from the surrounding adaptors. If the bases from the surrounding adaptors happen to match another index sequence, this will actually require only a single deletion event to convert one index sequence to another. Furthermore, the index may be read in the opposite direction, in which case additional adaptor sequences may appear at the 5' end of the index. While it is possible to look at the expected adaptor sequence to see the likelihood of this occurring, this would make the index sequence valid only in the context of the particular adaptor. Rather, a custom edit distance is generated that always assumes that adjacent adaptor sequences will match adaptors. In this custom edit distance, only a single insertion/deletion event is allowed. An edit distance threshold of 3 means that index pairs are not allowed, where a single deletion + substitution can convert one index sequence into another.
In some embodiments, the edit distance is a modified Levenshtein distance, wherein end gaps are not assigned penalties. U.S. provisional patent application No. 62/447,851, incorporated herein by reference in its entirety, describes various methods for determining modified Levenshtein distances for nucleic acid sequences.
Indexing oligonucleotides, adaptors and primers
In addition to the adaptor design described in the
FIGS. 2A-2D illustrate various embodiments of indexing oligonucleotides. Although the adaptors are labeled with various components, they may contain additional components that are not labeled, such as additional primer binding sites or cleavage or digestion sites. FIG. 2A shows a standard IlluminaA double-indexed adaptor. The adapter isPartially double-stranded, and formed by annealing two oligonucleotides corresponding to both strands. The two strands have a number of complementary base pairs (e.g., 12-17bp or 6-34bp) that allow the two oligonucleotides to anneal at the ends to be ligated to the dsDNA fragments. The dsDNA fragments to be ligated on both ends to obtain paired-end reads are also referred to as inserts. Other base pairs on the two strands do not match (are not complementary), resulting in either a forked adapter or a Y-adapter with two floppy overhangs.
On the strand with the 5' soft overhang (top strand), in the 5' to 3' direction, the adapter has the P5 sequence, the i5 index sequence, and the sequencing primer binding sequence SP1 (e.g., SBS 3). On strands with 3' soft overhangs, in the 3' to 5' direction, the adapters have the P7' sequence, the i7 index sequence, and the SP2 sequencing primer binding sequence (e.g., SBS12 '). The P5 and P7' oligonucleotides were complementary to amplification primers bound to the solid phase of the flow cell of the sequencing platform. They are also referred to as amplification primer binding sites, regions or sequences. In some embodiments, the index sequence provides a means to track the source of a sample, allowing for multiplexing of multiple samples on a sequencing platform.
The complementary base pairs are part of the sequencing primer binding sequences SP1 and
As in some embodiments where the index sequence is selected from a set of index sequences, each strand of the adaptor comprises an index sequence selected from the set of index sequences, such as the sets shown in tables 1-3 and described elsewhere herein. In some embodiments, each double-stranded sequencing adaptor in the set of oligonucleotides comprises a first strand comprising an index sequence selected from a first subset of the set of index sequences and a second strand comprising an index sequence selected from a second subset of the set of index sequences. The first subset is non-overlapping with the second subset. In some embodiments, the first subset of index sequences comprises the index sequences listed in table 1 and the second subset of index sequences comprises the index sequences listed in table 2.
Table 1.I7 index set including subsets (index groups 0-3)
Table 2.I5 index set including subsets (index groups 0-3)
In some embodiments, the index sequence on the first strand of the adaptor and the index sequence on the second strand of the adaptor are both selected from the same subset of the plurality of subsets of the set of index sequences. In some embodiments, the subset of index sequences is one of the subsets of index sequences in table 3 (labeled by plate numbers).
Table 3.I5 index set and I7 index set including subsets (boards 1-4)
The set of index sequences contained in the set of oligonucleotides includes a plurality of unique index sequences. In some embodiments, the hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is 2 or greater. The set of index sequences includes a plurality of pairs of color balanced index sequences. Any two bases at the corresponding sequence positions of each pair of color-balanced index sequences include both: (i) an A base or a C base, and (ii) a G base, a T base or a U base. In some embodiments, the first standard value is 3. In some embodiments, the first standard value is 4.
In some embodiments, the set of index sequences comprises a plurality of non-overlapping subsets of index sequences, such as the subsets shown in tables 1-3. In these subsets, the hamming distance between any two index sequences is not less than the second criterion value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5.
In some embodiments, the oligonucleotide comprises an index sequence on its 3 'end and an index sequence on its 5' end. In such embodiments, the oligonucleotide may be a single-stranded nucleic acid fragment having adaptors attached to both ends. It may be a denatured fragment obtained, for example, from the adaptor-target-
In some implementations, the edit distance between any two index sequences in the set of index sequences is not less than the third criterion value. In some embodiments, the third standard value is 3. In some embodiments, the edit distance is a modified Levenshtein distance, wherein end gaps are not assigned penalties. U.S. patent application No. 15/863,737, which is incorporated herein by reference in its entirety, describes various methods for determining modified Levenshtein distances for nucleic acid sequences.
In some embodiments, each index sequence in the set of index sequences has 8 bases; the first standard value is 3; and the third standard value is 2. In some embodiments, the set of indexed sequences comprises the sequences listed below under example 2. In some embodiments, each index sequence in the set of index sequences has 10 bases; the first standard value is 4; and the third standard value is 3. In some embodiments, the set of indexed sequences comprises the sequences listed below under example 3.
From a bioinformatics perspective, longer oligonucleotides can provide more candidates that satisfy various constraints of interest, such as edit distance or hamming distance. However, longer oligonucleotides are more difficult to manufacture and will lead to undesired reactions (such as undesired reactions by self-hybridization, cross-hybridization, folding) and other side effects. In contrast, shorter oligonucleotides, while able to avoid some of these side effects, may not be able to satisfy bioinformatic constraints, such as providing a hamming distance or editing distance large enough to allow error correction. A balance between bioinformatics robustness and biochemical function must be considered. In some embodiments, each index sequence in the set of oligonucleotides has 32 bases or less. In some embodiments, each index sequence in the set of oligonucleotides has 16 bases or less. In some embodiments, each index sequence in the set of oligonucleotides has 10 or fewer bases. In some embodiments, each index sequence in the set of oligonucleotides has 8 or fewer bases. In some embodiments, each index sequence in the set of oligonucleotides has 8 bases. In some embodiments, each index sequence in the set of oligonucleotides has 7 or fewer bases. In some embodiments, each index sequence in the set of oligonucleotides has 6 or fewer bases. In some embodiments, each index sequence in the set of oligonucleotides has 5 or fewer bases. In some embodiments, each index sequence in the set of oligonucleotides has 4 or fewer bases.
In some embodiments, the set of indexing sequences incorporated into the indexing oligonucleotide does not include an indexing sequence that is empirically determined to have poor performance in indexing the source of the nucleic acid sample in multiplex massively parallel sequencing. In some embodiments, the index sequence comprises the sequence in table 4. Other sequences not listed in table 4 may also not be included.
