Medical application of iridoid glycoside compound

文档序号：262730 发布日期：2021-11-19 浏览：9次中文

阅读说明：本技术 一种环烯醚萜苷化合物的医药用途 (Medical application of iridoid glycoside compound ) 是由黄成钢胡义扬冯琴田小亭李志雄彭景华孙兆林徐洲赵瑜于 2020-05-15 设计创作，主要内容包括：本发明公开一种环烯醚萜苷化合物的医药用途,具体涉及京尼平1-β-D龙胆双糖苷的用途。京尼平1-β-D龙胆双糖苷在体外细胞上显著降低甘油三酯TG及炎症相关基因TNF-α和IL-6的表达；在高脂高糖诱导的非酒精性脂肪肝模型小鼠上降低动物血清ALT和肝脏TG含量；且在体内外均能抑制NLRP3相关基因表达。因此,京尼平1-β-D龙胆双糖苷能够用于制备预防和治疗非酒精性脂肪性肝病药物及其他产品。(The invention discloses medical application of an iridoid glycoside compound, and particularly relates to application of genipin 1-beta-D gentiobioside. Genipin 1-beta-D gentiobioside can obviously reduce the expression of triglyceride TG and inflammation related genes TNF-alpha and IL-6 on in vitro cells; reducing the ALT and TG contents of animal serum on a high-fat high-sugar induced non-alcoholic fatty liver model mouse; and can inhibit the expression of NLRP3 related genes in vitro and in vivo. Therefore, the genipin 1-beta-D gentiobioside can be used for preparing medicines and other products for preventing and treating the non-alcoholic fatty liver disease.)

1. Use of a compound of formula I, or a pharmaceutically acceptable salt, solvate, optically pure isomer, stereoisomer or mixture thereof, for the manufacture of a medicament or nutraceutical or functional food for the prevention or treatment of non-alcoholic fatty liver disease, for the manufacture of an inhibitor of inflammatory corpuscle NLRP3, or for use as an inhibitor of inflammatory corpuscle NLRP3,

R₁is a di-or polysaccharide-based,

R₂is hydrogen, C1-C4 alkyl, substituted C1-C4 alkyl, C2-C4 alkenyl, substituted C2-C4 alkenyl, C2-C4 alkynyl, substituted C2-C4 alkynyl, C6-C10 aryl, substituted C6-C10 aryl, 3-8 membered heteroaryl, substituted CA 3-8 membered heteroaryl, monosaccharide, disaccharide or polysaccharide group,

R₃is COOR₄Or CONHR₄，R₄Is hydrogen, C1-C4 alkyl, substituted C1-C4 alkyl, C2-C4 alkenyl, substituted C2-C4 alkenyl, C2-C4 alkynyl, substituted C2-C4 alkynyl, C6-C10 aryl, substituted C6-C10 aryl, 3-8 membered heteroaryl, substituted 3-8 membered heteroaryl, heterocyclic, substituted heterocyclic.

2. The use according to claim 1, wherein the compound of formula I has the structure shown in formula 2,

R₅is a disaccharide radical.

3. The use according to claim 1, wherein the compound of formula I has the structure shown in formula 2,

4. the use according to claim 1, wherein the compound of formula I is genipin 1-beta-D gentiobioside represented by formula 4,

5. the use according to any one of claims 1 to 4, wherein the non-alcoholic fatty liver disease is selected from: non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, fatty liver fibrosis, fatty liver cirrhosis, and liver cancer.

6. The use of any one of claims 1-4, wherein the compound of formula I reduces hepatic triglyceride levels in a subject with non-alcoholic fatty liver disease.

7. The use of any one of claims 1-4, wherein the compound of formula I inhibits or ameliorates liver inflammation in a subject with non-alcoholic fatty liver disease.

8. The use of any one of claims 1-4, wherein the compound of formula I reduces lipid deposition or reduces hepatic fat activity in the liver of a patient with non-alcoholic fatty liver disease.

9. The use of any one of claims 1-4, wherein the compound of formula I reduces glutamate pyruvate transaminase levels in a patient having non-alcoholic fatty liver disease.

10. The application of a composition containing a compound shown as a formula I, or a pharmaceutically acceptable salt, a solvate, an optical pure isomer, a stereoisomer or a mixture thereof in preparing a medicament or health-care product or functional food for preventing or treating non-alcoholic fatty liver diseases.

