阅读说明：本技术 包含罂粟碱和阿魏酸的药物组合物及其应用 (Pharmaceutical composition containing papaverine and ferulic acid and application thereof ) 是由 党亚龙 于 2021-09-03 设计创作，主要内容包括：本发明涉及生物医学领域,具体而言,涉及一种包含罂粟碱和阿魏酸的药物组合物及其应用。本发明所提供的组合物,具有明显的协同作用,能够更好地抑制小胶质细胞的过度激活,抑制其炎症因子的释放,并加快神经损伤的修复。(The invention relates to the field of biomedicine, and particularly relates to a pharmaceutical composition containing papaverine and ferulic acid and application thereof. The composition provided by the invention has an obvious synergistic effect, can better inhibit the over-activation of microglia, inhibit the release of inflammatory factors of the microglia, and accelerate the repair of nerve injury.)

1. A pharmaceutical composition characterised in that the active pharmaceutical ingredients comprise papaverine and ferulic acid.

2. The pharmaceutical composition of claim 1, wherein the papaverine is present in a concentration of 5 μ g/ml to 15 μ g/ml and the ferulic acid is present in a concentration of 5 μ M to 15 μ M.

3. The pharmaceutical composition of claim 2, wherein the papaverine is present in a concentration of 7 μ g/ml to 13 μ g/ml and the ferulic acid is present in a concentration of 7 μ M to 13 μ M.

4. The pharmaceutical composition of claim 3, wherein the papaverine is present in a concentration of 8 μ g/ml to 12 μ g/ml and the ferulic acid is present in a concentration of 8 μ M to 12 μ M.

5. The pharmaceutical composition according to any one of claims 1 to 4, further comprising a pharmaceutically acceptable carrier.

6. The pharmaceutical composition according to any one of claims 1 to 4, wherein the composition is in the form of one selected from the group consisting of a solution, an emulsion, a dispersion and a suspension.

7. A pharmaceutical composition according to any one of claims 1 to 4, wherein the composition is in the form of one selected from a topical cream, a gel, a foam and a solution in an organic solvent.

8. The pharmaceutical composition of claim 7, wherein the gel is in a form selected from the group consisting of a hydrogel, an organogel, and a xerogel.

9. Use of the pharmaceutical composition of any one of claims 1 to 8 for the preparation of a medicament for the treatment of a nerve damage disease caused by excessive activation of microglia.

10. The use of claim 9, wherein the nerve damage disease comprises glaucoma, parkinson's disease, alzheimer's disease, macular degeneration, and optic nerve contusion.

Technical Field

The invention relates to the field of biomedicine, and particularly relates to a pharmaceutical composition containing papaverine and ferulic acid and application thereof.

Background

Microglia (Microglia), also known as Microglia, is a type of glial cell that exists in the brain and spinal cord, accounting for approximately 10% -15% of the number of brain cells. Microglia, a macrophage-like group present in the central nervous system, is the fastest reacting and most important immune barrier in the central nervous system. Microglia usually do not overlap with other glial cells (e.g., astrocytes) in the central nervous system. Microglia are important for maintaining normal function of the central nervous system: they clear neuritic plaques, pathogens, and damaged or nonfunctional neurons and axons in the central nervous system. Microglia can sense the tiny change of the extracellular potassium ion concentration through a special potassium ion channel existing on the cell surface, so that the microglia can timely respond to the potential tiny lesion of the central nervous system to prevent the tiny lesion from being enlarged into a disease which is enough to threaten the life of an organism.

Microglia are associated with diseases such as alzheimer's disease (senile dementia), parkinson's disease, aids dementia syndrome, and retinal degeneration. Abnormal microglial function can cause substances such as active oxygen free radicals secreted by the microglial function to damage peripheral nerve cells, so that neurodegenerative diseases are caused. Inflammatory factors secreted by microglia are likely to be one of the factors that exacerbate neurodegeneration in patients with Parkinson's disease. Similar mechanisms of microglia may also exacerbate the neurodegenerative disease of alzheimer's disease, but there is also evidence that microglia can inhibit the early onset of alzheimer's disease. In aids patients, aids type I virus in the central nervous system is mainly stored in microglia. Microglia infected by AIDS virus can be activated, secrete immune regulation factor with cytotoxicity, cause dysfunction of nervous system, and finally cause neurodegenerative disease.