Table 4.Non-included index sequence
Index tag
Index sequence
>N501
TAGATCGC
>N504
AGAGTAGA
>N513
TCGACTAG
>N515
TTCTAGCT
>N516
CCTAGAGT
>N501-rc
GCGATCTA
>N513-rc
CTAGTCGA
>N515-rc
AGCTAGAA
>N516-rc
ACTCTAGG
>N504-rc
TCTACTCT
>N704
TCCTGAGC
>N715
ATCTCAGG
>N710
CGAGGCTG
>N705
GGACTCCT
>N709
GCTACGCT
>N709-rc
AGCGTAGC
>N715-rc
CCTGAGAT
>N705-rc
AGGAGTCC
>N704-rc
GCTCAGGA
>N710-rc
CAGCCTCG
In some embodiments, the set of index sequences comprises at least 12 different index sequences. In some embodiments, the set of index sequences comprises at least 20 different index sequences. In some embodiments, the set of index sequences comprises at least 24 different index sequences. In some embodiments, the set of index sequences comprises at least 28 different index sequences. In some embodiments, the set of index sequences comprises at least 48 different index sequences. In some embodiments, the set of index sequences comprises at least 80 or at least 96 different index sequences. In some embodiments, the set of index sequences comprises at least 112 or at least 384 different index sequences. In some embodiments, the set of index sequences comprises at least 734, at least 1,026, or at least 1,536 different index sequences.
In some embodiments, the set of index sequences includes 4 subsets of 8 unique index sequences assigned as i5 sequences and 4 subsets of 12 unique index sequences assigned as i8 sequences. In some embodiments, the index sequences in the subset are pairs of color balanced sequences. In some embodiments, each subset includes two or more pairs of index sequences to provide redundancy, such that when any index needs to be replaced, the color balanced index pair can be replaced together with the redundant pair in the subset. In some embodiments, the set of index sequences includes 4 subsets of 12 unique index sequences assigned as i5 sequences and 4 subsets of 16 unique index sequences assigned as i8 sequences, totaling 112 sequences.
In some embodiments, the set of index sequences includes 4 subsets of index sequences, each of which can be applied as both an i5 index sequence and an i8 index sequence.
In some embodiments, the set of indexed sequences does not include any homopolymer of four or more consecutive identical bases. In some embodiments, the set of index sequences does not include index sequences that match or are reverse complementary to one or more sequencing primer sequences. In some embodiments, the sequencing primer sequence is contained in the sequence of an oligonucleotide, such as the sequence shown in the double-indexed adaptor of fig. 2A (SP1 sequence or SP2 sequence). In some embodiments, the set of index sequences does not include index sequences that match or are reverse complementary to one or more flow cell amplification primer sequences, such as P5 sequences or P7 sequences (amplification primer sequences). In some embodiments, the flow cell amplification primer sequences are included in oligonucleotide sequences, such as P5 sequences and P7' sequences at the 5' end and 3' end of the bifurcation region of the Y-shaped adaptor.
In some embodiments, the set of index sequences does not include any subsequence of the sequence of an adaptor or primer in the Illumina sequencing platform, or the reverse complement of the subsequence. In some embodiments, the sequence of the adaptors or primers in the Illumina sequencing platform comprises SEQ ID NO:1(AGATGTGTATAAGAGACAG), SEQ ID NO:3(TCGTCGGCAGCGTC), SEQ ID NO:5(CCGAGCCCACGAGAC), SEQ ID NO:7(CAAGCAGAAGACGGCATACGAGAT), and SEQ ID NO:8 (AATGATACGGCGACCACCGAGATCTACAC).
In some embodiments, the set of index sequences comprises index sequences having the same number of bases.
In some embodiments, each index sequence in the set of index sequences has a combined number of G bases and C bases between 2 and 6. In some embodiments, each index sequence has a guanine/cytosine (GC) content of between 25% and 75%. In some embodiments, the set of oligonucleotides comprises DNA oligonucleotides or RNA oligonucleotides.
FIG. 2B shows a different indexing oligonucleotide design in which only one strand of the Y-shaped adaptor contains the indexing sequence. The sequencing adapter shown in FIG. 2B is similar to that in FIG. 2A, except that the adapter contains the i7 index sequence only on the P7' arm of the Y-shaped adapter. The i7 index sequence is a member of the index sequence set. The adapter does not contain an index sequence on its P5 arm.
FIG. 2C shows another embodiment of an indexing oligonucleotide, in which the indexing sequence is incorporated into two different indexing primers, i5 indexing primer (204) and i7 indexing primer (206). The i5 index primer (204) comprises the i5 index sequence located downstream of the P5 flow cell amplification primer binding site.
The i5 index primer contained the i5 index sequence (210). The
The short
FIG. 2D shows another index oligonucleotide design involving an index primer that can be used to bind to a double-stranded short universal adaptor. The design is similar to that shown in FIG. 2C, but the short
In some embodiments, the set of index oligonucleotides is provided in a container comprising a plurality of individual compartments. In some embodiments, the container comprises a multi-well plate. FIGS. 4A-4C schematically illustrate multi-well plates in which index oligonucleotides may be provided. In some embodiments, each compartment comprises a plurality of oligonucleotides comprising one of the set of index sequences. One index sequence in a compartment is different from the index sequences contained in other compartments. The oligonucleotides in each compartment can be applied to nucleic acid fragments from different sample sources to provide a mechanism for identifying the source of the sample.
In some embodiments, each compartment comprises a first plurality of oligonucleotides comprising a first index sequence in the set of index sequences. The compartment further comprises a second plurality of oligonucleotides comprising a second index sequence in the set of index sequences. The ordered combination of the first plurality of oligonucleotides and the second plurality of oligonucleotides is different from the ordered combination in any other compartment. The set of polynucleotides comprises a first plurality of oligonucleotides and a second plurality of oligonucleotides.
The multi-well plate shown in fig. 4A comprises an array of wells in 8 rows and 12 columns for a total of 96 compartments. In some embodiments, the array may have 16 rows and 24 columns for a total of 384 compartments. In some embodiments, the set of oligonucleotides is provided in a multi-well plate as shown in fig. 4A, wherein each 1/4 rows of compartments comprises oligonucleotides comprising at least one pair of color-balanced index sequences, and each 1/4 columns of compartments comprises oligonucleotides comprising at least one pair of color-balanced indices. In such a configuration, every quarter row and every quarter column can be used in a multiple sequencing workflow. Thus, this configuration enables two-fold, three-fold, four-fold, six-fold, eight-fold, nine-fold, and 12-fold sequencing with full utilization of the wells.
FIG. 4B shows the layout of the i5 index sequence in an
Fig. 4C shows the layout of the i7 index sequence. The i7 sequence is also organized in color balance pairs as described above. The i701-i712 sequence may be selected from any subset of table 2 or table 3. For both the i5 and i7 sequences, when one sequence needs to be replaced for various reasons, such as poor performance or experimental considerations, its color balance pair should also be replaced. The removed color balance pair may be replaced with another color balance pair from the same subset in tables 1-3. Such replacement will maintain the color balance of the panel. The index sequence layouts shown in fig. 4B and 4C are for a combined double index application. In other words, each well comprises a first plurality of oligonucleotides comprising a first index sequence of a set of index sequences and a second plurality of oligonucleotides comprising a second index sequence of the set of index sequences. The ordered combination of the first and second oligonucleotides in each compartment is different from the ordered combination of any other compartment.
In some embodiments, such as in the index sequence layouts illustrated in fig. 4B and 4C, the first plurality of oligonucleotides comprises a P5 flow cell amplification primer binding site. The second plurality of oligonucleotides comprises P7' flow cell amplification primer binding sites. In some embodiments, such as the embodiments shown in fig. 4B and 4C, the first plurality of oligonucleotides comprises the i5 index sequence and the second plurality of oligonucleotides comprises the i7 index sequence.
