Method for detecting multiple nucleic acids based on CRISPR technology

文档序号：1961408 发布日期：2021-12-14 浏览：22次中文

阅读说明：本技术 基于crispr技术进行多重核酸检测的方法 (Method for detecting multiple nucleic acids based on CRISPR technology ) 是由梁亚峰孙洁刘锐恒于 2021-03-03 设计创作，主要内容包括：本发明提供了基于CRISPR技术进行多重核酸检测的方法,具体地提供了一种基于CRISPR技术检测靶核酸的方法、系统和试剂盒,所述的检测方法包括向含有靶核酸的反应体系中加入第一核酸检测组合物、第二核酸检测组合物、第三核酸检测组合物和第四核酸检测组合物中的任意一种、任意两种、任意三种或四种,以实现对于靶核酸的多重检测。(The invention provides a method, a system and a kit for detecting target nucleic acid based on CRISPR technology, and particularly provides a method, a system and a kit for detecting target nucleic acid based on CRISPR technology.)

1. A method of detecting a target nucleic acid in a sample for non-disease diagnostic purposes, the method comprising contacting the sample with a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid;

the nucleic acid detecting composition is a third nucleic acid detecting composition;

the third nucleic acid detection composition includes Cas12a, a third gRNA that can bind Cas12a and hybridize to a third target sequence on the target nucleic acid, and a third single-stranded nucleic acid detector;

the third single-stranded nucleic acid detector is a single-stranded nucleic acid detector comprising a spacer free of base, the single-stranded nucleic acid detector comprising 1 arbitrary nucleotide and at least 1 spacer free of base, and both ends of the nucleotide are each connected to at least 1 spacer free of base.

2. A method of dual detection of a target nucleic acid in a sample for non-disease diagnostic purposes, the method comprising contacting the sample with a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid;

the nucleic acid detection composition comprises a third nucleic acid detection composition;

the third single-stranded nucleic acid detector is a single-stranded nucleic acid detector comprising a spacer without a base, the single-stranded nucleic acid detector comprising 1 nucleotide and at least 1 spacer without a base, the at least 1 spacer without a base being connected to each end of the nucleotide, and the base of the nucleic acid of the third single-stranded nucleic acid detector is A, G or C;

the nucleic acid detection composition further comprises a fourth nucleic acid detection composition;

the fourth nucleic acid detection composition includes Cas12j, a fourth gRNA that can bind Cas12j and hybridize to a fourth target sequence on the target nucleic acid, and a fourth single-stranded nucleic acid detector;

the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analog, and the nucleic acid analog is 2' oxymethyl RNA.

3. The method of any one of claims 1-2, wherein the detectable signal is detected by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

4. The method of any one of claims 1-2, wherein the target nucleic acid comprises ribonucleotides or deoxyribonucleotides.

5. The method of claim 4, wherein the target nucleic acid comprises a single-stranded nucleic acid, a double-stranded nucleic acid.

6. The method of claim 4, wherein the target nucleic acid comprises single-stranded DNA, double-stranded DNA.

7. The method according to any one of claims 1 to 2, wherein different reporter groups are provided at the 5 'end and the 3' end of the single-stranded nucleic acid detector, respectively; alternatively, different marker molecules are provided at the 5 'end and the 3' end of the single-stranded nucleic acid detector, respectively.

8. The method of any one of claims 1-2, wherein the target nucleic acid is derived from a microbial, soil, water source, human, animal, or plant sample.

9. The method of claim 8, wherein the target nucleic acid is derived from a virus or a bacterium.

10. The method of any one of claims 1-2, wherein the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a disease-related specific nucleic acid, or a control-specific nucleic acid.

11. The method of claim 10, wherein the disease-associated specific nucleic acid is a specific mutation site or SNP site.

12. The method of claim 10, wherein the virus is a plant virus or an animal virus.

13. The method of claim 10, wherein the virus is a papillomavirus, a hepadnavirus, a herpesvirus, an adenovirus, a poxvirus, a parvovirus, or a coronavirus.

14. The method of claim 13, wherein the coronavirus is SARS, SARS-CoV2(COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, or Mers-CoV.

15. The method of any one of claims 1-2, further comprising the step of obtaining nucleic acids from the sample.

16. A system or composition or kit for detecting a target nucleic acid in a sample, the system or composition or kit comprising a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; the nucleic acid detection composition is selected from the group consisting of the nucleic acid detection compositions of any one of claims 1-15.

17. Use of the system or composition of claim 16 in the preparation of a kit for detecting a target nucleic acid in a sample.

18. The system or composition or kit of claim 16, or use of claim 17, wherein the target nucleic acid is derived from a microbial, soil, water source, human, animal, or plant sample.

19. The system or composition or kit of claim 16, or use of claim 17, wherein the target nucleic acid is of viral or bacterial origin.

Technical Field

The invention relates to the field of nucleic acid detection, in particular to a method, a system and a kit for detecting target nucleic acid based on CRISPR technology, and particularly relates to a method for detecting multiple target nucleic acid based on CRISPR technology.

Background

The method for specifically detecting Nucleic acid molecules (Nucleic acid detection) has important application values, such as pathogen detection, genetic disease detection and the like. In the aspect of pathogen detection, each pathogenic microorganism has a unique characteristic nucleic acid molecule sequence, so that nucleic acid molecule detection for a specific species, also called Nucleic Acid Diagnostics (NADs), can be developed, and is important in the fields of food safety, detection of environmental microbial contamination, infection of human pathogenic bacteria, and the like. Another aspect is the detection of Single Nucleotide Polymorphisms (SNPs) in humans or other species. Understanding the relationship between genetic variation and biological functions at the genomic level provides a new perspective for modern molecular biology, and SNPs are closely related to biological functions, evolution, diseases and the like, so the development of detection and analysis techniques of SNPs is particularly important.

The detection of specific nucleic acid molecules established today usually requires two steps, the first step being the amplification of the nucleic acid of interest and the second step being the detection of the nucleic acid of interest. The existing detection technologies include restriction endonuclease methods, Southern, Northern, dot blot, fluorescent PCR detection technologies, LAMP loop-mediated isothermal amplification technologies, recombinase polymerase amplification technologies (RPA) and the like. After 2012, CRISPR gene editing technology arose, a new nucleic acid diagnosis technology (SHERLOCK technology) of targeted RNA with Cas13 as a core was developed by the zhanfeng team based on RPA technology, a diagnosis technology (DETECTR technology) with Cas12 enzyme as a core was developed by the Doudna team, and a new nucleic acid detection technology (HOLMES technology) based on Cas12 was also developed by the royal doctor of the institute of physiology and ecology of plants in the shanghai of the chinese academy of sciences. Nucleic acid detection techniques developed based on CRISPR technology are playing an increasingly important role.

Although the existing nucleic acid detection technologies are numerous, how to detect more quickly, simply, cheaply and accurately is still an important direction for improving the detection technology, and especially how to perform multiple detection on nucleic acid is a problem to be solved urgently.

Disclosure of Invention

The invention provides a method for detecting nucleic acid based on CRISPR technology, in particular to a method, a system and a kit for carrying out multiple detection on nucleic acid.

In one aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid;

the nucleic acid detecting composition is selected from any one, any two, any three or four of a first nucleic acid detecting composition, a second nucleic acid detecting composition, a third nucleic acid detecting composition and a fourth nucleic acid detecting composition;

the first nucleic acid detection composition includes Cas12i, a first gRNA that can bind Cas12i and hybridize to a first target sequence on a target nucleic acid, and a first single-stranded nucleic acid detector;

the second nucleic acid detection composition includes Cas12b, a second gRNA that can bind Cas12b and hybridize to a second target sequence on the target nucleic acid, and a second single-stranded nucleic acid detector;

The first single-stranded nucleic acid detector comprises at least two continuous nucleotides, wherein the nucleotides are one or more of ribonucleotides, deoxyribonucleotides and nucleic acid analogues; the base of the ribonucleotide is selected from A, U, C, G, T, I; the base of the deoxyribonucleotide is selected from A, T, C, G, U, I or any of the bases.

Preferably, the nucleic acid of the first single-stranded nucleic acid detector is two continuous nucleotides, and the nucleotides are one or more of ribonucleotides, deoxyribonucleotides and nucleic acid analogues.

The nucleic acid analogs include 2' -fluoro-modifications, 2' oxymethyl-modifications, locked nucleic acids, bridged nucleic acids, morpholino nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threose nucleic acids, arabinose nucleic acids, 2' methoxyacetyl modifications, 2' -amino modifications, 4 ' -thio RNA, and combinations thereof; preferably, the nucleic acid analog is a 2' -fluoro-modified nucleic acid analog.

Further, the base of the ribonucleotide is selected from A, U, C, G, T, I; the base of the deoxyribonucleotide is selected from A, T, C, G, U, I or any of the bases. The base of the nucleic acid analogue is selected from one or any more of A, U, C, G, T, I; preferably, the bases of the nucleic acid analogues are selected from T and/or C.

Preferably, the nucleic acid of the first single-stranded nucleic acid detector is two consecutive deoxyribonucleotides, and the base sequence of the deoxyribonucleotides is TT or CT.

Preferably, the first single stranded nucleic acid detector is two consecutive nucleic acid analogues.

More preferably, the first single-stranded nucleic acid detector is two consecutive 2' -fluoro-modified nucleic acid analogs.

Further, the first single-stranded nucleic acid detector is two consecutive 2' -fluoro-modified T, or a single-stranded nucleic acid composed of 2' -fluoro-modified T and 2' -fluoro-modified C.

The second single-stranded nucleic acid detector is selected from a single-stranded nucleic acid detector comprising a base-free spacer; alternatively, the nucleic acid structure of the second single-stranded nucleic acid detector is a nucleic acid analogue, the nucleic acid analogue is Locked Nucleic Acid (LNA), and the single-stranded nucleic acid detector comprising locked nucleic acid is also described in the Chinese application CN 2020105609327. The base of the locked nucleic acid is selected from one or any more of A, T, C, G, U, I.

The single-stranded nucleic acid detector comprising a base-free spacer comprises at least 1 arbitrary nucleotide and at least 1 base-free spacer; preferably, at least 1 spacer without base is connected to each end of the nucleotide; more preferably, at least 2 base-free spacers are attached to each end of the nucleotide; in a preferred embodiment, the single-stranded nucleic acid detector contains only 1 arbitrary nucleotide.

In one embodiment, the single-stranded nucleic acid detector comprising an abasic spacer comprises at least 2 discrete arbitrary nucleotides having at least 1 abasic spacer attached between them; in one embodiment, between 2 and 20 base-free spacers are attached between any of the discrete nucleotides; preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 base-free spacers.