Technical Field

The invention belongs to the field of medicines and health-care products, and particularly relates to application of genipin 1-beta-D gentiobioside in preparation of medicines, health-care products and other products for preventing and treating non-alcoholic fatty liver disease (NAFLD).

Background

NAFLD refers to a metabolic Disease with main characteristics of excessive fat deposition in Liver cells caused by excluded alcohol and other definite Liver damage factors, about 1/4 people all over the world suffer from NAFLD, which will become the first chronic Liver Disease in China, but the prevention and treatment of NAFLD lacks ideal therapeutic drugs, and the US FDA has not approved any new drug specially for treating NAFLD to be on the market. Has the advantages of multiple paths and multiple target points. Therefore, the search of monomer micromolecules with NAFLD resistance from traditional Chinese medicines has important clinical significance.

Gardenia (Gardenia jasminoides Ellis.) is a dried mature fruit of Gardenia jasminoides Ellis of Gardenia of Rubiaceae (Rubiaceae) and has effects of clearing pathogenic fire, relieving restlessness, and clearing away heat and toxic materials. The main chemical components of fructus Gardeniae include iridoid, organic acid, flavone, coumarin, volatile oil, saponin, etc., and have effects in protecting liver, promoting bile flow, resisting inflammation, resisting bacteria, tranquilizing mind, etc.

Genipin 1-beta-D-gentiobioside (genipin-1-beta-D-geniobioside) is the main chemical component of the fruit of traditional Chinese medicine gardenia. Genipin 1-beta-D-gentiobioside bisglucoside can resist to pentobarbital sodium-induced heart failure by increasing myocardial contractility and decreasing cardiac load (Chen, L.; Luo, Z.; Peng, G.; Li, X.; Liu, L.; Sheng, X.; Wang, Z.; The cardiac sylic and diene effects of gene-1-beta-D-geniobioside in The experimental heart failure. Pharmacology and Clinics of Chinese Material medicinal, 2013,29(2), 39-41); alleviation of melanin synthesis in B16 mouse melanoma cell lines (kihisa, T.; Watanabe, K.; Yamamoto, A.; Zhang, J.; Matsumoto, M.; Fukatsu, M., Melanogenesis inhibition Activity of Monoterpene carbohydrates from Gardniae Structure 2012,9(8), 1490-1499.); it has also been found to exert therapeutic effects on mouse models of memory impairment by increasing the levels of acetylcholine in the brain (Kwak, J.H.; Lee, D. -U., Structure & ndash; anticancer Activity Relationship of iridium from Gardnia streams chemistry Letters 2015,44(6), 837-839.). However, no literature report about the effect of genipin 1-beta-D-gentiobioside on the non-alcoholic fatty liver disease is reported at present.

Chinese patent application CN104510747A discloses new application of genipin 1-beta-D-gentiobioside and other components in preparing antiviral, antibacterial, antipyretic, antiinflammatory, antioxidant compositions. Can be clinically used for treating virus and bacterial infection diseases such as acute respiratory tract infection, influenza, pneumonia, viral infection of type B, herpes zoster and the like. Chinese patent application CN102000102A discloses the application of genipin gentiobioside in preparing and treating heart failure diseases. Chinese patent application CN106309462.A discloses that genipin 1-beta-D-gentiobioside and a composition have obvious treatment effects on a cerebral ischemia injury model in vivo and in vitro, and long-term toxicity tests of mice and rats show that genipin 1-beta-D-gentiobioside has better safety. However, no patent publication is published on the treatment effect of genipin 1-beta-D-gentiobioside on non-alcoholic fatty liver.

Disclosure of Invention

The invention aims to provide medical application of an iridoid glycoside compound, and particularly relates to application of genipin 1-beta-D gentiobioside.

In a first aspect of the invention, there is provided a compound of formula I, or a pharmaceutically acceptable salt, solvate, optically pure isomer, stereoisomer or mixture thereof, for use in the preparation of a medicament or nutraceutical or functional food for the prevention or treatment of non-alcoholic fatty liver disease, for use in the preparation of an inhibitor of inflammatory corpuscle NLRP3, or for use as an inhibitor of inflammatory corpuscle NLRP3,

R₁is a di-or polysaccharide-based,

R₂is hydrogen, C1-C4 alkyl, substituted C1-C4 alkyl, C2-C4 alkenyl, substituted C2-C4 alkenyl, C2-C4 alkynyl, substituted C2-C4 alkynyl, C6-C10 aryl, substituted C6-C10 aryl, 3-8 membered heteroaryl, substituted 3-8 membered heteroaryl, monosaccharide, disaccharide or polysaccharide,

In another preferred embodiment, the compound of formula I has the structure shown in formula 2,

R₅is a disaccharide radical.