In some embodiments, the set of oligonucleotides (including the first plurality of oligonucleotides and the second plurality of oligonucleotides) is implemented as Y-adapters comprising an index sequence, such as those Y-adapters in fig. 2A and 2B. In some embodiments, the set of oligonucleotides provided in the plate comprises double-stranded adaptors comprising an index sequence. In some embodiments, the set of oligonucleotides includes primers comprising an index sequence, such as the primers shown in fig. 2C and fig. 2D.
In some embodiments, each index sequence in the first plurality of oligonucleotides is selected from a first subset of a set of index sequences, and each index sequence in the second plurality of oligonucleotides is selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset. In some embodiments, a hamming distance between any two index sequences in the first subset or between any two index sequences in the second subset is not less than the second criterion value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5. In other words, the hamming distance between sequences in the subset is greater than the hamming distance between sequences spanning the subset. In some applications, a larger hamming distance within a subset may increase the probability of identifying index sequence reads that contain errors (such as substitutions, insertions, or deletions). In some embodiments, the first subset is a subset selected from table 1 and the second subset is a subset selected from table 2. In some embodiments, the first subset comprises the i5 index sequence and the second subset comprises the i7 index sequence.
In some embodiments, the index sequence is incorporated into a sequencing adaptor. In some embodiments, the sequencing adaptors comprise Y-shaped sequencing adaptors, wherein each sequencing adaptor comprises a first strand comprising an index sequence selected from a first subset of the set of index sequences and a second strand comprising an index sequence selected from a second subset of the set of index sequences, the first subset being non-overlapping with the second subset.
In some embodiments, the index sequences comprised in the first plurality of oligonucleotides and the second plurality of oligonucleotides are selected from the same subset of the set of index sequences. In some embodiments, the hamming distance between any two index sequences in the same subset is not less than the second criterion value. In some embodiments, the second standard value is greater than the first standard value. In some embodiments, the first standard value is 4 and the second standard value is 5. In some embodiments, the subset is selected from the subsets listed in table 3. In some embodiments, the plurality of individual compartments of the multiwell plate are arranged in an array of one or more rows of compartments and one or more columns of compartments. In some embodiments, every 1/n row and/or every 1/m column of compartments comprises an oligonucleotide comprising at least one pair of color balanced index sequences, wherein n and m are each selected from integers in the range of 1 to 24. In some embodiments, a plurality of individual compartments are arranged in an 8 x 12 array, as shown in fig. 4A.
Some embodiments provide oligonucleotides consisting essentially of multiple subsets of oligonucleotides. The set of oligonucleotides is configured to identify a source of nucleic acid samples in multiplexed massively parallel sequencing, each of the nucleic acid samples comprising a plurality of nucleic acid molecules. Each of the plurality of subsets of oligonucleotides comprises a unique index sequence, the index sequences of the plurality of subsets consisting of a set of index sequences. The hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is at least 2. The set of index sequences comprises a plurality of pairs of color balanced index sequences, wherein any two bases at respective sequence positions of each pair of color balanced index sequences comprises both: (i) an adenine (A) base or a cytosine (C) base, and (ii) a guanine (G) base, a thymine (T) base or a uracil (U) base.
Construction of the indexing oligonucleotides
Some embodiments provide methods for preparing a plurality of oligonucleotides for multiplex massively parallel sequencing. The method includes selecting a set of index sequences from a pool of different index sequences. The set of index sequences includes at least six different sequences. The hamming distance between any two index sequences in the set of index sequences is not less than a first criterion value, wherein the first criterion value is at least 2. The set of index sequences comprises a plurality of pairs of color balanced index sequences. Any two bases at the corresponding sequence positions of each pair of color-balanced index sequences include both: (i) an A base or a C base, and (i) a G base, a T base or a U base.
In some embodiments, the process for selecting a set of index sequences from a pool of different index sequences proceeds according to step 402-416 of
Fig. 5 shows a
The
The
Sample (I)
The sample used for determining the sequence of the DNA fragment may include a sample taken from any cell, fluid, tissue or organ, which contains the nucleic acid in which the sequence of interest is to be determined. In some embodiments involving diagnosis of cancer, circulating tumor DNA may be obtained from a body fluid of the subject, such as blood or plasma. In some embodiments involving the diagnosis of a fetus, it is advantageous to obtain cell-free nucleic acid, e.g., cell-free dna (cfdna), from a maternal bodily fluid. Cell-free nucleic acids, including cell-free DNA, can be obtained from biological samples including, but not limited to, plasma, serum, and urine by a variety of methods known in the art (see, e.g., Fan et al, Proc Natl Acad Sci 105: 16266-.
In various embodiments, nucleic acids (e.g., DNA or RNA) present in a sample can be specifically or non-specifically enriched prior to use (e.g., prior to preparation of a sequencing library). Non-specific enrichment of sample DNA refers to whole genome amplification of genomic DNA fragments of a sample that can be used to increase the level of sample DNA prior to preparing cfDNA sequencing libraries. Methods for whole genome amplification are known in the art. Degenerate oligonucleotide-primed PCR (DOP), primer extension PCR technology (PEP) and Multiple Displacement Amplification (MDA) are examples of whole genome amplification methods. In some embodiments, the sample is not enriched for DNA.
The sample comprising nucleic acids to which the methods described herein are applied typically comprises a biological sample ("test sample") as described above. In some embodiments, the nucleic acid to be sequenced is purified or isolated by any of a number of well-known methods.
Thus, in certain embodiments, the sample comprises or consists essentially of purified or isolated polynucleotides, or it may comprise a sample such as a tissue sample, a biological fluid sample, a cell sample, or the like. Suitable biological fluid samples include, but are not limited to, blood, plasma, serum, sweat, tears, sputum, urine, sputum, ear flow (earflow), lymph, saliva, cerebrospinal fluid, lavage fluid, bone marrow suspensions, vaginal flow, transcervical lavage fluid, cerebral fluid, ascites, breast milk, secretions of the respiratory, intestinal and genitourinary tracts, amniotic fluid, breast milk and leukocyte apheresis samples. In some embodiments, the sample is one that is readily obtainable by a non-invasive procedure, such as blood, plasma, serum, sweat, tears, sputum, urine, stool, sputum, ear flow, saliva, or feces (fecs). In certain embodiments, the sample is a peripheral blood sample, or a plasma and/or serum fraction of a peripheral blood sample. In other embodiments, the biological sample is a swab or smear, a biopsy sample, or a cell culture. In another embodiment, the sample is a mixture of two or more biological samples, for example, a biological sample may include two or more of a biological fluid sample, a tissue sample, and a cell culture sample. The terms "blood", "plasma" and "serum" as used herein expressly encompass fractions or treated portions thereof. Similarly, where a sample is taken from a biopsy, swab, smear, or the like, the "sample" expressly encompasses a processed fraction or portion derived from the biopsy, swab, smear, or the like.
In certain embodiments, the sample may be obtained from sources including, but not limited to: samples from different individuals, samples from different developmental stages of the same or different individuals, samples from different diseased individuals (e.g., individuals suspected of having a genetic disorder), normal individuals, samples obtained at different stages of a disease of an individual, samples obtained from individuals undergoing treatment for different diseases, samples from individuals undergoing different environmental factors, samples from individuals having a predisposition to a pathology, samples from individuals exposed to infectious disease agents (infectious disease agents), and the like.