In one embodiment, the nucleotides are linked at each end with 2-20 base-free spacers; preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 base-free spacers.

In a most preferred embodiment, the single-stranded nucleic acid detector comprising an abasic spacer comprises 1 arbitrary nucleotide, and 2 abasic spacers are attached to both ends of the nucleotide.

The Spacer without base group is one or more of dSpacer, Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, inserted Abasic Site (dSpacer Abasic furan) and rAbasic Site (rSpacer Abasic furan); preferably, the abasic spacer is dspacer (abasic furan).

In the present invention, "dSpacer" is also called abasic site, Tetrahydrofuran (THF) or purine/pyrimidine-free site (apurinic/apyrimidic (ap) site) or a abasic linker, wherein methylene is located at position 1 of 2' -deoxyribose.

dSpacers are well known in the art as base-free spacers, for example, dSpacers are disclosed in U.S. Pat. No.4, 8153772, 2. The dSpacer is not only very similar in structure to the native site, but is also quite stable. The structure is as follows:

the dSpacer, when attached to a nucleotide, may form the following structure:

preferably, the nucleotides are ribonucleotides and/or deoxyribonucleotides; the base of the ribonucleotide is selected from A, U, C, G, T, I; the base of the deoxyribonucleotide is selected from A, T, C, G, I, U or any of the bases.

Further, the nucleotide is a deoxyribonucleotide; the base of the deoxyribonucleotide is selected from A, T, G or any of the bases.

The third single-stranded nucleic acid detector is a single-stranded nucleic acid detector comprising a base-free spacer; the single-stranded nucleic acid detector comprising a base-free spacer comprises at least 1 arbitrary nucleotide and at least 1 base-free spacer; preferably, at least 1 spacer without base is connected to each end of the nucleotide; more preferably, at least 2 base-free spacers are attached to each end of the nucleotide; in a preferred embodiment, the single-stranded nucleic acid detector contains only 1 arbitrary nucleotide.

In one embodiment, the nucleotides are linked at each end with 2-20 base-free spacers; preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 base-free spacers.

The abasic spacer is dSpacer (abasic furan).

Preferably, the nucleotides are ribonucleotides and/or deoxyribonucleotides; the base of the ribonucleotide is selected from A, U, C, G, T, I; the base of the deoxyribonucleotide is selected from A, T, C, G, I, U or any of the bases.

The fourth single-stranded nucleic acid detector is selected from single-stranded nucleic acid detectors comprising a base-free spacer; or the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analogue, the nucleic acid analogue is 2 'oxymethyl RNA, and the basic group of the 2' oxymethyl RNA is selected from one or more of A, T, U, C, G, I.

In one embodiment, the nucleotides are linked at each end with 2-20 base-free spacers; preferably, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 base-free spacers.

The abasic spacer is dSpacer (abasic furan).

The nucleotide is ribonucleotide and/or deoxyribonucleotide; the base of the ribonucleotide is selected from A, U, C, G, T, I; the base of the deoxyribonucleotide is selected from A, T, C, G, I, U or any of the bases.

Further, the nucleotide is a deoxyribonucleotide; the base of the deoxyribonucleotide is T.

In the present invention, the Cas12i can specifically cleave the first single-stranded nucleic acid detector compared to other Cas proteins, thereby generating a first detectable signal; the Cas12b can specifically cleave the second single-stranded nucleic acid detector compared to other Cas proteins, thereby generating a second detectable signal; the Cas12a can specifically cleave the third single-stranded nucleic acid detector compared to other Cas proteins, thereby generating a third detectable signal; the Cas12j can specifically cleave the fourth single-stranded nucleic acid detector compared to other Cas proteins, thereby generating a fourth detectable signal.

The specific cleavage means that a certain protein has higher cleavage efficiency and exhibits a better detectable signal than other proteins with respect to a single-stranded nucleic acid detector to which the protein is directed.

The detectable signal is achieved by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal-based detection, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, detection based on fluorescence signals, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In a preferred embodiment, the first detectable signal, the second detectable signal, the third detectable signal and the fourth detectable signal are different detectable signals from each other.

Preferably, the single-stranded nucleic acid detector has a fluorescent group and a quencher group disposed at both ends thereof, respectively, and can exhibit a detectable fluorescent signal when the single-stranded nucleic acid detector is cleaved. The fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the first single-stranded nucleic acid detector, the second single-stranded nucleic acid detector, the third single-stranded nucleic acid detector and the fourth single-stranded nucleic acid detector are respectively provided with a first fluorescent group, a first quenching group, a second fluorescent group, a second quenching group, a third fluorescent group, a third quenching group, a fourth fluorescent group and a fourth quenching group at two ends; the first fluorophore, the second fluorophore, the third fluorophore and the fourth fluorophore may be the same or different fluorophores from each other; the first quencher, the second quencher, the third quencher and the fourth quencher may be the same or different quenchers from each other.

In other embodiments, different labeled molecules are respectively disposed at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and the results of the colloidal gold test before and after cleavage by the Cas protein of the single-stranded nucleic acid detector are detected by means of colloidal gold detection; the single-stranded nucleic acid detector shows different color development results on a colloidal gold detection line and a quality control line before and after being cut by the Cas protein.

In the present invention, the first target sequence, the second target sequence, the third target sequence and the fourth target sequence may be the same target sequence or different target sequences.

The first target sequence, the second target sequence, the third target sequence and the fourth target sequence are selected by those skilled in the art to be identical, different or partially identical according to actual needs.

Preferably, the target sequences are different from each other, and thus the method for detecting a target nucleic acid of the present invention can realize multiplex detection of a nucleic acid in a sample; in one embodiment, the first, second, third, and fourth target sequences can be target sequences designed for the same target nucleic acid or different sites of the same gene, or target sequences designed for different target nucleic acids or different genes. In one embodiment, different target sequences may be designed for a particular bacterial, viral or disease-associated nucleic acid; in other embodiments, different target sequences may be designed for different species of bacterial, viral or disease-associated nucleic acids.

In one embodiment, the first nucleic acid detection composition can be used in combination with any of the second, third, or fourth nucleic acid detection compositions to achieve dual detection of the target nucleic acid.

In another embodiment, the second nucleic acid detection composition can be used in combination with either the third nucleic acid detection composition or the fourth nucleic acid detection composition to achieve dual detection of the target nucleic acid; in this embodiment, the nucleic acid structure of the second single stranded nucleic acid detector in the second nucleic acid detecting composition is a nucleic acid analog which is Locked Nucleic Acid (LNA).

In another embodiment, the second nucleic acid detection composition can be used in combination with a fourth nucleic acid detection composition to achieve dual detection of the target nucleic acid; in this embodiment, the second single stranded nucleic acid detector in the second nucleic acid detecting composition is selected from single stranded nucleic acid detectors comprising a spacer without a base, preferably the base of the nucleotide in the second single stranded nucleic acid detector in the second nucleic acid detecting composition is selected from one or more of A, T, G; the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analog, and the nucleic acid analog is 2' oxymethyl RNA; preferably, the base of the 2' oxymethyl RNA is selected from A, T, U, C, G, I.

In another embodiment, a third nucleic acid detection composition can be used in combination with a fourth nucleic acid detection composition to achieve dual detection of a target nucleic acid; in such embodiments, the third single-stranded nucleic acid detector in the third nucleic acid detection composition is selected from a single-stranded nucleic acid detector comprising a base-free spacer; the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analog, and the nucleic acid analog is 2' oxymethyl RNA; preferably, the base of the 2' oxymethyl RNA is selected from A, T, U, C, G, I.

In another embodiment, a combination of the first nucleic acid detecting composition, the second nucleic acid detecting composition, and any one selected from the group consisting of the third nucleic acid detecting composition and the fourth nucleic acid detecting composition can be used to achieve triple detection of the target nucleic acid; in this embodiment, the nucleic acid structure of the second single stranded nucleic acid detector in the second nucleic acid detecting composition is a nucleic acid analog which is Locked Nucleic Acid (LNA).

In another embodiment, triple detection of a target nucleic acid can be achieved using a third nucleic acid detecting composition, a fourth nucleic acid detecting composition, and any combination selected from the group consisting of the first nucleic acid detecting composition and the second nucleic acid detecting composition; in such embodiments, the nucleic acid structure of the second single stranded nucleic acid detector in the second nucleic acid detecting composition is a nucleic acid analog that is Locked Nucleic Acid (LNA); the base of the nucleotide in the third single-stranded nucleic acid detector in the third nucleic acid detecting composition is C; the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analogue, the nucleic acid analogue is 2 'oxymethyl RNA, and the basic group of the 2' oxymethyl RNA is selected from one or more than one of A, T, U, C, G, I.

In other embodiments, the first, second, third, and fourth nucleic acid detection compositions can be used in combination to achieve quadruple detection of a target nucleic acid; in such embodiments, the nucleic acid structure of the second single stranded nucleic acid detector in the second nucleic acid detecting composition is a nucleic acid analog that is Locked Nucleic Acid (LNA); in this embodiment, the base of the nucleotide in the third single-stranded nucleic acid detector in the third nucleic acid detecting composition is C; the nucleic acid structure of the fourth single-stranded nucleic acid detector is a nucleic acid analogue, the nucleic acid analogue is 2 'oxymethyl RNA, and the basic group of the 2' oxymethyl RNA is selected from one or more than one of A, T, U, C, G, I.

For example, when performing a duplex detection using the first nucleic acid detecting composition and the second nucleic acid detecting composition, a different target sequence can be designed for SARS-CoV2(COVID-19) virus, and a duplex detection can be performed for two target nucleic acids of SARS-CoV2 (COVID-19); alternatively, the first and second target sequences may be designed for SARS-CoV2(COVID-19) and SARS virus, respectively, for dual detection of both SARS-CoV2(COVID-19) and SARS virus.

In another aspect, the invention provides a method of multiplex detection of a target nucleic acid in a sample, the method comprising contacting the sample with a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the nucleic acid detecting composition is selected from any one, any two, any three or four of the first nucleic acid detecting composition, the second nucleic acid detecting composition, the third nucleic acid detecting composition and the fourth nucleic acid detecting composition.

In another aspect, the present invention provides a nucleic acid detecting composition selected from any one, any two, any three, or four of the first, second, third, and fourth nucleic acid detecting compositions described above.

In another aspect, the invention also provides a system for detecting a target nucleic acid in a sample, the system comprising a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid; the nucleic acid detecting composition is selected from any one, any two, any three or four of the first nucleic acid detecting composition, the second nucleic acid detecting composition, the third nucleic acid detecting composition and the fourth nucleic acid detecting composition.