In another preferred embodiment, the compound of formula I has the structure shown in formula 2,

in another preferred embodiment, the compound of the formula I is genipin 1-beta-D gentiobioside shown in formula 4,

in another preferred embodiment, the non-alcoholic fatty liver disease is selected from: non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, fatty liver fibrosis, fatty liver cirrhosis, and liver cancer.

In another preferred embodiment, the compound of formula I reduces hepatic triglyceride levels in a subject with non-alcoholic fatty liver disease.

In another preferred embodiment, the compound of formula I inhibits or ameliorates liver inflammation in a subject with non-alcoholic fatty liver disease.

In another preferred embodiment, the compound of formula I reduces lipid deposition or reduces hepatic fat activity in the liver of a subject with a non-alcoholic fatty liver disease.

In another preferred embodiment, the compound of formula I reduces glutamate pyruvate transaminase levels in a patient suffering from non-alcoholic fatty liver disease.

In a second aspect of the present invention, there is provided a pharmaceutical composition or a nutraceutical or functional food comprising a compound of formula I as described in the first aspect, or a pharmaceutically acceptable salt, solvate, optically pure isomer, stereoisomer or a mixture thereof as an active ingredient.

In another preferred embodiment, the pharmaceutical composition or health product or functional food is used for treating and/or preventing non-alcoholic fatty liver disease, and is selected from: non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, fatty liver fibrosis, fatty liver cirrhosis, and liver cancer.

In another preferred embodiment, the pharmaceutical composition or health product or functional food comprises a pharmaceutically or food acceptable carrier.

In another preferred embodiment, the compound of formula I has a structure as shown in formula 2, formula 3 or formula 4 described above.

In another preferred embodiment, the pharmaceutical composition or health product or functional food does not contain geniposide and genipin.

In a third aspect of the present invention, there is provided a use of a composition comprising a compound of formula I, or a pharmaceutically acceptable salt, solvate, optically pure isomer, stereoisomer or mixture thereof, for preparing a medicament or health product or functional food for preventing or treating non-alcoholic fatty liver disease.

In another preferred embodiment, the non-alcoholic fatty liver disease is selected from: non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, fatty liver fibrosis, fatty liver cirrhosis, and liver cancer.

In another preferred embodiment, the composition, the medicament or the health product or the functional food does not contain geniposide and genipin.

In another preferred embodiment, the compound of formula I has a structure as shown in formula 2, formula 3 or formula 4 described above.

Genipin 1-beta-D gentiobioside can obviously reduce the expression of Triglyceride (TG) and inflammation related genes TNF-alpha and IL-6 on in vitro cells; genipin 1-beta-D gentiobioside can reduce the content of ALT and TG in animal serum in a high-fat high-sugar induced non-alcoholic fatty liver model mouse; genipin 1-beta-D gentiobioside can inhibit NLRP3 related gene expression in vitro and in vivo, and can be used for preparing medicines or health products or functional foods for preventing or treating non-alcoholic fatty liver disease and other products. In addition, genipin 1- β -D gentiobioside is capable of inhibiting inflammatory-corpuscle NLRP3, acting as an inhibitor of inflammatory-corpuscle NLRP 3.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a bar graph showing TG content, TNF-. alpha.mRNA and IL-6mRNA expression levels of HepG2 cells of each group in example 1.

FIG. 2 is a graph showing the results of oil red staining patterns of various groups of HepG2 cells in example 1.

FIG. 3 is a graph of serum ALT levels and hepatic TG content after the experiment in each group of mice in example 2.

FIG. 4 is a graph showing the oil red staining of the liver of each group of mice in example 2.

FIG. 5 is a graph of the effect of genipin 1- β -D gentiobioside of example 3 on free fatty acid-induced hepatocyte AML-12 and high lipid high sugar-induced inflammatory-small-body NLPR3mRNA and protein expression in liver of model mice.

FIG. 6 is a graph of the effect of genipin 1-. beta. -D gentiobioside, geniposide and genipin on HepG2 cell viability in example 4.