In one illustrative but non-limiting embodiment, the sample is a maternal sample obtained from a pregnant female, e.g., a pregnant female. In this case, the sample may be analyzed using the methods described herein to provide a prenatal diagnosis of potential chromosomal abnormalities in the fetus. The maternal sample may be a tissue sample, a biological fluid sample or a cell sample. By way of non-limiting example, biological fluids include blood, plasma, serum, sweat, tears, sputum, urine, sputum, ear flow, lymph, saliva, cerebrospinal fluid, lavage fluid, bone marrow suspension, vaginal flow, transcervical lavage fluid, brain fluid, ascites fluid, milk, secretions of the respiratory, intestinal, and genitourinary tracts, and leukopheresis samples.
In certain embodiments, the sample may also be obtained from tissues, cells, or other polynucleotide-containing sources cultured in vitro. The cultured sample may be obtained from sources including, but not limited to: a culture (e.g., tissue or cells) maintained in different media and conditions (e.g., pH, pressure, or temperature), a culture (e.g., tissue or cells) maintained for different length periods, a culture (e.g., tissue or cells) treated with different factors or agents (e.g., candidate drugs or modulators), or a culture of different types of tissue and/or cells.
Methods of isolating nucleic acids from biological sources are well known and will vary depending on the nature of the source. One skilled in the art can readily isolate nucleic acids from sources as needed for the methods described herein. In some cases, it may be advantageous to fragment nucleic acid molecules in a nucleic acid sample. Fragmentation may be random, or it may be specific, as achieved, for example, using restriction endonuclease digestion. Methods for random fragmentation are well known in the art and include, for example, limited dnase digestion, alkaline treatment, and physical shearing.
Sequencing library preparation
In various embodiments, sequencing can be performed on a variety of sequencing platforms that require the preparation of a sequencing library. This preparation typically involves fragmentation of the DNA (sonication, nebulization or shearing), followed by DNA repair and end smoothing (polising) (blunt-ended or a-overhang), and ligation of platform-specific adapters. In one embodiment, the methods described herein can utilize next generation sequencing technologies (NGS) that allow multiple samples to be sequenced individually as genomic molecules (i.e., single-plex sequencing) or in a single sequencing run as pooled samples containing indexed genomic molecules (e.g., multiplex sequencing). These methods can generate up to billions of reads of DNA sequences. In various embodiments, the sequence of the genomic nucleic acid and/or the indexed genomic nucleic acid can be determined using, for example, next generation sequencing technology (NGS) as described herein. In various embodiments, analysis of large amounts of sequence data obtained using NGS can be performed using one or more processors as described herein.
In various embodiments, the use of such sequencing techniques does not involve the preparation of sequencing libraries.
However, in certain embodiments, the sequencing methods contemplated herein involve the preparation of sequencing libraries. In one illustrative method, sequencing library preparation involves the generation of a random collection of adaptor-modified DNA fragments (e.g., polynucleotides) that are ready for sequencing. A sequencing library of polynucleotides may be prepared by: DNA or RNA, including DNA or cDNA equivalents, analogs, such as complementary DNA or cDNA or by reverse transcriptase action, RNA template generated copy DNA. The polynucleotide may originate in a double-stranded form (e.g., dsDNA such as genomic DNA fragments, cDNA, PCR amplification products, etc.), or in certain embodiments, the polynucleotide may originate in a single-stranded form (e.g., ssDNA, RNA, etc.) and have been converted to a dsDNA form. As an example, in certain embodiments, single-stranded mRNA molecules may be copied into double-stranded cDNA suitable for use in preparing sequencing libraries. The exact sequence of the primary polynucleotide molecule is generally not important to the method of library preparation and may be known or unknown. In one embodiment, the polynucleotide molecule is a DNA molecule. More specifically, in certain embodiments, the polynucleotide molecule represents the entire gene complement of an organism or substantially the entire gene complement of an organism, and is a genomic DNA molecule (e.g., cellular DNA, cell-free DNA (cfdna), etc.) that typically comprises both intron and exon sequences (coding sequences), as well as non-coding regulatory sequences such as promoter and enhancer sequences. In certain embodiments, the primary polynucleotide molecule comprises a human genomic DNA molecule, such as a cfDNA molecule present in the peripheral blood of a pregnant subject.
The preparation of sequencing libraries for some NGS sequencing platforms is facilitated by the use of polynucleotides comprising a specific range of fragment sizes. The preparation of such libraries typically involves fragmentation of large polynucleotides (e.g., cellular genomic DNA) to obtain polynucleotides in a desired size range.
Paired-end reads can be used in the sequencing methods and systems disclosed herein. The fragment or insert length is longer than the read length, and sometimes longer than the sum of the lengths of the two reads.
In some illustrative embodiments, the sample nucleic acid is obtained as genomic DNA that is fragmented into fragments longer than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, or 5000 base pairs to which NGS methods can be readily applied. In some embodiments, paired-end reads are obtained from inserts of about 100-5000 bp. In some embodiments, the insert is about 100-1000bp in length. These are sometimes implemented as conventional short insert paired-end reads. In some embodiments, the insert is about 1000 and 5000bp in length. These are sometimes implemented as long insert matching paired reads as described above.
In some embodiments, long insert fragments are designed to evaluate very long sequences. In some embodiments, matched pair reads may be applied to obtain reads that are separated by thousands of base pairs. In these embodiments, the insert or fragment ranges from hundreds to thousands of base pairs with two biotin-ligating adaptors at both ends of the insert. Biotin ligation adaptors are then ligated to both ends of the insert to form a circular molecule, which is then further fragmented. Subfragments containing biotin ligation adaptors and both ends of the original insert were selected for sequencing on a platform designed to sequence shorter fragments.
Fragmentation can be achieved by any of a number of methods known to those skilled in the art. For example, fragmentation can be achieved by mechanical means including, but not limited to, atomization, sonication, and hydro shear. However, mechanical fragmentation typically cleaves the DNA backbone at the C-O, P-O and C-C bonds, creating a heterogeneous mixture of blunt ends with broken C-O, P-O and C-C bonds and 3' -overhangs and 5' -overhangs (see, e.g., Alnemri and Liwack, J Biol. chem 265:17323-17333[1990 ]; Richards and Boyer, J Mol Biol 11:327-240[1965]), which may need to be repaired because they may lack the 5' -phosphate necessary for subsequent enzymatic reactions, e.g., sequencing, ligation of adapters required to prepare the DNA for sequencing.
In contrast, cfDNA typically exists as fragments of less than about 300 base pairs, and thus, fragmentation is generally not necessary for generating sequencing libraries using cfDNA samples.
Typically, whether the polynucleotides are forcibly fragmented (e.g., in vitro fragmentation), or naturally present as fragments, they are converted to blunt-ended DNA having a 5 '-phosphate and a 3' -hydroxyl group. Standard protocols, e.g., using protocols such as Illumina platform sequencing as described above in the exemplary workflow with reference to fig. 1A and 1B, guide the user to end-repair sample DNA, to purify the end-repaired product prior to adenylation or dA-tailing of the 3' end, and to purify the dA-tailing product prior to the adaptor-ligation step of library preparation.
Various embodiments of the methods of sequence library preparation described herein eliminate the need to perform one or more steps typically enforced by standard protocols to obtain a modified DNA product that can be sequenced by NGS. Simplified methods (ABB methods), 1-step methods, and 2-step methods are examples of methods for preparing sequencing libraries, which can be found in U.S. patent publication No. 2013/0029852a1, which is incorporated herein by reference in its entirety.