Papaverine (PAP) is an opiate alkaloid antispasmodic, and is also a nonspecific PDE inhibitor, and has effects of relaxing smooth muscle of cardiovascular, respiratory and gastrointestinal tracts, and can be used for treating cerebral thrombosis, pulmonary embolism, and arterial spasm, and for treating erectile dysfunction occasionally. Although it is present in poppy, papaverine differs from analgesic (morphine-related) opiate alkaloids (opioids) in both structure and pharmacological actions. In recent years, the effects of suppressing microglial immune inflammation, protecting central nerves and the like are gradually emphasized.

Abnormally activated microglia release a number of cytotoxic factors such as Tumor necrosis factor-alpha (TNF- α), Interleukin-1 β (Interleukin-1 β, IL-1 β), Nitric Oxide (NO), and Reactive Oxygen Species (ROS), causing secondary damage to RGCs, damage to nerves, and thus are associated with a variety of diseases. Therefore, inhibiting the over-activation of microglia is an important link for the research of therapeutic methods for the lesion of nerve damage.

Heretofore, it has been reported in the prior art that papaverine is expected to be used for treating optic nerve damage diseases such as glaucoma by suppressing activation of microglia and reducing inflammatory reaction, but its effect is not satisfactory and further improvement is required.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first object of the present invention is to provide a pharmaceutical composition whose active pharmaceutical ingredients include papaverine and ferulic acid.

Optionally, the pharmaceutical composition is prepared from papaverine with a concentration of 5 μ g/ml to 15 μ g/ml and ferulic acid with a concentration of 5 μ M to 15 μ M.

Optionally, the pharmaceutical composition is prepared from papaverine with a concentration of 7-13 μ g/ml and ferulic acid with a concentration of 7-13 μ M.

Optionally, the pharmaceutical composition is prepared from papaverine 8-12 μ g/ml and ferulic acid 8-12 μ M.

Optionally, the pharmaceutical composition as described above, further comprising a pharmaceutically acceptable carrier.

Optionally, the pharmaceutical composition as described above, in a form selected from one of a solution, an emulsion, a dispersion and a suspension.

Optionally, a pharmaceutical composition as described above, in the form of one selected from the group consisting of a topical cream, a gel, a foam and a solution in an organic solvent.

Optionally, the pharmaceutical composition as described above, wherein the gel is in the form of one selected from the group consisting of a hydrogel, an organogel and a xerogel.

The second purpose of the invention is to provide the application of the pharmaceutical composition in preparing a medicament for treating nerve damage diseases caused by excessive activation of microglia.

Alternatively, for use as described above, the nerve damage disease comprises glaucoma, parkinson's disease, alzheimer's disease, macular degeneration and optic nerve contusion.

The invention has the beneficial effects that:

the composition provided by the invention has an obvious synergistic effect, can better inhibit the over-activation of microglia, inhibit the release of inflammatory factors of the microglia, and accelerate the repair of nerve injury.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the results of a flow cytometer assay for detecting phagocytosis in cells according to an embodiment of the present invention;

FIG. 2 is a graph showing the results of measurement of phagocytosis of colloidal beads by BV2 cells in accordance with one embodiment of the present invention;

FIG. 3 shows the results of an experiment for detecting the IL-1. beta. IL-6 and TNF-. alpha.content in cell culture supernatant by ELISA according to an embodiment of the present invention; p <0.05, vs LPS + papaverine;

FIG. 4 shows the mRNA expression of iNOS and CD206 in cells detected by qPCR in one embodiment of the present invention; p <0.05, vs LPS + papaverine;