In another aspect, the invention also provides a kit for detecting a target nucleic acid in a sample, the kit comprising a nucleic acid detection composition comprising a Cas protein, a gRNA, and a single-stranded nucleic acid detector; the gRNA includes a region that binds to the Cas protein and a guide sequence that hybridizes to a target sequence on a target nucleic acid. The nucleic acid detecting composition is selected from any one, any two, any three or four of the first nucleic acid detecting composition, the second nucleic acid detecting composition, the third nucleic acid detecting composition and the fourth nucleic acid detecting composition.

In another aspect, the invention also provides the use of the above system or kit for detecting a target nucleic acid in a sample. As described above, when the system or the kit of the present invention detects a target nucleic acid in a sample, one or more of the first nucleic acid detecting composition, the second nucleic acid detecting composition, the third nucleic acid detecting composition and the fourth nucleic acid detecting composition may be used to detect the same target sequence, or different target sequences may be used to detect, thereby achieving a double, triple or quadruple detection effect.

In another aspect, the invention also provides the use of a nucleic acid detection composition for detecting a target nucleic acid in a sample, or in the preparation of a system or kit for detecting a target nucleic acid in a sample. The nucleic acid detecting composition is selected from any one, any two, any three or four of the first nucleic acid detecting composition, the second nucleic acid detecting composition, the third nucleic acid detecting composition and the fourth nucleic acid detecting composition.

In the present invention, the target nucleic acid includes ribonucleotide or deoxyribonucleotide, and includes single-stranded nucleic acid, double-stranded nucleic acid, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA.

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein, upon recognition or hybridization to the target nucleic acid, can activate the cleavage activity of single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and thereby generating a detectable signal.

In one embodiment, the target nucleic acid is derived from a sample of a virus, bacterium, microorganism, soil, water source, human, animal, plant, or the like. Preferably, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and the like.

In one embodiment, the method of the invention further comprises the step of obtaining the target nucleic acid from the sample.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant virus or an animal virus, e.g., papilloma virus, hepatic DNA virus, herpes virus, adenovirus, poxvirus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2(COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-CoV.

In some embodiments, the target nucleic acid is derived from a cell, e.g., from a cell lysate.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

In one embodiment, the method further comprises the step of obtaining the target nucleic acid from the sample.

In some embodiments, the target nucleic acid is derived from a cell, e.g., from a cell lysate.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

In the invention, the guide sequence comprises 10-40 bp; preferably, 12-25 bp; preferably, 15-23 bp; preferably, 16-18 bp.

In the present invention, the gRNA has at least 50% match to a target sequence on a target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

In one embodiment, when the target sequence contains one or more characteristic sites (e.g., a particular mutation site or SNP), the characteristic site is a perfect match to the gRNA.

In one embodiment, one or more grnas with targeting sequences different from each other can be included in the detection method, targeting different target sequences.

In one embodiment, the Cas12a is selected from one or any of FnCas12a, assas 12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12 a; the Cas12a is preferably LbCas12a, the amino acid sequence is shown as SEQ ID No.1, or the derivative protein which is formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9or 10) amino acid residues of the amino acid sequence shown as SEQ ID No.1 or an active fragment thereof and has basically the same function.

In other embodiments, the amino acid sequence of Cas12b is as shown in SEQ ID No.2, or a derivative protein formed by substitution, deletion or addition of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.2 or an active fragment thereof, and having substantially the same function.

In other embodiments, the amino acid sequence of Cas12i is as shown in SEQ ID No.3, or a derivative protein formed by substitution, deletion or addition of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.3 or an active fragment thereof, and having substantially the same function.

In other embodiments, the amino acid sequence of Cas12j is as shown in SEQ ID No.4, or a derivative protein formed by substituting, deleting or adding one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9or 10) amino acid residues of the amino acid sequence shown in SEQ ID No.4 or an active fragment thereof, and having substantially the same function.

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence of 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such an alignment can be determined by using, for example, the identity of the amino acid sequences by conventional methods, as taught by, for example, Smith and Waterman,1981, adv.Appl.Math.2:482Pearson & Lip man,1988, Proc.Natl.Acad.Sci.USA 85:2444, Thompson et al, 1994, Nucleic Acids Res 22:467380, etc., by computerized operational algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisco nsin Genetics software package). The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.nc bi. nlm. nih. gov /), can also be used, determined using default parameters.

As used herein, the "CRISPR" refers to Clustered, regularly interspaced short palindromic repeats (Clustered regular interspersed short palindromic repeats) derived from the immune system of a microorganism.

As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with extremely high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin to avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to a protein (such as an antibody) by a covalent bond, and an avidin molecule bonded to an enzyme reacts with a biotin molecule bonded to a specific antibody, so that not only is a multi-stage amplification effect achieved, but also color is developed due to the catalytic effect of the enzyme when the enzyme meets a corresponding substrate, and the purpose of detecting an unknown antigen (or antibody) molecule is achieved.

Nucleic acid analogs

As used herein, "nucleic acid analogs" include, but are not limited to: 2' Oxomethyl (-OCH)₃) RNA, locked nucleic acids, bridged nucleic acids, morpholino nucleic acids, ethylene glycol nucleic acids, hexitol nucleic acids, threose nucleic acids, arabinose nucleic acids, 2 'methoxyacetyl RNA, 2' -fluoro (-F) RNA, 2 '-amino RNA, 4' -thio RNA, and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

Locked Nucleic Acid (LNA): LNA is a 2' modified nucleoside comprising a diradical of C2 ' and C4 ' that links the ribose ring of the nucleoside, which restricts or locks the conformation of the ribose ring, and whose formula is shown below, the bases of LNA can be selected from adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil.

2 'O-Methyl RNA (2' O-Methyl RNA, 2 'O-Methyl, 2' -O-Methyl substituted RNA, -OCH₃): 2' oxymethyl RNA is a 2' modified nucleoside having a methoxy (-OCH) group attached at the C2 ' position of the ribose ring of the nucleoside₃). The 2 '-oxymethylRNA monomer structure is shown below, and the base of the 2' -oxymethylRNA can be selected from the group consisting of adenine, cytosine, guanine, 5-Methyl-cytosine, thymine and uracil.

2 '-fluoro-modified nucleic acid analogs, otherwise known as 2' -fluoro RNAs, are 2 'modified nucleosides that have a F (-F) attached at the C2' position of the ribose sugar ring of the nucleoside. The structure of the 2 '-fluoro RNA monomer is shown below, and the base of the 2' -fluoro RNA can be selected from adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil.

Spacer without base

As used herein, "Spacer-free" refers to a nucleoside that does not contain specific coding information. The abasic spacer may be associated with the oligonucleotide, including the 3 'and 5' ends, or within the nucleotide chain. Common spacers include: dSpacer (abacic furan), Spacer C3, Spacer C6, Spacer C12, Spacer9, Spacer12, Spacer18, inserted Abasic Site (dSpacer Abasic furan) and rAbasic Site (rSpacer Abasic furan).

Such abasic spacers are well known in the art and are disclosed, for example, in U.S. Pat. No.4, 8153772, 2 to dSpacer, Spacer9, Spacer18, Spacer C3; chinese patent application CN101454451A discloses dSpacer.

Preferred herein are the abasic spacers "dspacers" also known as abasic sites, Tetrahydrofuran (THF) or apurinic/apyrimidic (ap) sites, or abasic linkers, wherein the methylene group is located at the 1-position of the 2' -deoxyribose. The dSpacer is not only very similar in structure to the native site, but is also quite stable. The structure is as follows:

the dSpacer, when in nucleotide linkage, may form the following structure:

target nucleic acid

As used herein, the "target nucleic acid" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested). The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single-celled organisms such as bacteria, yeasts, protozoa and amoebae and the like, multicellular organisms (e.g. plants or animals, including samples from healthy or superficially healthy human subjects or human patients affected by a condition or disease to be diagnosed or investigated, e.g. infection by a pathogenic microorganism such as a pathogenic bacterium or virus). For example, the biological sample may be a biological fluid obtained from, for example, blood, plasma, serum, urine, feces, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous humor, or any bodily secretion, exudate (e.g., obtained from an abscess or any other site of infection or inflammation), or a fluid obtained from a joint (e.g., a normal joint or a joint affected by a disease, such as rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab of a skin or mucosal surface. The sample may also be a sample obtained from any organ or tissue (including biopsies or autopsy specimens, e.g., tumor biopsies) or may comprise cells (primary cells or cultured cells) or culture medium conditioned by any cell, tissue or organ. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cytocentrifuge preparations, cytological smears, bodily fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc.), tissue biopsies (e.g., tumor biopsies), fine needle aspirates, and/or tissue sections (e.g., cryostat tissue sections and/or paraffin-embedded tissue sections).

In other embodiments, the biological sample may be a plant cell, callus, tissue or organ (e.g., root, stem, leaf, flower, seed, fruit), and the like.

In the present invention, the target nucleic acid also includes a DNA molecule formed by reverse transcription of RNA, and further, the target nucleic acid can be amplified by a technique known in the art, such as isothermal amplification techniques, such as nucleic acid sequencing-based amplification (NASBA), Recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), Strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), or Nicking Enzyme Amplification (NEAR), and non-isothermal amplification techniques. In certain exemplary embodiments, non-isothermal amplification methods may be used, including, but not limited to, PCR, Multiple Displacement Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or derivative amplification methods (RAM).

Further, the detection method of the present invention further comprises a step of amplifying the target nucleic acid; the detection system further comprises a reagent for amplifying the target nucleic acid. The reagents for amplification include one or more of the following: DNA polymerase, strand displacing enzyme, helicase, recombinase, single-strand binding protein, and the like.

Cas protein

As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein, which upon binding to a signature sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein). When the Cas protein is combined with the characteristic sequence, the protein can induce the trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence. The Cas protein recognizes the characteristic sequence by recognizing PAM (protospacer adjacenttoment motif) adjacent to the characteristic sequence.

The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of the gRNA.

The Cas protein provided by the invention comprises V-type CRISPR/CAS effector proteins, including protein families such as Cas12 and Cas 14. Preferably, e.g., Cas12 proteins, e.g., Cas12a, Cas12b, Cas12i, Cas12 j; preferably, the Cas protein is Cas12a, Cas12b, Cas12i, Cas12 j; the Cas14 protein family includes Cas14a, Cas14b, and the like.