Sequencing method
The methods and apparatus described herein may employ next generation sequencing technology (NGS), which allows massively parallel sequencing. In certain embodiments, clonally amplified DNA templates or individual DNA molecules are sequenced in a flow cell in a massively parallel fashion (e.g., as described in Volkering et al Clin Chem 55: 641-. Sequencing techniques for NGS include, but are not limited to, pyrosequencing, sequencing by synthesis using reversible dye terminators, oligonucleotide probe ligation sequencing, and ion semiconductor sequencing. DNA from a single sample can be sequenced individually (i.e., single-plex sequencing), or DNA from multiple samples can be pooled and sequenced as indexed genomic molecules in a single sequencing run (i.e., multiplex sequencing) to generate up to hundreds of millions of DNA sequence reads. Examples of sequencing techniques that can be used to obtain sequence information according to the methods of the invention are further described herein.
Some sequencing technologies are commercially available, such as the hybridization sequencing platform from Affymetrix Inc (Sunnyvale, CA) and the synthetic sequencing platforms from 454Life Sciences (Bradford, CT), Illumina/Solexa (Hayward, CA) and Helicos Biosciences (Cambridge, MA), as well as the ligation sequencing platform from Applied Biosystems (Foster City, CA), as described below. In addition to single molecule sequencing using sequencing-by-synthesis of Helicos Biosciences, other single molecule sequencing technologies include, but are not limited to, SMCT of Pacific BiosciencesTMTechnique, ION torentTMTechniques and Nanopore sequencing, for example, developed by Oxford Nanopore Technologies.
While the automated Sanger method is considered a "first generation" technology, Sanger sequencing, including automated Sanger sequencing, can also be used in the methods described herein. Additional suitable sequencing methods include, but are not limited to, nucleic acid imaging techniques such as Atomic Force Microscopy (AFM) or Transmission Electron Microscopy (TEM). Illustrative sequencing techniques are described in more detail below.
In some embodiments, the disclosed methods involve obtaining sequence information of nucleic acids in a test sample by massively parallel sequencing of millions of DNA fragments using both Illumina's sequencing-by-synthesis and reversible terminator-based sequencing chemistry (e.g., as described in Bentley et al, Nature 6:53-59[2009 ]). The template DNA may be genomic DNA, such as cellular DNA or cfDNA. In some embodiments, genomic DNA from an isolated cell is used as a template, and it is fragmented into lengths of several hundred base pairs. In other embodiments, cfDNA or circulating tumor dna (ctDNA) is used as a template, and fragmentation is not required because cfDNA or ctDNA exists as short fragments. For example, fetal cfDNA circulates in the bloodstream as fragments of approximately 170 base pairs (bp) in length (Fan et al, Clin Chem 56:1279-1286[2010]), and fragmentation of DNA prior to sequencing is not required. Illumina sequencing technology relies on attaching fragmented genomic DNA to a planar, optically transparent surface to which oligonucleotide anchors are bound. The template DNA was end-repaired to generate 5 '-phosphorylated blunt ends, and the polymerase activity of the klenow fragment was used to add a single a base to the 3' end of the blunt-ended phosphorylated DNA fragment. This addition prepares DNA fragments for ligation to oligonucleotide adaptors that have a single T base overhang at their 3' end to increase ligation efficiency. The adaptor oligonucleotide is complementary to the flow cell anchor oligonucleotide. Adaptor-modified single-stranded template DNA is added to the flow cell under limiting dilution conditions and immobilized to the anchor oligonucleotide by hybridization. The attached DNA fragments were extended and bridge amplified to generate ultra-high density sequencing flow cells with hundreds of millions of clusters, each cluster containing about 1,000 copies of the same template. In one embodiment, randomly fragmented genomic DNA is amplified using PCR before it is subjected to cluster amplification. Alternatively, non-amplified genomic library preparations were used, and cluster amplification was used separately to enrich for randomly fragmented genomic DNA (Kozarewa et al, Nature Methods 6:291-295[2009 ]). In some applications, the template is sequenced using a robust four-color DNA sequencing-by-synthesis technique that employs a reversible terminator with a removable fluorescent dye. High sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Short sequence reads of about tens to hundreds of base pairs are aligned to the reference genome, and unique mappings of short sequence reads to the reference genome are identified using specially developed data analysis pipeline software. After the first read is completed, the template may be regenerated in situ to enable a second read from the opposite end of the fragment. Thus, single-ended sequencing or paired-ended sequencing of DNA fragments can be used.
Various embodiments of the present disclosure may use sequencing-by-synthesis that allows paired-end sequencing. In some embodiments, the sequencing-by-synthesis platform by Illumina involves clustering fragments. Clustering is a process in which each fragment molecule is amplified isothermally. In some embodiments, as in the examples described herein, a fragment has two different adaptors attached to both ends of the fragment, the adaptors allowing the fragment to hybridize to two different oligonucleotides on the surface of the flow cell lane. Fragments also contain or are linked to two index sequences at both ends of the fragment, which provide tags to identify different samples in multiplex sequencing. In some sequencing platforms, the fragments to be sequenced from both ends are also referred to as inserts.
In some embodiments, the flow cell for clustering in the Illumina platform is a slide with lanes. Each lane is a glass channel coated with a large amount (a fall of) of two types of oligonucleotides (e.g., P5 oligonucleotide and P7' oligonucleotide). Hybridization is achieved by the first of the two types of oligonucleotides on the surface. The oligonucleotide is complementary to the first adaptor on one end of the fragment. The polymerase produces the complementary strand of the hybridized fragment. The double stranded molecules are denatured and the original template strand is washed away. The remaining strands, in parallel with many other remaining strands, are clonally amplified by bridge amplification.
In bridge amplification and other sequencing methods involving clustering, a strand is folded and a second adapter region on a second end of the strand is hybridized to a second type of oligonucleotide on the surface of the flow cell. The polymerase produces a complementary strand, forming a double-stranded bridge molecule. The double-stranded molecule is denatured, resulting in two single-stranded molecules that are tethered to the flow cell by two different oligonucleotides. This process is then repeated one more pass and over again, and occurs simultaneously for millions of clusters, resulting in clonal expansion of all fragments. After bridge amplification, the reverse strand is cleaved and washed away, leaving only the forward strand. The 3' end is blocked to prevent unwanted priming.
After clustering, sequencing is initiated by extending the first sequencing primer to generate a first read. At each cycle, fluorescently tagged nucleotides compete for addition to the growing strand. Based on the sequence of the template, only one nucleotide is incorporated. After addition of each nucleotide, the cluster is excited by a light source and emits a characteristic fluorescent signal. The number of cycles determines the length of the read. The emission wavelength and signal intensity determine the base call. For a given cluster, all of the same chains are read simultaneously. Hundreds of millions of clusters are sequenced in a massively parallel fashion. After the first read is completed, the read product is washed away.
In the next step of the protocol involving two index primers, the
After reading both of the primers, read 2 is initiated by extending the second flow cell oligonucleotide using a polymerase, forming a double-stranded bridge. The double-stranded DNA is denatured, and the 3' -end is blocked. The original forward strand is cleaved off and washed away, leaving the reverse strand. Read 2 started with the introduction of the
The examples of sequencing-by-synthesis described above involve paired-end reads, which are used in many embodiments of the disclosed methods. Paired-end sequencing involves 2 reads from both ends of the fragment. Paired end reads were used to resolve ambiguous alignments. Paired-end sequencing allows a user to select the length of an insert (or a fragment to be sequenced) and sequence either end of the insert, generating high quality, alignable sequence data. Because the distance between each paired read is known, the alignment algorithm can use this information to more accurately map the reads on the repeat region. This results in better alignment of reads, particularly across difficult to sequence repeat regions in the genome. Paired-end sequencing can detect rearrangements, including insertions and deletions (insertions/deletions) and inversions.