FIG. 5 is a graph showing the results of using omentum damage model to verify the effectiveness of papaverine + paeoniflorin, papaverine + ferulic acid in one embodiment of the present invention; a is slit lamp observation animal eye surface, B is HE staining observation retina pathological result; c is the expression of Iba-1 detected by immunofluorescence.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

Unless otherwise defined, all terms (including technical and scientific terms) used in disclosing the invention are to be interpreted as commonly understood by one of ordinary skill in the art to which this invention belongs. The following definitions serve to better understand the teachings of the present invention by way of further guidance. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

As used herein, the terms "comprising," "including," and "comprising" are synonymous, inclusive or open-ended, and do not exclude additional, unrecited members, elements, or method steps.

The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range, as well as the recited endpoints.

The term "active pharmaceutical ingredient" refers to the active ingredient of the composition. The active pharmaceutical ingredient is typically a chemical substance or a mixture of chemical substances. Such substances are intended to provide pharmacological activity or other direct effects in the diagnosis, cure, mitigation, treatment or prevention of ocular diseases.

As used herein, "topical," "topically applying," and "topically applying" are used interchangeably herein and include applying to the anterior portion of the eye of a subject. Topical application or administration can result in the delivery of the active agent to the eye.

"topical formulation" and "topical pharmaceutical composition" are used interchangeably herein and include formulations suitable for topical application to the eye. Topical formulations may, for example, be used to impart therapeutic benefits to their users.

"formulation" and "composition" are equivalent and refer to a composition of matter suitable for medical use (i.e., to produce a therapeutic effect and having acceptable pharmacokinetic and toxicological properties).

The invention relates to a pharmaceutical composition, the active pharmaceutical ingredients of which comprise papaverine and ferulic acid.

It is readily understood that pharmaceutically acceptable salts of papaverine and ferulic acid are also within the scope of the present application in accordance with the teachings of the present invention. The phrase "pharmaceutically acceptable salt" as used herein refers to a salt of an active compound that has the same pharmacological activity as the active compound and is neither biologically nor otherwise undesirable. Salts may be formed with, for example, organic or inorganic acids. Non-limiting examples of suitable acids include acetic acid, acetylsalicylic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzoic acid, benzenesulfonic acid, bisulfic acid, boric acid, butyric acid, camphoric acid, camphorsulfonic acid, carbonic acid, citric acid, cyclopentanepropionic acid, digluconic acid, dodecylsulfuric acid (dodecyclfic acid), ethanesulfonic acid, formic acid, fumaric acid, glyceric acid, glycerophosphoric acid, glycine, glucoheptonic acid (glucoheptanoic acid), gluconic acid, glutamic acid, glutaric acid, glycolic acid, hemisulfuric acid (hemisulfeic acid), heptanoic acid, hexanoic acid, hippuric acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, hydroxyethanesulfonic acid, lactic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalenesulfonic acid (naphtylnesulfonic acid), naphthoic acid (naphthoic acid), nicotinic acid, nitrous acid, oxalic acid, nicotinic acid, nonanoic acid, phosphoric acid, salicylic acid, and mixtures thereof, Sorbic acid, succinic acid, sulfuric acid, tartaric acid, thiocyanic acid, thioglycolic acid, thiosulfuric acid, toluenesulfonic acid (tosymic acid), undecylenic acid, naturally and synthetically derived amino acids.

Non-limiting examples of base salts include ammonium salts; alkali metal salts, such as sodium and potassium salts; alkaline earth metal salts, such as calcium and magnesium salts; salts with organic bases, such as dicyclohexylamine salts; methyl-D-glucamine; and salts with amino acids such as arginine, lysine, and the like. Alternatively, the basic nitrogen-containing groups may be quaternized with the following agents: lower alkyl halides such as methyl, ethyl, propyl and butyl chlorides, bromides and iodides; dialkyl sulfates such as dimethyl sulfate, diethyl sulfate, dibutyl sulfate, and diamyl sulfate; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; asthmatic halides such as benzyl and phenethyl bromide; and others.