Detailed Description

The inventor of the application finds that genipin 1-beta-D gentiobioside can reduce the content of Triglyceride (TG) in liver of a patient with non-alcoholic fatty liver disease through extensive and intensive research; improving liver inflammation of a patient with non-alcoholic fatty liver disease; reducing lipid deposition in the liver of a patient with a non-alcoholic fatty liver disease; reducing glutamic-pyruvic transaminase (ALT) as liver function injury index of non-alcoholic fatty liver disease patients, and can be used for treating non-alcoholic fatty liver disease. On the basis of this, the present invention has been completed.

Term(s) for

In the present invention, unless otherwise specified, the terms used have the ordinary meanings well known to those skilled in the art.

In the present invention, the term "C₁-C₄"means having 1, 2, 3, or 4 carbon atoms. "3-8 membered" means having 3-8 ring atoms, and so on.

In the present invention, the term "alkyl" denotes a saturated linear or branched hydrocarbon moiety, for example the term "C₁-C₄Alkyl "refers to a straight or branched chain alkyl group having 1 to 4 carbon atoms, including, without limitation, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl.

In the present invention, the term "alkenyl" denotes a straight or branched chain hydrocarbon moiety comprising at least one double bond, for example the term "C₂-C₄Alkenyl "means a straight or branched chain alkenyl group having 2 to 4 carbon atoms containing one double bond, including without limitation ethenyl, propenyl, n-butenyl, isobutenyl.

In the present invention, the term "alkynyl" refers to a straight or branched alkynyl group containing one triple bond, and includes, but is not limited to, ethynyl, propynyl, butynyl, isobutynyl, and the like.

In the present invention, the term "aryl" denotes a hydrocarbyl moiety comprising one or more aromatic rings. For example, the term "C₆-C₁₀Aryl "refers to an aromatic ring group having 6 to 10 carbon atoms, such as phenyl, naphthyl, and the like, which does not contain heteroatoms in the ring.

Unless otherwise specified, alkyl, alkenyl, alkynyl, heteroaryl, and aryl groups described herein are substituted and unsubstituted groups, and possible substituents include, but are not limited to: hydroxyl, amino, nitro, nitrile, halogen, C1-C6 alkyl, C2-C10 alkenyl, C2-C10 alkynyl, C3-C20 cycloalkyl, C3-C20 cycloalkenyl, C1-C20 heterocycloalkyl, C1-C20 heterocycloalkenyl, C1-C6 alkoxy, aryl, heteroaryl, heteroaryloxy, C1-C10 alkylamino, C1-C20 dialkylamino, arylamino, diarylamino, C1-C10 alkylsulfamoyl, arylsulfamoyl, C1-C10 alkylimino, C1-C10 alkylsulfamomino, arylsulfonylimino, mercapto, C1-C10 alkylthio, C1-C10 alkylsulfonyl, arylsulfonyl, acylamino, aminoacyl, aminothioacyl, guanidino, ureido, acyl, thioacyl, acyloxy, carboxyl, and carboxylate.

In the invention, the substitution is mono-substitution or multi-substitution, and the multi-substitution is di-substitution, tri-substitution, tetra-substitution or penta-substitution. By disubstituted is meant having two substituents and so on.

The pharmaceutically acceptable salts of the present invention may be salts of anions with positively charged groups on the compounds of formula I. Suitable anions are chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methylsulfonate, trifluoroacetate, acetate, malate, tosylate, tartrate, fumarate, glutamate, glucuronate, lactate, glutarate or maleate. Similarly, salts may be formed from cations with negatively charged groups on the compounds of formula I. Suitable cations include sodium, potassium, magnesium, calcium, and ammonium ions, such as tetramethylammonium.