In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, may be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satrapia, legionella, treponema, Proteus, eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flavivivola, Flavobacterium, Azospirillum, Sphaerochaeta, gluconacetobacter, Neisseria, Rochelia, Parvibaculum, Staphylococcus, Nitrarefactor, Mycoplasma, Campylobacter, and Muspirillum.

In one embodiment, the Cas protein is selected from the group consisting of proteins consisting of:

(1) proteins shown as SEQ ID No. 1-4;

(2) derived proteins which are formed by substituting, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9or 10) amino acid residues in the amino acid sequences shown in SEQ ID No.1-4 or active fragments thereof and have basically the same functions.

In one embodiment, the Cas protein further includes proteins having 50%, preferably 55%, preferably 60%, preferably 65%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95%, sequence identity to the above sequences and having trans activity.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be, for example, of the plasmid, virus, cosmid, phage, etc. type, which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.

gRNA

As used herein, the "gRNA" is also referred to as guide RNA or guide RNA and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, a direct repeat and a guide sequence (guide sequence). grnas may include crRNA and tracrRNA or only crRNA depending on Cas protein on which they depend in different CRISPR systems. The crRNA and tracrRNA may be artificially engineered to fuse to form single guide RNA (sgRNA). In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to the target sequence (the signature sequence described in the present invention) to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%, when optimally aligned. Determining the optimal alignment is within the ability of one of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), Bowtie, Geneius, Biopython, and SeqMan.

The gRNA of the invention can be natural, and can also be artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention comprises different reporter groups or marker molecules at both ends, and exhibits no reporter signal when in an initial state (i.e., non-cleaved state), and a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., exhibits a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid contains a characteristic sequence to be detected; alternatively, if the detectable difference is not detectable, it indicates that the target nucleic acid does not contain the signature sequence to be detected.

In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to the 5 'end and a second molecule (e.g., biotin) attached to the 3' end. The reaction system containing the single-stranded nucleic acid detector is matched with the flow strip to detect the characteristic sequence (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (side) flow test or a (side) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector may be replaced with each other, or the positions of the molecules may be changed, and the modified form is also included in the present invention as long as the reporting principle is the same as or similar to that of the present invention.

Drawings

FIG. 1. Cas12i specifically cleaves single stranded nucleic acid detectors and shows better detectable signal than other proteins when the single stranded nucleic acid detector has the sequence 5 '6-FAM// T// T// 3' BHQ 1.

FIG. 2 shows that Cas12b specifically cleaves single stranded nucleic acid detectors and exhibits better detectable signal than other proteins when the single stranded nucleic acid detector is constructed as a nucleic acid analog-locked nucleic acid with a sequence of 5 '6-FAM// LNA _ T// LNA _ T// LNA _ T// LNA _ T// LNA _ T// 3' BHQ 1.

FIG. 3. Cas12a specifically cleaves single stranded nucleic acid detectors and shows better detectable signal than other proteins when the single stranded nucleic acid detector has the sequence 5 '6-FAM/S// S// C// S// S// 3' BHQ 1.

FIG. 4. when the single stranded nucleic acid detector sequence is 5 '6-FAM/S// S// A// S// S// 3' BHQ1, Cas12a and Cas12b are able to specifically cleave the single stranded nucleic acid detector, and show better detectable signal than other proteins, Cas12a shows stronger detectable signal than Cas12 b.

FIG. 5. Cas12a and Cas12j specifically cleave the single stranded nucleic acid detector, showing better detectable signal than other proteins, when the single stranded nucleic acid detector has the sequence 5 '6-FAM/S// S// T// S// S// 3' BHQ 1.

FIG. 6. when the single stranded nucleic acid detector sequence is 5 '6-FAM/S// S// G// S// S// 3' BHQ1, Cas12a and Cas12b are able to specifically cleave the single stranded nucleic acid detector, and show better detectable signal than other proteins, Cas12b shows stronger detectable signal than Cas12 a.

Figure 7. when the single stranded nucleic acid detector is a nucleic acid analog-2' oxymethyl RNA, Cas12j specifically cleaves the single stranded nucleic acid detector and exhibits a better detectable signal than other proteins.

FIG. 8 double detection of the N and S genes of COVID-19 virus using Cas12i, Cas12 j: cas12i targets S gene, reporter is FAM-CT-BHQ1, cas12j targets N gene, reporter is Cy 3-SSTSSS-BHQ 2; when S gene and N gene exist in the sample at the same time, two fluorescence signals can be detected; in the presence of the N gene but not the S gene in the sample, only FAM fluorescence signal corresponding to Cas12i was detected; only Cy3 fluorescence signal corresponding to Cas12j was detected in the presence of the S gene but not the N gene in the sample; the absence of either the S gene or the N gene in the sample was such that neither signal could be detected.

Fig. 9 triplex detection of different target nucleic acids using Cas12a, Cas12b, Cas12 i.

Detailed description of the preferred embodiments

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

The technical scheme of the invention is based on the following principle, the nucleic acid of a sample to be detected is obtained, for example, a target nucleic acid can be obtained by an amplification method, and the gRNA which can be paired with the target nucleic acid is used for guiding the Cas protein to be identified and combined on the target nucleic acid; subsequently, the Cas protein activates the cleavage activity of the single-stranded nucleic acid detector, thereby cleaving the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, and if the single-stranded nucleic acid detector is cut, fluorescence can be excited; in other embodiments, both ends of the single-stranded nucleic acid detector may be provided with a label capable of being detected by colloidal gold.

Example 1 nucleic acid detection Using Cas12i, Cas12j, Cas12a and Cas12b

In this embodiment, different single-stranded nucleic acid assays are designedThe detector detects by using Cas12i, Cas12j, Cas12a and Cas12 b. The different single-stranded nucleic acid detectors are, respectively, single-stranded nucleic acid detector-TT-F, single-stranded nucleic acid detector-LNA, single-stranded nucleic acid detector-SSCSS, single-stranded nucleic acid detector-SSASS, single-stranded nucleic acid detector-SSTSS, single-stranded nucleic acid detector-SSGSS, and single-stranded nucleic acid detector-OCH₃。

Wherein the structure of the single-stranded nucleic acid detector-TT is 5 ' 6-FAM// T// T//3 ' BHQ1, the structure of the single-stranded nucleic acid detector-TT-F is 5 ' 6-FAM// T-F// T-F//3 ' BHQ1 (wherein T-F is T with 2' fluoro group modification to T), the structure of the single-stranded nucleic acid detector-LNA is 5 ' 6-FAM// LNA _ T// LNA _ T// LNA _ T// LNA _ T// LNA _ T//3 ' BHQ1, the structure of the single-stranded nucleic acid detector-SSCSS is 5 ' 6-FAM// S// S// C// S// S//3 ' BHQ1, s is dSpacer, the structure of the single-stranded nucleic acid detector-SSASS is 5 '6-FAM// S// S// A// S// S// 3' BHQ1, S is dSpacer, the structure of the single-stranded nucleic acid detector-SSTSSS is 5 '6-FAM// S// S// T// S// S// 3' BHQ1, S is dSpacer, the structure of the single-stranded nucleic acid detector-SSGSS is 5 '6-FAM// S// S// G// S// S// 3' BHQ1, S is dSpacer, and the structure of the single-stranded nucleic acid detector-OCH₃Has the structure of 5' 6-FAM// T-OCH₃//T-OCH₃//T-OCH₃//T-OCH₃//T-OCH₃// 3' BHQ1 where, T-OCH₃Is a 2' oxymethyl modified T.

Applicants have verified the detection effect of Cas12a (SEQ ID No.1), Cas12b (SEQ ID No.2), Cas12i (SEQ ID No.3) and Cas12j (SEQ ID No.4) when using the above-described nucleic acid detector with no base spacer, the experimental design being as follows:

the sequence of the Cas12i3-g2-ssDNA0 is shown as SEQ ID No. 5;

the sequence of the Cas12j19-g3-ssDNA0 is shown as SEQ ID No. 6;

the sequence of the LbCas12a-TGW6-g1 is shown as SEQ ID No. 7;

the sequence of the AaCas12b-TGW6-g1 is shown as SEQ ID No. 8;

the sequence of the Cas12i3-TGW6-g2 is shown as SEQ ID No. 9;

the sequence of the Cas12j19-TGW6-g3 is shown as SEQ ID No. 10.

The content of each component in the 20 microliter system is as follows:

components	20ul of the system usage amount	Final concentration
			Buffer solution	2ul	1×
100mM DTT	2ul	10mM
			Cas12 of 2uM	0.5ul	50nM
1uM gRNA	1ul	50nM
			100nM ssDNA	1ul	5nM
10uM Single-stranded nucleic acid Detector	0.4ul	200nM
			H2O	Up to 20ul

As shown in fig. 1-7, respectively.

When the probe sequence is TT, Cas12i can specifically cleave the single-stranded nucleic acid detector, showing better detectable signal than other proteins.

When the probe sequence is 5 '6-FAM// T-F// T-F// 3' BHQ1, Cas12i can specifically cleave the single-stranded nucleic acid detector, and shows better detectable signal than other proteins.

In addition, Cas12i was also able to specifically cleave single-stranded nucleic acid detectors and exhibited better detectable signal when the probe sequence was CT (5 '6-FAM// C// T// 3' BHQ1) compared to other Cas proteins.

When the probe is a nucleic acid analogue-Locked Nucleic Acid (LNA), Cas12b specifically cleaves single-stranded nucleic acid detectors and exhibits better detectable signal than other proteins.

When the probe sequence is 5 '6-FAM/S// C// S// 3' BHQ1, Cas12a can specifically cleave the single stranded nucleic acid detector, showing better detectable signal than other proteins.

When the probe sequence is 5 '6-FAM/S// S// A// S// S// 3' BHQ1, Cas12a and Cas12b can specifically cleave the single-stranded nucleic acid detector, and show better detectable signal than other proteins.

When the probe sequence is 5 '6-FAM/S// S// T// S// S// 3' BHQ1, Cas12a and Cas12j can specifically cleave the single-stranded nucleic acid detector, and show better detectable signal than other proteins.

When the probe sequence is 5 '6-FAM/S// S// G// S// S// 3' BHQ1, Cas12a and Cas12b can specifically cleave the single-stranded nucleic acid detector, and show better detectable signal than other proteins, and Cas12b has stronger detectable signal than Cas12 a.

When the probe is a nucleic acid analog-2' oxymethyl RNA, Cas12j can specifically cleave the single-stranded nucleic acid detector, showing better detectable signal than other proteins.