Typical pharmaceutically acceptable salts are, for example, papaverine hydrochloride and the like

In some embodiments, the papaverine is at a concentration of 5 μ g/ml to 15 μ g/ml and the ferulic acid is at a concentration of 5 μ M to 15 μ M.

In some embodiments, the papaverine is present at a concentration of 7 μ g/ml to 13 μ g/ml and the ferulic acid is present at 7 μ M to 13 μ M.

In some embodiments, the papaverine is present at a concentration of 8 μ g/ml to 12 μ g/ml and the ferulic acid is present at 8 μ M to 12 μ M.

In some embodiments, the composition is an ophthalmic composition.

In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

According to the present invention, the compositions of the present invention may optionally comprise one or more agents such as, but not limited to, emulsifiers, wetting agents, tonicity adjusting agents, preservatives, buffers and antioxidants. Tonicity adjusting agents for use in the pharmaceutical compositions of the present invention include, but are not limited to, salts such as sodium acetate, sodium chloride, potassium chloride, mannitol, or glycerol and other pharmaceutically acceptable tonicity adjusting agents. Preservatives for use in the pharmaceutical compositions described herein include, but are not limited to, benzalkonium chloride, chlorobutanol, thimerosal, phenylmercuric acetate, and phenylmercuric nitrate. Various buffers and methods for adjusting the pH that may be used to prepare the pharmaceutical composition include, but are not limited to, acetate buffers, citrate buffers, phosphate buffers, and borate buffers. Similarly, antioxidants for use in pharmaceutical compositions are well known in the art and include, for example, sodium metabisulfite, sodium thiosulfate, acetylcysteine, butylhydroxyanisole, and butylhydroxytoluene. Flavonoids are compounds found in plants, which are well known to have a variety of beneficial biochemical and antioxidant effects.

In some embodiments, the composition is in a form selected from one of a solution, an emulsion, a dispersion, and a suspension.

In some embodiments, the composition is in the form of one selected from the group consisting of a topical cream, a gel, a foam, and a solution in an organic solvent.

In some embodiments, the gel is in the form of one selected from the group consisting of a hydrogel, an organogel, and a xerogel.

The invention also relates to application of the pharmaceutical composition in preparing a medicament for treating nerve damage diseases caused by excessive activation of microglia.

According to yet another aspect of the invention, it also relates to a method of treating a neurodegenerative disease comprising administering to a subject an effective amount of the composition.

The term "subject" as used herein includes all members of the kingdom animalia that are predisposed to the indicated condition. In some aspects, the subject is a mammal (e.g., a mouse, cat, dog, cow, horse, sheep, rabbit, etc.), while in some aspects, the subject is a human.

As used herein, "treating" includes any method of obtaining a beneficial or desired result (including a clinical effect) in a condition in a subject. Beneficial or desired clinical effects may include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilization (i.e., not worsening) of disease state, delay or slowing of disease progression, amelioration, reduction of disease recurrence. Treatment can prevent disease; relieving symptoms of the disease, removing the root cause of the disease completely or partially, shortening the duration of the disease, or a combination thereof.

The phrase "effective amount". As used herein, means that the amount of a compound or composition within the scope of reasonable medical adjustment is large enough to significantly effectively alleviate the symptoms or conditions being treated, but small enough to avoid serious side effects (at a reasonable benefit/risk ratio). The safe and effective amounts of the active ingredients in the pharmaceutical compositions used in the methods of the present invention will vary with the particular condition being treated, the age and physical condition of the patient being treated, the severity of the disease, the time of treatment, the concurrent condition, the particular active ingredient employed, the particular pharmaceutically acceptable excipient employed and such factors including the knowledge and skill of the attending physician.

In some embodiments, the nerve damage disease is an ocular nerve damage, in particular a retinal damage.

In some embodiments, the nerve damage disease comprises glaucoma, parkinson's disease, alzheimer's disease, macular degeneration, optic nerve contusion.

Embodiments of the present invention will be described in detail with reference to examples.

The main reagents and instruments used in the following examples are shown in the following table.