Paired-end reads can use inserts of different lengths (i.e., different sizes of fragments to be sequenced). As a default meaning in this disclosure, paired-end reads are used to refer to reads obtained from various insert lengths. In some cases, to distinguish short insert paired end reads from long insert paired end reads, the latter are specifically referred to as matching pair reads. In some embodiments involving matching pair reads, two biotin-ligating adaptors are first attached to both ends of a relatively long insert (e.g., a few kb). Biotin ligation adaptors are then ligated to both ends of the insert to form a circular molecule. Sub-fragments encompassing the biotin-ligated adaptors can then be obtained by further fragmentation of the circular molecules. The sub-fragments containing both ends of the original fragment in reverse sequence order can then be sequenced by the same procedure as described above for short insert paired-end sequencing. Additional details of matched pair sequencing using the Illumina platform are shown in the online publications at the following addresses, which are incorporated by reference in their entirety: https:// www.illumina.com/documents/products/technologies/technology _ nextera _ matepair _ data _ processing.
After sequencing the DNA fragments, sequence reads of a predetermined length (e.g., 100bp) are located by mapping to (aligning with) a known reference genome. The mapped reads and their corresponding positions on the reference sequence are also referred to as tags. In another embodiment of the procedure, localization is achieved by k-mer (k-mer) sharing and read-read alignment. Analysis of many embodiments disclosed herein utilize poorly matched or unmatched reads, as well as matched reads (tags). In one embodiment, the reference genomic sequence is the NCBI36/hg18 sequence, which is in genome. org & db & hg18& hgsid 166260105 are available on the world wide web. Alternatively, the reference genomic sequence is GRCh37/hg19 or GRCh38, which are available on the world Wide Web of genome. Other sources of common sequence information include GenBank, dbEST, dbSTS, EMBL (European Molecular Biology Laboratory) and DDBJ (Japanese DNA database of Japan)). A number of computer algorithms can be used to align sequences, including, but not limited to, BLAST (Altschul et al, 1990), BLATT (MPsrc) (Sturrock & Collins,1993), FASTA (Person & Lipman,1988), BOWTIE (Langmead et al, genomic biology 10: R25.1-R25.10[2009]), or ELAND (Illumina, Inc., San Diego, Calif., USA). In one embodiment, one end of a clonally amplified copy of the plasma cfDNA molecule is sequenced and processed by bioinformatics Alignment analysis by an Illumina genome analyzer using efficient large-Scale Alignment of Nucleotide Databases (ELAND) software.
Other sequencing methods can also be used to obtain sequence reads and their alignments. Additional suitable methods are described in U.S. patent publication No. 2016/0319345a1, which is incorporated by reference herein in its entirety.
In some embodiments of the methods described herein, the sequence reads are about 20bp, about 25bp, about 30bp, about 35bp, about 40bp, about 45bp, about 50bp, about 55bp, about 60bp, about 65bp, about 70bp, about 75bp, about 80bp, about 85bp, about 90bp, about 95bp, about 100bp, about 110bp, about 120bp, about 130bp, about 140bp, about 150bp, about 200bp, about 250bp, about 300bp, about 350bp, about 400bp, about 450bp, or about 500 bp. It is expected that technological advances will enable single-ended reads greater than 500bp, which when generating paired-ended reads enables reads greater than about 1000 bp. In some embodiments, paired-end reads are used to determine a sequence of interest that comprises sequence reads of about 20bp to 1000bp, about 50bp to 500bp, or 80bp to 150 bp. In various embodiments, paired-end reads are used to evaluate the sequence of interest. The sequence of interest is longer than the read. In some embodiments, the sequence of interest is longer than about 100bp, 500bp, 1000bp, or 4000 bp. Mapping of sequence reads is accomplished by comparing the sequence of the reads to a reference sequence to determine the chromosomal origin of the sequenced nucleic acid molecule, and no specific genetic sequence information is required. A small degree of mismatch (0-2 mismatches/read) may be allowed to account for minor polymorphisms between the genomes that may be present in the reference genome and the mixed sample. In some embodiments, reads that match the reference sequence are used as anchor reads, and reads that pair with anchor reads but do not match or poorly match the reference are used as anchor reads. In some embodiments, poorly matched reads may have a relatively large number of mismatch percentages/reads, e.g., at least about 5%, at least about 10%, at least about 15%, or at least about 20% mismatches/reads.
Multiple sequence tags (i.e., reads that match the reference sequence) are typically obtained for each sample. In some embodiments, each sample obtains at least about 3 x 10, e.g., 100bp, from mapping reads to a reference genome6A sequence tag of at least about 5 x 106A sequence tag of at least about 8 x 106A sequence tag of at least about 10 x 106Sequence of thingsColumn label, at least about 15 x 106At least about 20 x 10 of sequence tags6At least about 30 x 10 of sequence tags6A sequence tag of at least about 40x 106A sequence tag, or at least about 50 x 106And (4) sequence tags. In some embodiments, all sequence reads are mapped to all regions of the reference genome, providing whole genome reads. In other embodiments, the reads map to a sequence of interest.
Apparatus and system for preparing index oligonucleotides
As should be apparent, certain embodiments of the present invention employ processes that function under the control of instructions and/or data stored in or transmitted over one or more computer systems. Certain embodiments also relate to apparatus for performing these operations. This apparatus may be specially designed and/or constructed for the required purposes, or it may be a general-purpose computer selectively configured by one or more computer programs and/or data structures stored in or otherwise available to the computer. In particular, various general-purpose machines may be used with programs written in accordance with the teachings herein, or it may be more convenient to construct a more specialized apparatus to perform the required method steps. The specific structure of the various described machines is shown and described below.
Certain embodiments also provide functionality (e.g., code and processes) for storing any of the results (e.g., query results) or data structures generated as described herein. Such results or data structures are typically stored, at least temporarily, on a computer-readable medium. The results or data structures may also be output in any of a variety of manners, such as display, printing, and the like.
Examples of tangible computer-readable media suitable for use with the computer program products and computing devices of the invention include, but are not limited to, magnetic media such as hard disks, floppy disks, and magnetic tape; optical media such as CD-ROM disks; a magneto-optical medium; semiconductor memory devices (e.g., flash memory) and hardware devices that are specially configured to store and execute program instructions, such as read-only memory devices (ASICs) and random-access memory (ROMs), and sometimes application-specific integrated circuits (ASICs), Programmable Logic Devices (PLDs), and signal-bearing media for communicating computer-readable instructions, such as local-area networks, wide-area networks, and the internet. The data and program instructions provided herein may also be embodied on a carrier wave or other transmission medium (including electrically or optically conductive pathways). The data and program instructions of the present invention may also be embodied on a carrier wave or other transmission medium (e.g., optical, electrical, and/or radio waves).
Examples of program instructions include both low-level code, such as produced by a compiler, and high-level code that may be executed by the computer using an interpreter. Further, the program instructions may be machine code, source code, and/or any other code that directly or indirectly controls the operation of a computing machine. The code may specify inputs, outputs, computations, conditions, branches, iterative loops, etc.