Example 2 Dual detection of COVID-19 Virus Using Cas12i, Cas12j

Double detection of the N and S genes of COVID-19 virus using Cas12i, Cas12 j: cas12i targets the S gene, reporter is 5 '6-FAM// C// T// 3' BHQ1, gRNA sequence is AGAGAAUGUGUGCAUAGUCACACUCAGGAUGUUAACUGCACAG, as shown in SEQ ID No. 11; cas12j targets the N gene, reporter is 5 'Cy 3// S// S// T// S// S// 3' BHQ2, gRNA sequence GUGCUGCUGUCUCCCAGACGGGAGGCAGAACUGCACCGCGACAUUCCGAAGAACGC, as shown in SEQ ID No. 12.

As shown in fig. 8. The result shows that when the S gene and the N gene exist in the sample at the same time, two fluorescence signals can be detected; in the presence of the N gene but not the S gene in the sample, only FAM fluorescence signal corresponding to Cas12i was detected; only Cy3 fluorescence signal corresponding to Cas12j was detected in the presence of the S gene but not the N gene in the sample; neither signal was detectable in the absence of either the S gene or the N gene in the sample.

Example 3 Triplex detection of different target nucleic acids using Cas12a, Cas12b, Cas12i

Triple detection of different target nucleic acids using Cas12a, Cas12b, Cas12 i:

cas12a targets the EV71 VP1 target nucleic acid with the sequence of GTGCACGCAACAAAAGTGAACTCTGCATCAAAGCGCATGT, the single-stranded nucleic acid detector is 5 '6-FAM// A// dS// dS// T// 3' BHQ1 (where dSpacer is a spacer without base), the gRNA is LbCas12a-g71-1, and the sequence of UAAUUUCUACUAAGUGUAGAUAUGCAGAGUUCACUUUUGUUGCG(bold is the position where the gRNA binds to the protein, underlined is the position matching the target nucleic acid sequence);

cas12b targets OsTGW6 target nucleic acid, and the sequence is GATCGTTGGTAGTTCATGCTGCTGTCGGTGAAATAAACATCTCCGGTAAC, the single-stranded nucleic acid detector is 5 'TAMRA// LNA-T// LNA-T// LNA-T// LNA-T// LNA-T// 3' BHQ2 (wherein LNA-T refers to locked nucleic acid with base T), the tracrRNA sequence is GUCUAAAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAACUUCUCAAAAAGAACGCUCGCUCAGUGUUCUGAC, crRNA and the sequence is GUCGGAUCACUGAGCGAGCGAUCUGAGAAGUGGCACuuucaccgacagcagcauga(underlined is the position matching the target nucleic acid sequence);

cas12i targets COVID-19orf1ab target nucleic acid with sequence of Ggcaccaaattccaaaggtttaccttggtaatcatcttcagtaccatactcatattgag, single stranded nucleic acid detector is 5 'HEX// C// T// 3' BHQ1, gRNA is CV19-Lamb-i3g5g with sequence of AGAGAAUGUGUGCAUAGUCACACccaaggUaaaccUUUggaaUUUgg(bold is the position where the gRNA binds to the protein, underlined is the position matching the target nucleic acid sequence).

As in fig. 9, the left side of the figure refers to the added target nucleic acid in the system, indicated by abbreviations for the corresponding enzymes, as "ABI" refers to EV71 VP1 target nucleic acid detected by adding Cas12a (a) protein, OsTGW6 target nucleic acid detected by Cas12B (B) protein, and covi-19 orf1ab target nucleic acid detected by Cas12I (I) protein in the system; the upper side of the figure refers to the fluorescence signal generated by activating the alternative cleavage activity and specifically cleaving the single-stranded nucleic acid detector after the Cas protein in the system recognizes the target nucleic acid, for example, "Cas 12-FAM" refers to that the alternative cleavage activity is activated after the Cas12 protein in the system recognizes the target nucleic acid of EV71 VP1, and the fluorescence intensity of the FAM generated by the specifically cleaving single-stranded nucleic acid detector 5 '6-FAM// A// S// S// T// 3' BHQ1 is stronger as the color is darker.

Specifically, for example, in the first row, when the EV71 VP1 target nucleic acid detected by the Cas12a (a) protein, the OsTGW6 target nucleic acid detected by the Cas12B (B) protein, and the codv-19 orf1ab target nucleic acid detected by the Cas12I (I) protein are added to the system, FAM fluorescence corresponding to Cas12a, TAMRA fluorescence corresponding to Cas12B, and HEX fluorescence corresponding to Cas12I can be detected.

The detection results demonstrate that Cas12a, Cas12b, and Cas12i have different preferences for single-stranded nucleic acid detectors and can be used for detection of triple nucleic acids.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shunheng Biotech Co., Ltd