Name (R)	Brand	Model/goods number
			Interleukin-1 beta (IL-1 beta) test kit	Build up in Nanjing	H002
Interleukin-6 (IL-6) test kit	Build up in Nanjing	H007
			Tumor necrosis factor-alpha (TNF-alpha) test kit	Build up in Nanjing	H052
LPS	Solaibao	L8880
			DMEM medium	gibco	C11885500BT
Papaverine	Northeast pharmaceutical group	120901-1
			Paeoniflorin	MERCK	75603
Ferulic acid	China Institute for food and drug control	537-98-4
			Melatonin	MERCK	M5250
Apigenin	MERCK	SMB00702
			Microscope	canon	126281
Fluorescent glue bead	Thermo Fisher Scientific	F8803
			HE dyeing suit	MDL	/
Full-automatic dehydrator	Leica	ASP200S
			Paraffin slicer	Leica	RM2235
Baking sheet table	Leica	HI1220
			Water bath tub	Leica	HI1220
Heating paraffin embedding system	Leica	G1150 H
			Xylene	Chinese medicine	/
Anhydrous alcohol	Chinese medicine	/
			Citrate buffer Citrate (pH6.0)	China fir gold bridge	ZLI-9064
PBS phosphate buffer (pH7.2-7.4)	China fir gold bridge	ZLI-9061

Example 1

Papaverine concentration screening

Experimental procedure

1) BV2 cell culture

BV2 cells at 37 ℃ with 5% CO₂Culturing in an incubator, wherein the culture solution is a DMED culture solution containing 10% FBS and 100U/mL penicillin/streptomycin double antibody. Well-grown cells were seeded in 12-well cell culture plates (5.6X 10)⁵one/mL) for use.

2) Adding 10ng/ml LPS into LPS group (1 group) to treat for 12h to induce BV2 cell inflammatory reaction;

3) papaverine (0. mu.M, 0.4. mu.g/ml, 2. mu.g/ml, 10. mu.g/ml) was added at various concentrations for treatment for 4 hours.

4) The ratio of 1:2000 (cells: microspheres), 0.5um fluorescent microspheres were added to the medium, incubated at 37 ℃ for 15 minutes, and rinsed 3 times with PBS.

5) DAPI stains the nucleus, and the phagocytosis of the colloidal beads by the cells is observed under a fluorescence microscope.

6) And detecting the fluorescence intensity of the gel beads by using a flow cytometer, and analyzing phagocytosis of the cells.

Results of the experiment

The results of the flow cytometry detection of phagocytosis (fluorescent gel bead fluorescence positive cell ratio) of each group of cells are shown in fig. 1, and the phagocytosis of gel beads by cells is shown in fig. 2.

And (4) conclusion: after stimulation by LPS, the phagocytosis of the fluorescent gel beads by BV2 cells is obviously enhanced, and papaverine treatment can reduce the phagocytic capacity of BV2 cells and present a dose effect, and can achieve the inhibition level basically the same as that of a normal group at 10 mu g/ml.

Example 2

And (5) screening drug combinations.

1. Experiment grouping

1)LPS

2) LPS + papaverine (10. mu.g/ml)

3) LPS + papaverine (10. mu.g/ml) + paeoniflorin (200. mu.M)

4) LPS + papaverine (10. mu.g/ml) + Ferulic acid (10. mu.M)

5) LPS + papaverine (10. mu.g/ml) + melatonin (10. mu.M)

6) LPS + papaverine (10. mu.g/ml) + apigenin (30. mu.M)

2. Experimental procedure

1) BV2 cell culture

BV2 cells at 37 ℃ with 5% CO₂Culturing in an incubator, wherein the culture solution is a DMED culture solution containing 10% FBS and 100U/mL penicillin/streptomycin double antibody. Well-grown cells were seeded in 12-well cell culture plates (5.6X 10)⁵one/mL) for use.

2) Adding 10ng/ml LPS into LPS group (1 group) to treat for 12h to induce BV2 cell inflammatory reaction;

3) adding components with corresponding working concentrations except LPS into the 2-6 groups for treatment for 4 hours; 1 group was treated with an equal amount of PBS for 4 hours;

4) cells and cell culture supernatants were collected.