Analysis of sequencing data and diagnostics derived therefrom are typically performed using various computer-implemented algorithms and programs. Thus, certain embodiments employ processes involving data stored in or transmitted through one or more computer systems or other processing systems. Embodiments disclosed herein also relate to apparatuses for performing these operations. This apparatus may be specially constructed for the required purposes, or it may be a general-purpose computer (or group of computers) selectively activated or reconfigured by a computer program and/or data structure stored in the computer. In some embodiments, the processor sets perform some or all of the enumerated analysis operations cooperatively (e.g., via network or cloud computing) and/or in parallel. The processor or processor complex for performing the methods described herein can be various types of processors or processor complexes, including microcontrollers and microprocessors, such as programmable devices (e.g., CPLDs and FPGAs) and non-programmable devices such as gate array ASICs or general purpose microprocessors.
One embodiment provides a system for determining sequences in a plurality of test samples comprising nucleic acids, the system comprising a sequencer for receiving a nucleic acid sample and providing nucleic acid sequence information from the sample; a processor; and a machine-readable storage medium having instructions stored thereon for execution on the processor to determine a sequence of interest in a test sample by the method described above.
In some embodiments of any one of the systems provided herein, the sequencer is configured to perform Next Generation Sequencing (NGS). In some embodiments, the sequencer is configured to perform massively parallel sequencing using sequencing by synthesis using reversible dye terminators. In other embodiments, the sequencer is configured to perform ligation sequencing. In yet other embodiments, the sequencer is configured to perform single molecule sequencing.
Another embodiment provides a system comprising a nucleic acid synthesizer, a processor, and a machine-readable storage medium having instructions stored thereon for execution on the processor to prepare sequencing adapters. The instructions include: (a) code for adding to a candidate set of index sequences pairs of color-balanced index sequences randomly selected from a pool of different index sequences, wherein any two bases at corresponding sequence positions of each pair of color-balanced index sequences comprises both: (i) an adenine base or a cytosine base, and (ii) a guanine base, a thymine base, or a uracil base; (b) code for sorting index sequences remaining in a pool of index sequences based on a minimum hamming distance from members of the candidate set; (c) code for removing any remaining index sequences for which the minimum hamming distance to members of the candidate set is less than a first criterion value or for which the minimum edit distance to members of the candidate set is less than a second criterion value; (d) code for repeating (a) - (c) to maximize the size of the candidate set; and (e) code for selecting from the candidate set a set of index sequences to be incorporated into a set of oligonucleotides configured for multiplex massively parallel sequencing.
In some embodiments, the instructions include: (a) code for receiving a plurality of index reads and a plurality of target reads of target sequences obtained from target nucleic acids derived from a plurality of samples, wherein each target read comprises target sequences obtained from target nucleic acids derived from samples from the plurality of samples, each index read comprises an index sequence obtained from target nucleic acids derived from samples from the plurality of samples, the index sequence is selected from a set of index sequences, each target read is associated with at least one index read, each sample in the plurality of samples is uniquely associated with one or more index sequences in the set of index sequences, and a hamming distance between any two index sequences in the set of index sequences is not less than a first standard value, wherein the first standard value is at least 2; (b) code for identifying, among the plurality of target reads, a subset of target reads associated with index reads that match at least one index sequence uniquely associated with a particular sample of the plurality of samples; and (c) code for determining a target sequence for the particular sample based on the identified subset of target reads.
Furthermore, certain embodiments relate to tangible and/or non-transitory computer-readable media or computer program products that include program instructions and/or data (including data structures) for performing various computer-implemented operations. Examples of computer readable media include, but are not limited to, semiconductor memory devices, magnetic media such as disk drives, magnetic tape, optical media such as CDs, magneto-optical media, and hardware devices that are specially configured to store and execute program instructions, such as read only memory devices (ROM) and Random Access Memory (RAM). The computer-readable medium may be controlled directly by the end-user, or the medium may be controlled indirectly by the end-user. Examples of directly controlled media include media located at a user facility and/or media that is not shared with other entities. Examples of indirectly controlled media include media that is indirectly accessible to users via an external network and/or via a service that provides a shared resource such as a "cloud". Examples of program instructions include both machine code, such as produced by a compiler, and files containing higher level code that may be executed by the computer using an interpreter.
In various embodiments, the data or information employed in the disclosed methods and apparatus is provided in an electronic format. Such data or information may include reads and tags derived from nucleic acid samples, reference sequences (including reference sequences that provide only or primarily polymorphisms), decisions such as cancer diagnostic decisions, counseling advice, diagnosis, and the like. As used herein, data or other information provided in an electronic format may be used for storage on and transmission between machines. Conventionally, data in electronic format is provided digitally and may be stored as bits and/or bytes in various data structures, lists, databases, etc. The data may be embodied electronically, optically, and the like.
One embodiment provides a computer program product for generating an output indicative of a sequence of a DNA fragment of interest in a test sample. The computer product may contain instructions for performing any one or more of the methods described above for determining a sequence of interest. As explained, the computer product can include a non-transitory and/or tangible computer-readable medium having computer-executable or compilable logic (e.g., instructions) recorded thereon for enabling the processor to determine a sequence of interest. In one example, a computer product includes a computer-readable medium having computer-executable or compilable logic (e.g., instructions) recorded thereon for enabling a processor to diagnose a condition or determine a nucleic acid sequence of interest.
It will be appreciated that for an unaided human, it is not practical, or even possible in most cases, to perform the computational operations of the methods disclosed herein. For example, without the aid of computing equipment, mapping a single 30bp read from a sample to any one of the human chromosomes may require years of effort. The problem is, of course, complex, as reliable determination of low allele frequency mutations typically requires mapping thousands (e.g., at least about 10,000) or even millions of reads to one or more chromosomes.
The methods disclosed herein can be performed using a system for determining a sequence of interest in a plurality of test samples. The system may include: (a) a sequencer for receiving nucleic acids from a test sample and providing nucleic acid sequence information from said sample; (b) a processor; and (c) one or more computer-readable storage media having instructions stored thereon for execution on the processor to determine a sequence of interest in a test sample. In some embodiments, the method is indicated by a computer-readable medium having stored thereon computer-readable instructions for performing a method for determining a sequence of interest. Accordingly, one embodiment provides a computer program product comprising a non-transitory machine-readable medium storing program code that, when executed by one or more processors of a computer system, causes the computer system to implement a method for determining a sequence of nucleic acid fragments in a plurality of test samples.
In some embodiments, the program code or instructions may also include automatically recording information related to the method. Patient medical records may be maintained by, for example, a laboratory, a physician's office, a hospital, a health maintenance organization, an insurance company, or a personal medical records website. Further, based on the results of the processor-implemented analysis, the method may further involve prescribing, initiating, and/or altering treatment of the human subject from which the test sample is obtained. This may involve performing one or more additional tests or analyses on additional samples taken from the subject.
The disclosed methods may also be performed using a computer processing system adapted or configured to perform a method for determining a sequence of interest. One embodiment provides a computer processing system adapted or configured to perform a method as described herein. In one embodiment, the apparatus comprises a sequencing device adapted or configured for sequencing at least a portion of nucleic acid molecules in a sample to obtain a type of sequence information described elsewhere herein. The apparatus may also include a component for processing the sample. Such components are described elsewhere herein.