<120> method for multiplex nucleic acid detection based on CRISPR technology

<130> P2021-2289

<150> CN202010888036.3

<151> 2020-08-28

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1228

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 1

Met Ser Lys Leu Glu Lys Phe Thr Asn Cys Tyr Ser Leu Ser Lys Thr

1 5 10 15

Leu Arg Phe Lys Ala Ile Pro Val Gly Lys Thr Gln Glu Asn Ile Asp

20 25 30

Asn Lys Arg Leu Leu Val Glu Asp Glu Lys Arg Ala Glu Asp Tyr Lys

35 40 45

Gly Val Lys Lys Leu Leu Asp Arg Tyr Tyr Leu Ser Phe Ile Asn Asp

50 55 60

Val Leu His Ser Ile Lys Leu Lys Asn Leu Asn Asn Tyr Ile Ser Leu

65 70 75 80

Phe Arg Lys Lys Thr Arg Thr Glu Lys Glu Asn Lys Glu Leu Glu Asn

85 90 95

Leu Glu Ile Asn Leu Arg Lys Glu Ile Ala Lys Ala Phe Lys Gly Asn

100 105 110

Glu Gly Tyr Lys Ser Leu Phe Lys Lys Asp Ile Ile Glu Thr Ile Leu

115 120 125

Pro Glu Phe Leu Asp Asp Lys Asp Glu Ile Ala Leu Val Asn Ser Phe

130 135 140

Asn Gly Phe Thr Thr Ala Phe Thr Gly Phe Phe Asp Asn Arg Glu Asn

145 150 155 160

Met Phe Ser Glu Glu Ala Lys Ser Thr Ser Ile Ala Phe Arg Cys Ile

165 170 175

Asn Glu Asn Leu Thr Arg Tyr Ile Ser Asn Met Asp Ile Phe Glu Lys

180 185 190

Val Asp Ala Ile Phe Asp Lys His Glu Val Gln Glu Ile Lys Glu Lys

195 200 205

Ile Leu Asn Ser Asp Tyr Asp Val Glu Asp Phe Phe Glu Gly Glu Phe

210 215 220

Phe Asn Phe Val Leu Thr Gln Glu Gly Ile Asp Val Tyr Asn Ala Ile

225 230 235 240

Ile Gly Gly Phe Val Thr Glu Ser Gly Glu Lys Ile Lys Gly Leu Asn

245 250 255

Glu Tyr Ile Asn Leu Tyr Asn Gln Lys Thr Lys Gln Lys Leu Pro Lys

260 265 270

Phe Lys Pro Leu Tyr Lys Gln Val Leu Ser Asp Arg Glu Ser Leu Ser

275 280 285

Phe Tyr Gly Glu Gly Tyr Thr Ser Asp Glu Glu Val Leu Glu Val Phe

290 295 300

Arg Asn Thr Leu Asn Lys Asn Ser Glu Ile Phe Ser Ser Ile Lys Lys

305 310 315 320

Leu Glu Lys Leu Phe Lys Asn Phe Asp Glu Tyr Ser Ser Ala Gly Ile

325 330 335

Phe Val Lys Asn Gly Pro Ala Ile Ser Thr Ile Ser Lys Asp Ile Phe

340 345 350

Gly Glu Trp Asn Val Ile Arg Asp Lys Trp Asn Ala Glu Tyr Asp Asp

355 360 365

Ile His Leu Lys Lys Lys Ala Val Val Thr Glu Lys Tyr Glu Asp Asp

370 375 380

Arg Arg Lys Ser Phe Lys Lys Ile Gly Ser Phe Ser Leu Glu Gln Leu

385 390 395 400

Gln Glu Tyr Ala Asp Ala Asp Leu Ser Val Val Glu Lys Leu Lys Glu

405 410 415

Ile Ile Ile Gln Lys Val Asp Glu Ile Tyr Lys Val Tyr Gly Ser Ser

420 425 430

Glu Lys Leu Phe Asp Ala Asp Phe Val Leu Glu Lys Ser Leu Lys Lys

435 440 445

Asn Asp Ala Val Val Ala Ile Met Lys Asp Leu Leu Asp Ser Val Lys

450 455 460

Ser Phe Glu Asn Tyr Ile Lys Ala Phe Phe Gly Glu Gly Lys Glu Thr

465 470 475 480

Asn Arg Asp Glu Ser Phe Tyr Gly Asp Phe Val Leu Ala Tyr Asp Ile

485 490 495

Leu Leu Lys Val Asp His Ile Tyr Asp Ala Ile Arg Asn Tyr Val Thr

500 505 510

Gln Lys Pro Tyr Ser Lys Asp Lys Phe Lys Leu Tyr Phe Gln Asn Pro

515 520 525

Gln Phe Met Gly Gly Trp Asp Lys Asp Lys Glu Thr Asp Tyr Arg Ala

530 535 540

Thr Ile Leu Arg Tyr Gly Ser Lys Tyr Tyr Leu Ala Ile Met Asp Lys

545 550 555 560

Lys Tyr Ala Lys Cys Leu Gln Lys Ile Asp Lys Asp Asp Val Asn Gly

565 570 575

Asn Tyr Glu Lys Ile Asn Tyr Lys Leu Leu Pro Gly Pro Asn Lys Met

580 585 590

Leu Pro Lys Val Phe Phe Ser Lys Lys Trp Met Ala Tyr Tyr Asn Pro

595 600 605

Ser Glu Asp Ile Gln Lys Ile Tyr Lys Asn Gly Thr Phe Lys Lys Gly

610 615 620

Asp Met Phe Asn Leu Asn Asp Cys His Lys Leu Ile Asp Phe Phe Lys

625 630 635 640

Asp Ser Ile Ser Arg Tyr Pro Lys Trp Ser Asn Ala Tyr Asp Phe Asn

645 650 655

Phe Ser Glu Thr Glu Lys Tyr Lys Asp Ile Ala Gly Phe Tyr Arg Glu

660 665 670

Val Glu Glu Gln Gly Tyr Lys Val Ser Phe Glu Ser Ala Ser Lys Lys

675 680 685

Glu Val Asp Lys Leu Val Glu Glu Gly Lys Leu Tyr Met Phe Gln Ile

690 695 700

Tyr Asn Lys Asp Phe Ser Asp Lys Ser His Gly Thr Pro Asn Leu His

705 710 715 720

Thr Met Tyr Phe Lys Leu Leu Phe Asp Glu Asn Asn His Gly Gln Ile

725 730 735

Arg Leu Ser Gly Gly Ala Glu Leu Phe Met Arg Arg Ala Ser Leu Lys

740 745 750

Lys Glu Glu Leu Val Val His Pro Ala Asn Ser Pro Ile Ala Asn Lys

755 760 765

Asn Pro Asp Asn Pro Lys Lys Thr Thr Thr Leu Ser Tyr Asp Val Tyr

770 775 780

Lys Asp Lys Arg Phe Ser Glu Asp Gln Tyr Glu Leu His Ile Pro Ile

785 790 795 800

Ala Ile Asn Lys Cys Pro Lys Asn Ile Phe Lys Ile Asn Thr Glu Val

805 810 815

Arg Val Leu Leu Lys His Asp Asp Asn Pro Tyr Val Ile Gly Ile Asp

820 825 830

Arg Gly Glu Arg Asn Leu Leu Tyr Ile Val Val Val Asp Gly Lys Gly

835 840 845

Asn Ile Val Glu Gln Tyr Ser Leu Asn Glu Ile Ile Asn Asn Phe Asn

850 855 860

Gly Ile Arg Ile Lys Thr Asp Tyr His Ser Leu Leu Asp Lys Lys Glu

865 870 875 880

Lys Glu Arg Phe Glu Ala Arg Gln Asn Trp Thr Ser Ile Glu Asn Ile

885 890 895

Lys Glu Leu Lys Ala Gly Tyr Ile Ser Gln Val Val His Lys Ile Cys

900 905 910

Glu Leu Val Glu Lys Tyr Asp Ala Val Ile Ala Leu Glu Asp Leu Asn

915 920 925

Ser Gly Phe Lys Asn Ser Arg Val Lys Val Glu Lys Gln Val Tyr Gln

930 935 940

Lys Phe Glu Lys Met Leu Ile Asp Lys Leu Asn Tyr Met Val Asp Lys

945 950 955 960

Lys Ser Asn Pro Cys Ala Thr Gly Gly Ala Leu Lys Gly Tyr Gln Ile

965 970 975

Thr Asn Lys Phe Glu Ser Phe Lys Ser Met Ser Thr Gln Asn Gly Phe

980 985 990

Ile Phe Tyr Ile Pro Ala Trp Leu Thr Ser Lys Ile Asp Pro Ser Thr

995 1000 1005

Gly Phe Val Asn Leu Leu Lys Thr Lys Tyr Thr Ser Ile Ala Asp Ser

1010 1015 1020

Lys Lys Phe Ile Ser Ser Phe Asp Arg Ile Met Tyr Val Pro Glu Glu

1025 1030 1035 1040

Asp Leu Phe Glu Phe Ala Leu Asp Tyr Lys Asn Phe Ser Arg Thr Asp

1045 1050 1055

Ala Asp Tyr Ile Lys Lys Trp Lys Leu Tyr Ser Tyr Gly Asn Arg Ile

1060 1065 1070

Arg Ile Phe Arg Asn Pro Lys Lys Asn Asn Val Phe Asp Trp Glu Glu

1075 1080 1085

Val Cys Leu Thr Ser Ala Tyr Lys Glu Leu Phe Asn Lys Tyr Gly Ile

1090 1095 1100

Asn Tyr Gln Gln Gly Asp Ile Arg Ala Leu Leu Cys Glu Gln Ser Asp

1105 1110 1115 1120

Lys Ala Phe Tyr Ser Ser Phe Met Ala Leu Met Ser Leu Met Leu Gln

1125 1130 1135

Met Arg Asn Ser Ile Thr Gly Arg Thr Asp Val Asp Phe Leu Ile Ser

1140 1145 1150

Pro Val Lys Asn Ser Asp Gly Ile Phe Tyr Asp Ser Arg Asn Tyr Glu

1155 1160 1165

Ala Gln Glu Asn Ala Ile Leu Pro Lys Asn Ala Asp Ala Asn Gly Ala

1170 1175 1180

Tyr Asn Ile Ala Arg Lys Val Leu Trp Ala Ile Gly Gln Phe Lys Lys

1185 1190 1195 1200

Ala Glu Asp Glu Lys Leu Asp Lys Val Lys Ile Ala Ile Ser Asn Lys

1205 1210 1215

Glu Trp Leu Glu Tyr Ala Gln Thr Ser Val Lys His

1220 1225

<210> 2

<211> 1129

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 2

Met Ala Val Lys Ser Ile Lys Val Lys Leu Arg Leu Asp Asp Met Pro

1 5 10 15

Glu Ile Arg Ala Gly Leu Trp Lys Leu His Lys Glu Val Asn Ala Gly

20 25 30

Val Arg Tyr Tyr Thr Glu Trp Leu Ser Leu Leu Arg Gln Glu Asn Leu

35 40 45

Tyr Arg Arg Ser Pro Asn Gly Asp Gly Glu Gln Glu Cys Asp Lys Thr

50 55 60

Ala Glu Glu Cys Lys Ala Glu Leu Leu Glu Arg Leu Arg Ala Arg Gln

65 70 75 80

Val Glu Asn Gly His Arg Gly Pro Ala Gly Ser Asp Asp Glu Leu Leu

85 90 95

Gln Leu Ala Arg Gln Leu Tyr Glu Leu Leu Val Pro Gln Ala Ile Gly

100 105 110

Ala Lys Gly Asp Ala Gln Gln Ile Ala Arg Lys Phe Leu Ser Pro Leu

115 120 125

Ala Asp Lys Asp Ala Val Gly Gly Leu Gly Ile Ala Lys Ala Gly Asn

130 135 140

Lys Pro Arg Trp Val Arg Met Arg Glu Ala Gly Glu Pro Gly Trp Glu

145 150 155 160

Glu Glu Lys Glu Lys Ala Glu Thr Arg Lys Ser Ala Asp Arg Thr Ala

165 170 175

Asp Val Leu Arg Ala Leu Ala Asp Phe Gly Leu Lys Pro Leu Met Arg

180 185 190

Val Tyr Thr Asp Ser Glu Met Ser Ser Val Glu Trp Lys Pro Leu Arg

195 200 205

Lys Gly Gln Ala Val Arg Thr Trp Asp Arg Asp Met Phe Gln Gln Ala

210 215 220

Ile Glu Arg Met Met Ser Trp Glu Ser Trp Asn Gln Arg Val Gly Gln

225 230 235 240

Glu Tyr Ala Lys Leu Val Glu Gln Lys Asn Arg Phe Glu Gln Lys Asn

245 250 255