In another preferred embodiment, "pharmaceutically acceptable salt" refers to a salt of a compound of formula I with an acid selected from the group consisting of: hydrofluoric acid, hydrochloric acid, hydrobromic acid, phosphoric acid, acetic acid, oxalic acid, sulfuric acid, nitric acid, methanesulfonic acid, sulfamic acid, salicylic acid, trifluoromethanesulfonic acid, naphthalenesulfonic acid, maleic acid, citric acid, acetic acid, lactic acid, tartaric acid, succinic acid, oxalic acid, pyruvic acid, malic acid, glutamic acid, p-toluenesulfonic acid, naphthalenesulfonic acid, ethanesulfonic acid, naphthalenedisulfonic acid, malonic acid, fumaric acid, propionic acid, oxalic acid, trifluoroacetic acid, stearic acid, pamoic acid, hydroxymaleic acid, phenylacetic acid, benzoic acid, glutamic acid, ascorbic acid, p-aminobenzenesulfonic acid, 2-acetoxybenzoic acid, isethionic acid and the like; or a sodium, potassium, calcium, aluminum or ammonium salt of a compound of formula I with an inorganic base; or methylamine salt, ethylamine salt or ethanolamine salt formed by the compound in the general formula I and organic base.

Genipin 1-beta-D gentiobioside and application thereof

The invention relates to medical application of iridoid glycoside compounds, in particular to application of genipin 1-beta-D gentiobioside.

Genipin 1-beta-D gentiobioside is an iridoid glycoside extracted from plants such as Gardenia (Gardenia jasminoides Ellis), genipa americana (Genipaamerica) and the like, can also be artificially synthesized or biologically synthesized and has the following structure:

the research shows that the genipin 1-beta-D gentiobioside can be used for treating the non-alcoholic fatty liver disease. Genipin 1-beta-D gentiobioside can reduce the content of Triglyceride (TG) in liver of a patient with non-alcoholic fatty liver disease; improving liver inflammation of a patient with non-alcoholic fatty liver disease; reducing lipid deposition in the liver of a patient with a non-alcoholic fatty liver disease; reduce glutamic-pyruvic transaminase (ALT) as liver function injury index of non-alcoholic fatty liver disease.

In particular, genipin 1-beta-D gentiobioside can obviously reduce Triglyceride (TG) and inflammation related genes TNF-alpha and IL-6 and expression on in vitro cells; genipin 1-beta-D gentiobioside can reduce the content of ALT and TG in animal serum in a high-fat high-sugar induced non-alcoholic fatty liver model mouse, and has a dose dependent relationship; genipin 1-beta-D gentiobioside can inhibit NLRP3 related gene expression in vitro and in vivo, and improve liver inflammation.

Geniposide and genipin are typical iridoid glycoside compounds in traditional Chinese medicine gardenia, and at present, geniposide and geniposide are reported to have certain effects of treating non-alcoholic fatty liver disease. However, the research finds that genipin has obvious hepatotoxicity on HepG2 cells, (IC50 is 0.216mM), and the phenomenon is consistent with the phenomenon that genipin is reported to have hepatotoxicity on liver cells in the literature (Khanal T, Kim HG, Choi JH, Do MT, Kong MJ, Kang MJ, et al.Biotransformation of geniposide by human endogenous microflora on cytotoxin aggit HepG2 cells. toxin. Lett.2012; 209:246-54.), and genipin 1-beta-D-gentiobioside can still maintain good cell viability at the maximum dosage of 2 mM. In addition, the ability of genipin 1-beta-D gentiobioside with equal dose in vivo for reducing serum ALT and liver TG of non-alcoholic fatty liver model animals is better than that of geniposide with equal dose; therefore, the genipin 1-beta-D-gentiobioside has better drug potential for treating the non-alcoholic fatty liver disease than the geniposide and the genipin.

In conclusion, the genipin 1-beta-D gentiobioside has treatment and prevention effects on the nonalcoholic fatty liver disease. Through in vitro cell and in vivo model animal experiments, genipin 1-beta-D gentiobioside has the functions of reducing fat, resisting inflammation and protecting liver, and the anti-inflammatory mechanism of the genipin is related to the inhibition of liver inflammatory corpuscle NLRP 3.

Pharmaceutical composition

The invention also provides a pharmaceutical composition for preparing a medicament or health product or functional food for preventing or treating the non-alcoholic fatty liver disease, which comprises the active ingredient genipin 1-beta-D gentiobioside.

The invention also provides a pharmaceutical composition which comprises the active ingredient genipin 1-beta-D gentiobioside in a safe and effective amount range and a pharmaceutically acceptable carrier, and preferably, the pharmaceutical composition does not contain geniposide and genipin.

"pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances which are suitable for human use and must be of sufficient purity and sufficiently low toxicity. By "compatible" is meant herein that the components of the composition are capable of being combined with the active ingredients of the present invention and with each other without significantly diminishing the efficacy of the active ingredient. Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g., sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), and the like) Wetting agents (e.g., sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like.