5) Detection was performed according to kit instructions.

3. Results of the experiment

1) The ELISA detects the content of IL-1 beta, IL-6 and TNF-alpha in the culture supernatant of BV2 cells, and the experimental result is shown in figure 3.

2) qPCR was used to detect the expression of iNOS and CD206 in BV2 cells using the primers shown in the following table:

encoding proteins	Forward primer	Reverse primer
			iNOS	GAAGAAAACCCCTTGTGCTG	GTCGATGTCACATGCAGCTT
CD206	CTTCGGGCCTTTGGAATA	TAGAAGAGCCCTTGGGTTGA

The results of the experiment are shown in FIG. 4.

In this example, the concentrations of paeoniflorin, ferulic acid, melatonin, and apigenin were all effective on BV2 cells reported in the prior art. Among them, melatonin (Journal of Molecular Neuroscience, 2020-03-28, Juan gaoet. al.) and apigenin (apigenin inhibition study on microglial activation, international psychiatric Neuroscience impurities, volume 33 in 2017, xu flood, etc.) have been reported to be able to inhibit the overactivation of microglia, but the applicant found that unlike paeoniflorin and ferulic acid, both of them could not cooperate with papaverine to achieve further synergistic effect to further promote the reduction of IL-1 β, IL-6 and TNF- α contents, or promote the further reduction of iNOS expression level, and further increase of CD206 expression level. In other words, due to the complexity of intracellular signaling pathways, agents that do not have inhibitory effects on BV2 cell overactivation alone may be compounded for use.

Example 3

Animal model verifies the effectiveness of papaverine, paeoniflorin, papaverine and ferulic acid.

Experimental procedure

1. Model for preparing retina injury caused by unilateral optic nerve cutting of rat through operation

A optic nerve crush injury model is established by adopting a left eye optic nerve clamping method according to an animal experiment standard published by ' medical experiment zoology ' 2008 edition of people's health publishing house written in Qinchuan. Rats to be molded are dropped with 0.25% chloramphenicol eye drops 3 days before molding, 3 times a day. During molding, 3.5% chloral hydrate is used for right lower abdominal cavity injection anesthesia, and 1% proparacaine hydrochloride is used for surface anesthesia on the left eye of the rat. After anaesthesia, the rat was fixed on an animal operating table, the bulbar conjunctiva was cut circularly along the temporal limbus of the left eye, the bulbar conjunctiva and sclera were separated, the rectus abdominis avoided during separation, the posterior rectus muscle was then continued to be separated, the optic nerve was exposed after opening the muscle cone, the optic nerve was clamped at the 2mm position of the retrobulbar optic nerve with the optic nerve clamps of equal clamping force, the clamps were released after 30 seconds, the bulbar conjunctiva was sutured with 8-0 nylon thread, gentamicin sphere was used as subconjunctival injection after the model was made, 0.3% tobramycin eye ointment was applied to the conjunctival sac, and the rat was kept warm to revival. Observing the pupil condition of the modeling eye, and taking the pupil with direct light reflection disappearance and indirect light reflection existence as an experimental animal for successful modeling to be included in the experiment.

Grouping experiments:

1)LPS

2) LPS + papaverine (10. mu.g/ml)

3) LPS + papaverine (10. mu.g/ml) + paeoniflorin (200. mu.M)

4) LPS + papaverine (10. mu.g/ml) + Ferulic acid (10. mu.M)

2. And (3) observing the eye surface of the animal by using slit lamps after operation, and grouping the rats successfully molded into groups to ensure that no less than 8 rats in each group are obtained. And 3-5 drops of the reagent are dripped on the ocular surface of each group after the operation every half hour. The eye surface of the animals was observed with a slit lamp at 8 hours after the operation, and the results are shown in A of FIG. 5.