The sequence or other data may be input to the computer or stored on a computer readable medium, directly or indirectly. In one embodiment, the computer system is directly connected to a sequencing device that reads and/or analyzes the sequence of nucleic acids from the sample. The sequences or other information from such tools are provided via an interface in a computer system. Alternatively, the sequences processed by the system are provided from a sequence storage source such as a database or other repository. After being available to the processing device, the memory means or mass memory means buffer or store the nucleic acid sequence at least temporarily. Further, the memory device may store tag counts for various chromosomes or genomes, and the like. The memory may also store various programs (routines) and/or programs (programs) for analyzing the data of the presented sequence or mapping. Such a program (program)/program (routine) may include a program for performing statistical analysis and the like.
In one example, a user provides a sample to a sequencing device. Data is collected and/or analyzed by a sequencing device connected to a computer. Software on the computer allows data collection and/or analysis. The data may be stored, presented (via a monitor or other similar device), and/or transmitted to another location. The computer may be connected to the internet for transmitting data to a handheld device used by a remote user (e.g., a physician, scientist, or analyst). It should be understood that the data may be stored and/or analyzed prior to transmission. In some embodiments, raw data is collected and sent to a remote user or device that will analyze and/or store the data. The transmission may occur via the internet, but may also occur via satellite or other connections. Alternatively, the data may be stored on a computer readable medium, and the medium may be shipped to the end user (e.g., via mail). The remote users may be in the same or different geographic locations including, but not limited to, buildings, cities, states, countries, or continents.
In some embodiments, the method further comprises collecting data about the plurality of polynucleotide sequences (e.g., reads, tags, and/or reference chromosomal sequences) and transmitting the data to a computer or other computing system. For example, the computer may be connected to a laboratory device, such as a sample collection device, a nucleotide amplification device, a nucleotide sequencing device, or a hybridization device. The computer may then collect applicable data collected by the laboratory device. The data may be stored on the computer at any step, for example, as collected in real time, before transmission, during or in conjunction with transmission, or after transmission. The data may be stored on a computer readable medium that can be extracted from the computer. The collected or stored data may be transmitted from the computer to a remote location, for example via a local or wide area network such as the internet. At the remote location, various operations may be performed on the transmitted data, as described below.
The types of electronically formatted data that may be stored, transmitted, analyzed, and/or manipulated in the systems, devices, and methods disclosed herein are the following:
a) reads obtained by sequencing nucleic acids in a test sample
b) Tags obtained by aligning reads to a reference genome or one or more other reference sequences
c) Reference genome or sequence
d) Threshold for determining test sample as affected, unaffected or not
e) Actual determination of medical conditions related to a sequence of interest
f) Diagnosis (clinical status associated with the decision)
g) Recommendation for further testing derived from decision making and/or diagnosis
h) Treatment and/or monitoring plan derived from judgment and/or diagnosis
These different types of data may be obtained, stored, transmitted, analyzed, and/or manipulated at one or more locations using different devices. The treatment options span a broad spectrum. At one end of the spectrum, all or many of this information is stored and used at the location where the test sample is processed (e.g., a physician's office or other clinical environment). In other extreme cases, a sample is obtained at one location, processed and optionally sequenced at a different location, reads are aligned and resolved at one or more different locations, and a diagnosis, recommendation, and/or plan is prepared at yet another location (which may be the location where the sample was obtained).
In various embodiments, the reads are generated by a sequencing device and then transmitted to a remote site where the reads are processed to determine the sequence of interest. As an example, at the remote location, the reads are aligned to the reference sequence to produce an anchor read and an anchored read. The processing operations that may be employed at the different locations are the following:
a) sample collection
b) Sample processing prior to sequencing
c) Sequencing
d) Analyzing the sequence data and obtaining a medical decision
e) Diagnosis of
f) Reporting diagnosis and/or determination to a patient or healthcare provider
g) Developing a plan for further treatment, testing and/or monitoring
h) Execution plan
i) Consultation
Any one or more of these operations may be automated, as described elsewhere herein. Typically, sequencing and analysis of sequence data and obtaining medical decisions will be computationally performed. Other operations may be performed manually or automatically.
FIG. 6 illustrates one embodiment of a decentralized system for generating a decision or diagnosis from a plurality of test samples. The
The sequence data is provided to a
FIG. 7 illustrates, in a simple modular format, a typical computer system that may be used as a computing device according to some embodiments, when suitably configured or designed. The
The CPU2002 is also connected to an
In one embodiment, a system such as
In particular embodiments, the
In certain embodiments, a computer, as used herein, may include a user terminal, which may be any type of computer (e.g., desktop computer, laptop computer, tablet computer, etc.), media computing platform (e.g., cable, satellite television set-top box, digital video recorder, etc.), handheld computing device (e.g., PDA, email client, etc.), cell phone, or any other type of computing or communication platform.
In certain embodiments, a computer, as used herein, may also include a server system in communication with a user terminal, which may include a server device or a decentralized server device, and may include a mainframe computer, a minicomputer, a supercomputer, a personal computer, or a combination thereof. Multiple server systems may also be used without departing from the scope of the invention. The user terminal and the server system may communicate with each other through a network. The network may include, for example, a wired network such as a LAN (local area network), a WAN (wide area network), a MAN (metropolitan area network), an ISDN (integrated services digital network), etc., and a wireless network such as a wireless LAN, CDMA, bluetooth, satellite communication network, etc., without limiting the scope of the present invention.
The present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the disclosure is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.
Experiment of
Example 1
Index sequence validation
Computer simulation experiments were performed to verify the effectiveness and efficacy of the indexing sequences according to some embodiments. The index sequence satisfies the following condition.
The ● index sequence did not directly match the 8-mer subsequence (or reverse complement) of the sequencing platform sequencing adapter or primer
○SBS491
○P7
○P5
○SBS3
● No four nucleotide homopolymers were present
● G/C content of 2 to 6
● did not use the sequences listed in Table 4 (known poor performers)
● design 1: the index sequences are selected from those in tables 1 and 2
○ No two sequences have a Hamming distance of < 4
● design 2: the index sequences are selected from those in Table 3
○ Hamming distance
■ the hamming distance between any pair in the I5 or I7 sequence of a given panel is 5
■ the hamming distance between any pair is 4 in all sequences (I5 and I7) across the entire design
○ edit distance
■ in all sequences (I5 and I7) across the entire design, the "edit" distance between any pair is 3
Computer simulation experiments generated 100 ten thousand randomly varying index sequences with 3 editing operations and no direct match was found in the resulting sequences. This experiment generated 100 ten thousand randomly varying index sequences with 1 deletion and 1 substitution operation, and no direct match was found in the resulting sequences.
The resulting sequences were assigned to a multi-well plate layout, as shown in fig. 4. No i5/i7 pair was found to occur more than once. The designed pair is color balanced. The triplets (quarter rows) are color balanced. The quadruple (half column) is color balanced. The six tuple (half line) is color balanced. The octave (octave) (full column) is color balanced. The designed collections (doublets, triplets, quadruplets, hexagrams, octagrams) do not have duplicate pairs (i.e. they mitigate index jumps).
Experimental results demonstrate that the index sequences and index oligonucleotides provided according to some embodiments can detect and correct errors in index sequence reads, thereby providing more accurate sample indexing in multiplex massively parallel sequencing.
- 上一篇:一种医用注射器针头装配设备
- 下一篇:密封微孔测定法