Phe Val Gly Gln Glu His Leu Val His Leu Val Asn Gln Leu Gln Gln

260 265 270

Asp Met Lys Glu Ala Ser Pro Gly Leu Glu Ser Lys Glu Gln Thr Ala

275 280 285

His Tyr Val Thr Gly Arg Ala Leu Arg Gly Ser Asp Lys Val Phe Glu

290 295 300

Lys Trp Gly Lys Leu Ala Pro Asp Ala Pro Phe Asp Leu Tyr Asp Ala

305 310 315 320

Glu Ile Lys Asn Val Gln Arg Arg Asn Thr Arg Arg Phe Gly Ser His

325 330 335

Asp Leu Phe Ala Lys Leu Ala Glu Pro Glu Tyr Gln Ala Leu Trp Arg

340 345 350

Glu Asp Ala Ser Phe Leu Thr Arg Tyr Ala Val Tyr Asn Ser Ile Leu

355 360 365

Arg Lys Leu Asn His Ala Lys Met Phe Ala Thr Phe Thr Leu Pro Asp

370 375 380

Ala Thr Ala His Pro Ile Trp Thr Arg Phe Asp Lys Leu Gly Gly Asn

385 390 395 400

Leu His Gln Tyr Thr Phe Leu Phe Asn Glu Phe Gly Glu Arg Arg His

405 410 415

Ala Ile Arg Phe His Lys Leu Leu Lys Val Glu Asn Gly Val Ala Arg

420 425 430

Glu Val Asp Asp Val Thr Val Pro Ile Ser Met Ser Glu Gln Leu Asp

435 440 445

Asn Leu Leu Pro Arg Asp Pro Asn Glu Pro Ile Ala Leu Tyr Phe Arg

450 455 460

Asp Tyr Gly Ala Glu Gln His Phe Thr Gly Glu Phe Gly Gly Ala Lys

465 470 475 480

Ile Gln Cys Arg Arg Asp Gln Leu Ala His Met His Arg Arg Arg Gly

485 490 495

Ala Arg Asp Val Tyr Leu Asn Val Ser Val Arg Val Gln Ser Gln Ser

500 505 510

Glu Ala Arg Gly Glu Arg Arg Pro Pro Tyr Ala Ala Val Phe Arg Leu

515 520 525

Val Gly Asp Asn His Arg Ala Phe Val His Phe Asp Lys Leu Ser Asp

530 535 540

Tyr Leu Ala Glu His Pro Asp Asp Gly Lys Leu Gly Ser Glu Gly Leu

545 550 555 560

Leu Ser Gly Leu Arg Val Met Ser Val Asp Leu Gly Leu Arg Thr Ser

565 570 575

Ala Ser Ile Ser Val Phe Arg Val Ala Arg Lys Asp Glu Leu Lys Pro

580 585 590

Asn Ser Lys Gly Arg Val Pro Phe Phe Phe Pro Ile Lys Gly Asn Asp

595 600 605

Asn Leu Val Ala Val His Glu Arg Ser Gln Leu Leu Lys Leu Pro Gly

610 615 620

Glu Thr Glu Ser Lys Asp Leu Arg Ala Ile Arg Glu Glu Arg Gln Arg

625 630 635 640

Thr Leu Arg Gln Leu Arg Thr Gln Leu Ala Tyr Leu Arg Leu Leu Val

645 650 655

Arg Cys Gly Ser Glu Asp Val Gly Arg Arg Glu Arg Ser Trp Ala Lys

660 665 670

Leu Ile Glu Gln Pro Val Asp Ala Ala Asn His Met Thr Pro Asp Trp

675 680 685

Arg Glu Ala Phe Glu Asn Glu Leu Gln Lys Leu Lys Ser Leu His Gly

690 695 700

Ile Cys Ser Asp Lys Glu Trp Met Asp Ala Val Tyr Glu Ser Val Arg

705 710 715 720

Arg Val Trp Arg His Met Gly Lys Gln Val Arg Asp Trp Arg Lys Asp

725 730 735

Val Arg Ser Gly Glu Arg Pro Lys Ile Arg Gly Tyr Ala Lys Asp Val

740 745 750

Val Gly Gly Asn Ser Ile Glu Gln Ile Glu Tyr Leu Glu Arg Gln Tyr

755 760 765

Lys Phe Leu Lys Ser Trp Ser Phe Phe Gly Lys Val Ser Gly Gln Val

770 775 780

Ile Arg Ala Glu Lys Gly Ser Arg Phe Ala Ile Thr Leu Arg Glu His

785 790 795 800

Ile Asp His Ala Lys Glu Asp Arg Leu Lys Lys Leu Ala Asp Arg Ile

805 810 815

Ile Met Glu Ala Leu Gly Tyr Val Tyr Ala Leu Asp Glu Arg Gly Lys

820 825 830

Gly Lys Trp Val Ala Lys Tyr Pro Pro Cys Gln Leu Ile Leu Leu Glu

835 840 845

Glu Leu Ser Glu Tyr Gln Phe Asn Asn Asp Arg Pro Pro Ser Glu Asn

850 855 860

Asn Gln Leu Met Gln Trp Ser His Arg Gly Val Phe Gln Glu Leu Ile

865 870 875 880

Asn Gln Ala Gln Val His Asp Leu Leu Val Gly Thr Met Tyr Ala Ala

885 890 895

Phe Ser Ser Arg Phe Asp Ala Arg Thr Gly Ala Pro Gly Ile Arg Cys

900 905 910

Arg Arg Val Pro Ala Arg Cys Thr Gln Glu His Asn Pro Glu Pro Phe

915 920 925

Pro Trp Trp Leu Asn Lys Phe Val Val Glu His Thr Leu Asp Ala Cys

930 935 940

Pro Leu Arg Ala Asp Asp Leu Ile Pro Thr Gly Glu Gly Glu Ile Phe

945 950 955 960

Val Ser Pro Phe Ser Ala Glu Glu Gly Asp Phe His Gln Ile His Ala

965 970 975

Asp Leu Asn Ala Ala Gln Asn Leu Gln Gln Arg Leu Trp Ser Asp Phe

980 985 990

Asp Ile Ser Gln Ile Arg Leu Arg Cys Asp Trp Gly Glu Val Asp Gly

995 1000 1005

Glu Leu Val Leu Ile Pro Arg Leu Thr Gly Lys Arg Thr Ala Asp Ser

1010 1015 1020

Tyr Ser Asn Lys Val Phe Tyr Thr Asn Thr Gly Val Thr Tyr Tyr Glu

1025 1030 1035 1040

Arg Glu Arg Gly Lys Lys Arg Arg Lys Val Phe Ala Gln Glu Lys Leu

1045 1050 1055

Ser Glu Glu Glu Ala Glu Leu Leu Val Glu Ala Asp Glu Ala Arg Glu

1060 1065 1070

Lys Ser Val Val Leu Met Arg Asp Pro Ser Gly Ile Ile Asn Arg Gly

1075 1080 1085

Asn Trp Thr Arg Gln Lys Glu Phe Trp Ser Met Val Asn Gln Arg Ile

1090 1095 1100

Glu Gly Tyr Leu Val Lys Gln Ile Arg Ser Arg Val Pro Leu Gln Asp

1105 1110 1115 1120

Ser Ala Cys Glu Asn Thr Gly Asp Ile

1125

<210> 3

<211> 1045

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 3

Met Lys Lys Val Glu Val Ser Arg Pro Tyr Gln Ser Leu Leu Leu Pro

1 5 10 15

Asn His Arg Lys Phe Lys Tyr Leu Asp Glu Thr Trp Asn Ala Tyr Lys

20 25 30

Ser Val Lys Ser Leu Leu His Arg Phe Leu Val Cys Ala Tyr Gly Ala

35 40 45

Val Pro Phe Asn Lys Phe Val Glu Val Val Glu Lys Val Asp Asn Asp

50 55 60

Gln Leu Val Leu Ala Phe Ala Val Arg Leu Phe Arg Leu Val Pro Val

65 70 75 80

Glu Ser Thr Ser Phe Ala Lys Val Asp Lys Ala Asn Leu Ala Lys Ser

85 90 95

Leu Ala Asn His Leu Pro Val Gly Thr Ala Ile Pro Ala Asn Val Gln

100 105 110

Ser Tyr Phe Asp Ser Asn Phe Asp Pro Lys Lys Tyr Met Trp Ile Asp

115 120 125

Cys Ala Trp Glu Ala Asp Arg Leu Ala Arg Glu Met Gly Leu Ser Ala

130 135 140

Ser Gln Phe Ser Glu Tyr Ala Thr Thr Met Leu Trp Glu Asp Trp Leu

145 150 155 160

Pro Leu Asn Lys Asp Asp Val Asn Gly Trp Gly Ser Val Ser Gly Leu

165 170 175

Phe Gly Glu Gly Lys Lys Glu Asp Arg Gln Gln Lys Val Lys Met Leu

180 185 190

Asn Asn Leu Leu Asn Gly Ile Lys Lys Asn Pro Pro Lys Asp Tyr Thr

195 200 205

Gln Tyr Leu Lys Ile Leu Leu Asn Ala Phe Asp Ala Lys Ser His Lys

210 215 220

Glu Ala Val Lys Asn Tyr Lys Gly Asp Ser Thr Gly Arg Thr Ala Ser

225 230 235 240

Tyr Leu Ser Glu Lys Ser Gly Glu Ile Thr Glu Leu Met Leu Glu Gln

245 250 255

Leu Met Ser Asn Ile Gln Arg Asp Ile Gly Asp Lys Gln Lys Glu Ile

260 265 270

Ser Leu Pro Lys Lys Asp Val Val Lys Lys Tyr Leu Glu Ser Glu Ser

275 280 285

Gly Val Pro Tyr Asp Gln Asn Leu Trp Ser Gln Ala Tyr Arg Asn Ala

290 295 300

Ala Ser Ser Ile Lys Lys Thr Asp Thr Arg Asn Phe Asn Ser Thr Leu

305 310 315 320

Glu Lys Phe Lys Asn Glu Val Glu Leu Arg Gly Leu Leu Ser Glu Gly

325 330 335

Asp Asp Val Glu Ile Leu Arg Ser Lys Phe Phe Ser Ser Glu Phe His

340 345 350

Lys Thr Pro Asp Lys Phe Val Ile Lys Pro Glu His Ile Gly Phe Asn

355 360 365

Asn Lys Tyr Asn Val Val Ala Glu Leu Tyr Lys Leu Lys Ala Glu Ala

370 375 380

Thr Asp Phe Glu Ser Ala Phe Ala Thr Val Lys Asp Glu Phe Glu Glu

385 390 395 400

Lys Gly Ile Lys His Pro Ile Lys Asn Ile Leu Glu Tyr Ile Trp Asn

405 410 415

Asn Glu Val Pro Val Glu Lys Trp Gly Arg Val Ala Arg Phe Asn Gln

420 425 430

Ser Glu Glu Lys Leu Leu Arg Ile Lys Ala Asn Pro Thr Val Glu Cys

435 440 445

Asn Gln Gly Met Thr Phe Gly Asn Ser Ala Met Val Gly Glu Val Leu

450 455 460

Arg Ser Asn Tyr Val Ser Lys Lys Gly Ala Leu Val Ser Gly Glu His

465 470 475 480

Gly Gly Arg Leu Ile Gly Gln Asn Asn Met Ile Trp Leu Glu Met Arg

485 490 495

Leu Leu Asn Lys Gly Lys Trp Glu Thr His His Val Pro Thr His Asn

500 505 510

Met Lys Phe Phe Glu Glu Val His Ala Tyr Asn Pro Ser Leu Ala Asp

515 520 525

Ser Val Asn Val Arg Asn Arg Leu Tyr Arg Ser Glu Asp Tyr Thr Gln

530 535 540

Leu Pro Ser Ser Ile Thr Asp Gly Leu Lys Gly Asn Pro Lys Ala Lys

545 550 555 560

Leu Leu Lys Arg Gln His Cys Ala Leu Asn Asn Met Thr Ala Asn Val

565 570 575

Leu Asn Pro Lys Leu Ser Phe Thr Ile Asn Lys Lys Asn Asp Asp Tyr

580 585 590

Thr Val Ile Ile Val His Ser Val Glu Val Ser Lys Pro Arg Arg Glu

595 600 605

Val Leu Val Gly Asp Tyr Leu Val Gly Met Asp Gln Asn Gln Thr Ala

610 615 620

Ser Asn Thr Tyr Ala Val Met Gln Val Val Lys Pro Lys Ser Thr Asp

625 630 635 640

Ala Ile Pro Phe Arg Asn Met Trp Val Arg Phe Val Glu Ser Gly Ser

645 650 655

Ile Glu Ser Arg Thr Leu Asn Ser Arg Gly Glu Tyr Val Asp Gln Leu