The mode of administration of the active ingredient or pharmaceutical composition of the present invention is not particularly limited, and representative modes of administration include (but are not limited to): oral, rectal, parenteral (intravenous, intramuscular, or subcutaneous), and the like.

Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules.

Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly employed in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1, 3-butylene glycol, dimethylformamide and oils, especially cottonseed, groundnut, corn germ, olive, castor and sesame oils or mixtures of such materials and the like. In addition to these inert diluents, the compositions can also contain adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

Suspensions, in addition to the active ingredients, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these materials, and the like.

Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures for which specific conditions are not indicated in the following examples are generally carried out according to conventional conditions (e.g.as described in Sambrook et al, molecular cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989)) or according to the conditions as recommended by the manufacturer. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Example 1:

genipin 1-beta-D-gentiobioside in-vitro anti-inflammatory and lipid-lowering experiment

1. Experiments and methods

1.1 cell culture and administration methods

Human hepatoma cell line HepG2 was inoculated in 6-well plates (density about 1X 10) with DMEM medium containing 10% fetal bovine serum⁵One/ml), placing at 37 deg.C and 5% CO₂And after culturing for 24 hours in an incubator with 95% humidity, dividing the culture medium into a normal control group, a model group and a genipin 1-beta-D gentiobioside group, wherein each group has 4 holes. The normal control group was given DMEM medium, and the model group was added with FFA (oleic acid 0.3 mM: palmitic acid 0.15mM) in DMEM medium; FFA (oleic acid 0.3 mM: palmitic acid 0.15mM) and genipin 1-beta-D gentiobioside (100 mu M) are added into a genipin 1-beta-D gentiobioside group culture medium for co-incubation, and after incubation for 24h, cells are collected.

1.2 determination of TG

Removing the 12-well plate culture medium by suction, (0.5 ml/well) washing with PBS, (200. mu.l/well) digesting with pancreatin for 3 min; diluted to 800. mu.l/well with PBS, each well was blown up, and then the liquid was aspirated into an EP tube,

centrifuging at 3000rpm for 6min, leaving precipitate, adding (0.5 ml/hole) isopropanol, inserting into ice box, adjusting AMPL to 15%, ultrasonically crushing cells, centrifuging at 3000rpm for 15min, taking supernatant, adding into glass tube, leaving precipitate in ice box, wrapping the glass tube with rubber band, placing into beaker, heating over water until completely evaporating isopropanol. After removal, the ice box was quickly inserted and TG was detected using a TG kit.

1.3 preparation and Mass analysis of RNA samples

Removing supernatant after incubation is finished, washing cells twice by using PBS (phosphate buffer solution), washing residual culture medium, adding 1mL of Trizol into each hole, standing for 5-10min, repeatedly blowing till the cells are uniform, and respectively transferring the cells into a new 1.5mL centrifuge tube.

② adding 400 mu L chloroform into each tube, violently oscillating and uniformly mixing for 30s, standing for 3min, and centrifuging under the conditions of 4 ℃, 12000rpm and 10 min.

③ sucking 200. mu.L of the upper aqueous phase, transferring to a new 1.5mL tube, adding 1/2 volumes of absolute ethyl alcohol, and mixing.

Putting the adsorption column into a collecting pipe, transferring the liquid into the adsorption column by using a pipette, standing for 2min, centrifuging at 12000rpm for 3min, and pouring the waste liquid of the collecting pipe.

Fifthly, the adsorption column is put back into the collecting tube, 500 mu LRPE Solution is added, the mixture is kept stand for 2min, the mixture is centrifuged at 1000rpm for 30s, and waste liquid in the collecting tube is poured out.

Sixthly, repeating the step five times.

Seventhly, the adsorption column is placed back into the collection tube and centrifuged for 2min at 10000 rpm.

Eighthly, putting the adsorption column into a new set of 1.5ml centrifuge tube, and adding 60 mul DEPC-treated ddH into the center of the adsorption film₂And O, standing for 5min, centrifuging at 12000rpm for 2min, and measuring and correcting the concentration of the obtained RNA solution by using a microplate reader.