After the observation is finished, the eyeball is fixed, embedded in paraffin and stained for observation. The method comprises the following specific steps:

embedding in paraffin wax

1) Tissue was harvested and fixed in 4% paraformaldehyde for 24 hours.

2) Dehydrating with 75% alcohol for 4 hr-85% alcohol for 2 hr-90% alcohol for 2 hr-95% alcohol for 1 hr-absolute ethanol for 30 min.

3) Xylene 10 min-wax 1 h-wax dip.

4) And (3) putting the melted wax into an embedding frame, taking the tissue out of the dehydration box before wax solidification, putting the tissue into the embedding frame according to the requirements of an embedding surface, cooling the tissue in a freezing table at a temperature of-20 ℃, taking the wax block out of the embedding frame after the wax solidification, and finishing the wax block.

Slicing

1) The trimmed wax block was sliced on a paraffin slicer to a thickness of 4 μm.

2) The slices were floated on a spreading machine at 40 ℃ warm water to flatten the tissue.

3) The tissue was scooped up with a glass slide and placed in a 60 ℃ oven for baking.

4) Baking with water, drying with wax, baking, and storing at room temperature.

Slicing and dewaxing

1) Sections were dewaxed 2 times in xylene (5 min/time).

2) Dehydrated for 5 minutes with anhydrous ethanol.

3) 95% ethanol was hydrated for 2 minutes.

4) 80% ethanol was hydrated for 2 minutes.

5) 70% ethanol was hydrated for 2 minutes.

6) The distilled water was hydrated for 2 minutes.

HE staining

1) Staining with hematoxylin staining solution for 5-10 min.

2) The differentiation fluid was differentiated for 30 seconds.

3) Soaking in tap water for 15 min.

4) The eosin dye solution is placed for 30 seconds to 2 minutes and is washed by tap water.

5) Soaking in tap water for 2-5 min.

6) Dehydrating, and sealing.

7) Observed under a microscope and photographed.

Immunofluorescence detection of expression of Iba-1

1) The tissue fixation, embedding, sectioning and deparaffinization steps were as before.

2) And (5) repairing.

3) The differentiation fluid was differentiated for 30 seconds.

4) PBS buffer, 2min X3 times, and wiping off PBS outside the specimen with filter paper.

5) Blocking serum was added dropwise in a wet box at 37 ℃ for 60 minutes. The blocking solution was wiped off with filter paper without washing.

6) Adding primary antibody with proper concentration dropwise, incubating overnight at 4 ℃ in a wet box, washing out the primary antibody by PBS for 3 minutes multiplied by 5 times, and wiping off PBS outside the specimen by filter paper.

7) The fluorescent secondary antibody is dripped into a wet box at 37 ℃ and is incubated for 1 hour in the dark, the secondary antibody is washed off by PBS for 5 minutes multiplied by 3 times, and the PBS outside the specimen is wiped off by filter paper.

8) DAPI is dripped to the suspension and incubated for 10 minutes in a dark place, and the specimen can be subjected to nuclear display and blue fluorescence. DAPI was washed off 5 minutes × 3 times with PBS, and PBS outside the specimen was wiped off with filter paper.

Mounting, observing under a fluorescence microscope and taking pictures.

Among them, the HE staining results are shown in B of FIG. 5, and the immunofluorescence results are shown in C of FIG. 5.

The experimental results show that a large amount of RGCs of retinas of LPS groups are swollen, irregularly arranged and less clearly layered; the nerve fiber layer is obviously edematous and thickened. Only a small amount of RGCs slightly swollen the retina with a clear gradation, slightly reduced amount, and slightly thinned nerve fiber layer. The two groups of paeoniflorin and ferulic acid are applied, the retina has better obvious recovery effect compared with the group only applying papaverine, and the RGC is arranged regularly, the cytoplasm is rich, and the dyeing is uniform; the nerve fiber layer structure is clear. Therefore, paeoniflorin or ferulic acid can be matched with papaverine to effectively promote the rapid recovery of retinal nerve cells.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the patent of the present invention should be subject to the appended claims, and the description and the drawings can be used for explaining the contents of the claims.