660 665 670

Asn His Asp Gly Val Asp Leu Phe Glu Ile Gly Asp Thr Glu Trp Val

675 680 685

Asp Ser Ala Arg Lys Phe Phe Asn Lys Leu Gly Val Lys His Lys Asp

690 695 700

Gly Thr Leu Val Asp Leu Ser Thr Ala Pro Arg Lys Ala Tyr Ala Phe

705 710 715 720

Asn Asn Phe Tyr Phe Lys Thr Met Leu Asn His Leu Arg Ser Asn Glu

725 730 735

Val Asp Leu Thr Leu Leu Arg Asn Glu Ile Leu Arg Val Ala Asn Gly

740 745 750

Arg Phe Ser Pro Met Arg Leu Gly Ser Leu Ser Trp Thr Thr Leu Lys

755 760 765

Ala Leu Gly Ser Phe Lys Ser Leu Val Leu Ser Tyr Phe Asp Arg Leu

770 775 780

Gly Ala Lys Glu Met Val Asp Lys Glu Ala Lys Asp Lys Ser Leu Phe

785 790 795 800

Asp Leu Leu Val Ala Ile Asn Asn Lys Arg Ser Asn Lys Arg Glu Glu

805 810 815

Arg Thr Ser Arg Ile Ala Ser Ser Leu Met Thr Val Ala Gln Lys Tyr

820 825 830

Lys Val Asp Asn Ala Val Val His Val Val Val Glu Gly Asn Leu Ser

835 840 845

Ser Thr Asp Arg Ser Ala Ser Lys Ala His Asn Arg Asn Thr Met Asp

850 855 860

Trp Cys Ser Arg Ala Val Val Lys Lys Leu Glu Asp Met Cys Asn Leu

865 870 875 880

Tyr Gly Phe Asn Ile Lys Gly Val Pro Ala Phe Tyr Thr Ser His Gln

885 890 895

Asp Pro Leu Val His Arg Ala Asp Tyr Asp Asp Pro Lys Pro Ala Leu

900 905 910

Arg Cys Arg Tyr Ser Ser Tyr Ser Arg Ala Asp Phe Ser Lys Trp Gly

915 920 925

Gln Asn Ala Leu Ala Ala Val Val Arg Trp Ala Ser Asn Lys Lys Ser

930 935 940

Asn Thr Cys Tyr Lys Val Gly Ala Val Glu Phe Leu Lys Gln His Gly

945 950 955 960

Leu Phe Ala Asp Lys Lys Leu Thr Val Glu Gln Phe Leu Ser Lys Val

965 970 975

Lys Asp Glu Glu Ile Leu Ile Pro Arg Arg Gly Gly Arg Val Phe Leu

980 985 990

Thr Thr His Arg Leu Leu Ala Glu Ser Thr Phe Val Tyr Leu Asn Gly

995 1000 1005

Val Lys Tyr His Ser Cys Asn Ala Asp Glu Val Ala Ala Val Asn Ile

1010 1015 1020

Cys Leu Asn Asp Trp Val Ile Pro Cys Lys Lys Lys Met Lys Glu Glu

1025 1030 1035 1040

Ser Ser Ala Ser Gly

1045

<210> 4

<211> 908

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 4

Met Pro Ser Tyr Lys Ser Ser Arg Val Leu Val Arg Asp Val Pro Glu

1 5 10 15

Glu Leu Val Asp His Tyr Glu Arg Ser His Arg Val Ala Ala Phe Phe

20 25 30

Met Arg Leu Leu Leu Ala Met Arg Arg Glu Pro Tyr Ser Leu Arg Met

35 40 45

Arg Asp Gly Thr Glu Arg Glu Val Asp Leu Asp Glu Thr Asp Asp Phe

50 55 60

Leu Arg Ser Ala Gly Cys Glu Glu Pro Asp Ala Val Ser Asp Asp Leu

65 70 75 80

Arg Ser Phe Ala Leu Ala Val Leu His Gln Asp Asn Pro Lys Lys Arg

85 90 95

Ala Phe Leu Glu Ser Glu Asn Cys Val Ser Ile Leu Cys Leu Glu Lys

100 105 110

Ser Ala Ser Gly Thr Arg Tyr Tyr Lys Arg Pro Gly Tyr Gln Leu Leu

115 120 125

Lys Lys Ala Ile Glu Glu Glu Trp Gly Trp Asp Lys Phe Glu Ala Ser

130 135 140

Leu Leu Asp Glu Arg Thr Gly Glu Val Ala Glu Lys Phe Ala Ala Leu

145 150 155 160

Ser Met Glu Asp Trp Arg Arg Phe Phe Ala Ala Arg Asp Pro Asp Asp

165 170 175

Leu Gly Arg Glu Leu Leu Lys Thr Asp Thr Arg Glu Gly Met Ala Ala

180 185 190

Ala Leu Arg Leu Arg Glu Arg Gly Val Phe Pro Val Ser Val Pro Glu

195 200 205

His Leu Asp Leu Asp Ser Leu Lys Ala Ala Met Ala Ser Ala Ala Glu

210 215 220

Arg Leu Lys Ser Trp Leu Ala Cys Asn Gln Arg Ala Val Asp Glu Lys

225 230 235 240

Ser Glu Leu Arg Lys Arg Phe Glu Glu Ala Leu Asp Gly Val Asp Pro

245 250 255

Glu Lys Tyr Ala Leu Phe Glu Lys Phe Ala Ala Glu Leu Gln Gln Ala

260 265 270

Asp Tyr Asn Val Thr Lys Lys Leu Val Leu Ala Val Ser Ala Lys Phe

275 280 285

Pro Ala Thr Glu Pro Ser Glu Phe Lys Arg Gly Val Glu Ile Leu Lys

290 295 300

Glu Asp Gly Tyr Lys Pro Leu Trp Glu Asp Phe Arg Glu Leu Gly Phe

305 310 315 320

Val Tyr Leu Ala Glu Arg Lys Trp Glu Arg Arg Arg Gly Gly Ala Ala

325 330 335

Val Thr Leu Cys Asp Ala Asp Asp Ser Pro Ile Lys Val Arg Phe Gly

340 345 350

Leu Thr Gly Arg Gly Arg Lys Phe Val Leu Ser Ala Ala Gly Ser Arg

355 360 365

Phe Leu Ile Thr Val Lys Leu Pro Cys Gly Asp Val Gly Leu Thr Ala

370 375 380

Val Pro Ser Arg Tyr Phe Trp Asn Pro Ser Val Gly Arg Thr Thr Ser

385 390 395 400

Asn Ser Phe Arg Ile Glu Phe Thr Lys Arg Thr Thr Glu Asn Arg Arg

405 410 415

Tyr Val Gly Glu Val Lys Glu Ile Gly Leu Val Arg Gln Arg Gly Arg

420 425 430

Tyr Tyr Phe Phe Ile Asp Tyr Asn Phe Asp Pro Glu Glu Val Ser Asp

435 440 445

Glu Thr Lys Val Gly Arg Ala Phe Phe Arg Ala Pro Leu Asn Glu Ser

450 455 460

Arg Pro Lys Pro Lys Asp Lys Leu Thr Val Met Gly Ile Asp Leu Gly

465 470 475 480

Ile Asn Pro Ala Phe Ala Phe Ala Val Cys Thr Leu Gly Glu Cys Gln

485 490 495

Asp Gly Ile Arg Ser Pro Val Ala Lys Met Glu Asp Val Ser Phe Asp

500 505 510

Ser Thr Gly Leu Arg Gly Gly Ile Gly Ser Gln Lys Leu His Arg Glu

515 520 525

Met His Asn Leu Ser Asp Arg Cys Phe Tyr Gly Ala Arg Tyr Ile Arg

530 535 540

Leu Ser Lys Lys Leu Arg Asp Arg Gly Ala Leu Asn Asp Ile Glu Ala

545 550 555 560

Arg Leu Leu Glu Glu Lys Tyr Ile Pro Gly Phe Arg Ile Val His Ile

565 570 575

Glu Asp Ala Asp Glu Arg Arg Arg Thr Val Gly Arg Thr Val Lys Glu

580 585 590

Ile Lys Gln Glu Tyr Lys Arg Ile Arg His Gln Phe Tyr Leu Arg Tyr

595 600 605

His Thr Ser Lys Arg Asp Arg Thr Glu Leu Ile Ser Ala Glu Tyr Phe

610 615 620

Arg Met Leu Phe Leu Val Lys Asn Leu Arg Asn Leu Leu Lys Ser Trp

625 630 635 640

Asn Arg Tyr His Trp Thr Thr Gly Asp Arg Glu Arg Arg Gly Gly Asn

645 650 655

Pro Asp Glu Leu Lys Ser Tyr Val Arg Tyr Tyr Asn Asn Leu Arg Met

660 665 670

Asp Thr Leu Lys Lys Leu Thr Cys Ala Ile Val Arg Thr Ala Lys Glu

675 680 685

His Gly Ala Thr Leu Val Ala Met Glu Asn Ile Gln Arg Val Asp Arg

690 695 700

Asp Asp Glu Val Lys Arg Arg Lys Glu Asn Ser Leu Leu Ser Leu Trp

705 710 715 720

Ala Pro Gly Met Val Leu Glu Arg Val Glu Gln Glu Leu Lys Asn Glu

725 730 735

Gly Ile Leu Ala Trp Glu Val Asp Pro Arg His Thr Ser Gln Thr Ser

740 745 750

Cys Ile Thr Asp Glu Phe Gly Tyr Arg Ser Leu Val Ala Lys Asp Thr

755 760 765

Phe Tyr Phe Glu Gln Asp Arg Lys Ile His Arg Ile Asp Ala Asp Val

770 775 780

Asn Ala Ala Ile Asn Ile Ala Arg Arg Phe Leu Thr Arg Tyr Arg Ser

785 790 795 800

Leu Thr Gln Leu Trp Ala Ser Leu Leu Asp Asp Gly Arg Tyr Leu Val

805 810 815

Asn Val Thr Arg Gln His Glu Arg Ala Tyr Leu Glu Leu Gln Thr Gly

820 825 830

Ala Pro Ala Ala Thr Leu Asn Pro Thr Ala Glu Ala Ser Tyr Glu Leu

835 840 845

Val Gly Leu Ser Pro Glu Glu Glu Glu Leu Ala Gln Thr Arg Ile Lys

850 855 860

Arg Lys Lys Arg Glu Pro Phe Tyr Arg His Glu Gly Val Trp Leu Thr

865 870 875 880

Arg Glu Lys His Arg Glu Gln Val His Glu Leu Arg Asn Gln Val Leu

885 890 895

Ala Leu Gly Asn Ala Lys Ile Pro Glu Ile Arg Thr

900 905

<210> 5

<211> 50

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gatcgttggt agttcatgct gctgtcggtg aaataaacat ctccggtaac 50

<210> 6

<211> 50

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ccccgccttt tggaccaact cgcatcaatc ccatgtaggc gtcggcgatg 50

<210> 7

<211> 41

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 7

uaauuucuac uaaguguaga uuuucaccga cagcagcaug a 41

<210> 8

<211> 105

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 8

gucuaaagga cagaauuuuu caacgggugu gccaauggcc acuuuccagg uggcaaagcc 60

cguugaacuu caagcgaagu ggcacuuuca ccgacagcag cauga 105

<210> 9

<211> 46

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 9

agagaaugug ugcauaguca cacuuucacc gacagcagca ugaacu 46

<210> 10

<211> 60

<212> RNA

<213> Artificial sequence (artificial sequence)

<400> 10

gugcugcugu cucccagacg ggaggcagaa cugcacggau ugaugcgagu ugguccaaaa 60

<210> 11

<211> 43

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

agagaaugug ugcauaguca cacucaggau guuaacugca cag 43

<210> 12

<211> 56

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

gugcugcugu cucccagacg ggaggcagaa cugcaccgcg acauuccgaa gaacgc 56

42页详细技术资料下载

Method for detecting multiple nucleic acids based on CRISPR technology

相关技术

网友询问留言