1.4. Reverse transcription

The reverse transcription kit from Bio-RAD was used for the operation. 600ng of RNA was reverse transcribed for each tube, and a 20. mu.L reaction system was constructed. The vector includes 5 XiScript Reaction Mix 4. mu.L, iScript Reverse transcription 1. mu.L, nucleic-free water 5. mu.L and RNAtemp plate 10. mu.L. Reverse transcription conditions were 25 ℃ for 5min (priming), 46 ℃ for 20min (reverse transcription), 95 ℃ for 1min (RT inactivation), and 4 ℃ for storage.

1.5.Real time PCR

The primers are synthesized and provided by bioTNT company, and the specific primer sequences are as follows:

beta-actin gene:

the forward primer is 5'-CATGTACGTTGCTATCCAGGC-3'

The reverse primer is 5'-CTCCTTAATGTCACGCACGAT-3'

TNF-alpha gene:

the forward primer is 5'-GAGGCCAAGCCCTGGTATG-3'

The reverse primer is 5'-CGGGCCGATTGATCTCAGC-3'

IL-6 gene:

the forward primer is 5'-ACTCACCTCTTCAGAACGAATTG-3'

The reverse primer is 5'-CCATCTTTGGAAGGTTCAGGTTG-3'

The PCR reaction was prepared according to the following table, in which SYBR Green was purchased from TAKARA.

Reagent	Amount of the composition used
		SYBRPremix Ex Taq	10μL
PCRForward Primer	2μL
		PCR ReversePrimer	2μL
ROX Reference Dye II	0.4μL
		DNA template	4μL
DEPC water	1.6μL

The loaded PCR plate was placed in the Ab applied Biosystems PCR apparatus, and the reaction conditions were set as follows: 30s at 95 deg.C, (5 s at 95 deg.C, 32s at 60 deg.C) x 50 cycles, 15s at 95 deg.C, 1min at 60 deg.C, and 15s at 95 deg.C. Relative quantification was performed by Δ Δ CT. Data were analyzed for variance using GraphPad prism7.00 software.

2. Results of the experiment

Compared with a normal control group, the content of TG (P <0.001), the expression level of TNF-alpha mRNA (P <0.001) and the expression level of IL-6mRNA (P <0.01) in cells of the model group are all obviously increased. Compared with the model group, the cell TG content (P <0.001), TNF-alpha mRNA expression level (P <0.01) and IL-6mRNA expression level (P <0.001) in the genipin 1-beta-D-gentiobiose administration group were all significantly reduced, as shown in FIG. 1.

The oil red O staining results show: the liver cells of the normal group have no red lipid drop, the cytoplasm is in a light blue semitransparent state, and the cell nucleus is deeply dyed; the cytoplasm of the model group cells is rich in red-stained lipid droplets, and a part of the red lipid droplets are connected into a sheet. Compared with the model group, red lipid droplets in the genipin 1-beta-D-gentiobioside group cells are remarkably reduced, as shown in figure 2.

The results prove that the genipin 1-beta-D gentiobioside has the effects of reducing liver fat, resisting inflammation and improving liver lipid deposition.

Example 2

In vivo drug effect experiment of genipin 1-beta-D gentiobioside and geniposide on non-alcoholic fatty liver

1. Experimental methods

1.1. Experimental Material

50 male 4-week-old C57 mice were purchased from Shanghai Slek laboratory animal center and were bred in the SPF-class breeding room of the laboratory animal center of Shanghai medical university; high-fat feed and control feed thereof are purchased from RESEARCH DIEATS company, the product numbers are D12331 and D12328, and fructose and sucrose are purchased from Nantong Turofen company, which are both proved by irradiation. The genipin 1-beta-D gentiobioside is obtained by separating and purifying gardenia by Shanghai pharmaceutical research institute of Chinese academy of sciences, and the purity of the genipin 1-beta-D gentiobioside is more than 98%. Dangfei Liganning is purchased from Sichuan Meidakang pharmaceutical industry GmbH, and has a batch number of Chinese medicine standard character Z51020085.

1.2. Animal modeling, grouping and administration

Model: male 4-week-old C57 mice were randomly divided into a normal group and a model group according to body weight, the normal group was fed with control diet (the model group was fed with high-fat diet high-sugar (42g/L, 45% sucrose, 55% fructose) for 4 weeks), and water intake and food intake were monitored.

Animal grouping and administration: after 4 weeks of molding, the model groups were randomly grouped into model groups, genipin 1- β -D-gentiobioside low dose (60mg/kg) group, genipin 1- β -D-gentiobioside medium dose (120mg/kg) group, genipin 1- β -D-gentiobioside medium dose (240mg/kg) group, and geniposide (120mg/kg) group according to body weight, and were continuously administered for 4 weeks (n ═ 10). The normal group and the model group are administered with 0.3 percent CMC-Na with corresponding amount for intragastric administration. After continuous administration for four weeks, the patient fasts for 12 hours, picks up the eyeball and blood, places the blood at normal temperature, centrifugalizes the blood to take the supernatant, takes the whole liver and removes the gall bladder, and the above samples are all stored at-80 ℃.

1.3 measurement of TG content in liver tissue

750. mu.l of acetone and 750. mu.l of absolute ethanol were added to a labeled EP tube of 2ml for use, and the liver tissue frozen in a freezer of-70 ℃ was taken out and placed in a freezer of-20 ℃ for use. Weighing about 100mg of liver tissue, putting the liver tissue into a 2ml EP tube added with acetone and absolute ethyl alcohol, putting the tissue on ice after the tissue is fully contacted with the reagent, quickly putting the rest liver tissue into liquid nitrogen, and putting the liver tissue into a refrigerator at the temperature of 70 ℃ below zero for freezing after all the liver tissue is weighed. Adding 2 small magnetic beads into each 2ml of EP tube added with the liver tissue sample and the reagent, putting the tubes into a module of a homogenizer for fixation, and setting parameters of the homogenizer after starting up: and homogenizing the slurry at 65HZ for 60s, placing the homogenized slurry in a refrigerator at 4 ℃, and standing the homogenized slurry overnight.

After standing overnight, the liver homogenate was centrifuged at room temperature at 3000rpm for 15 min. Sucking 9 μ l of supernatant to 1.5ml of EP tube, sucking standard substance in a kit (Ou diagnosis products Co., Ltd. in the east of Zhejiang province) to a standard tube, adding 900 μ l of reagent in the kit to the sample tube and the standard tube respectively, uniformly mixing, sucking 200 μ l to a 96-well plate, placing in a water bath kettle at 37 ℃ for 5min, calibrating zero with a blank tube, and comparing color at 546nm by using a multifunctional enzyme-linked immunosorbent assay instrument to read the absorbance value of each tube. The measurement formula of the TG content (mg/g) of the liver tissue is as follows: (measured tube number-blank tube number)/standard tube 200 × 3/20.

1.4. Determination of ALT in serum

The ALT activity of the serum is measured according to the kit instruction (Nanjing institute of bioengineering), a standard curve is firstly added and measured, and then a multifunctional microplate reader is used for reading the light absorption value and substituting the value into the corresponding standard curve for numerical calculation. ALT activity was measured using a microplate method.

1.5. Liver tissue oil red O staining

After the cryomicrotome was turned on for 24 hours, the frozen OCT gel frozen tissue blocks in a-80 ℃ freezer were placed in a-20 ℃ freezer for sectioning. Adhesive slides were naturally adhered to the sections and stained in a refrigerator at 4 ℃ with prepared diluents as stock solutions: the stock solution in the kit was diluted at a ratio of 5:2, filtered three times with 0.22 μm filter paper, and set aside. The water-based sealing agent is put into a water bath kettle at the temperature of-60 ℃ and heated to be liquid, and is used when the film is sealed. The frozen sections to be stained were left at room temperature for 15 minutes, placed in diluted and filtered stock solution for 20 minutes and then washed with double distilled water at 37 ℃ for 10 seconds, after which they were stained in counterstain solution for 5 minutes and still washed with double distilled water at 37 ℃ for 40 seconds. Finally, an aqueous sealing agent is dripped on the glass slide, and the film is inspected and observed by a microscope after being sealed.

2. Results of the experiment

Compared with normal rats, the serum ALT (P <0.05) and the liver TG content (P <0.01) of the NAFLD model mouse induced by the high fat feed are obviously increased. Compared with the model group, the positive drug of the swertia pseudochinensis liver benefiting product can significantly reduce the serum ALT (P <0.05) of the model mouse, but has no significant influence on the content of TG in the liver.

The genipin 1-beta-D gentiobioside with low (60mg/kg), medium (120mg/kg) and high (240mg/kg) dosages can respectively and obviously reduce 38% (P <0.05), 58% (P <0.01) and 62% (P <0.01) of the ALT level of the serum of a model mouse; the genipin 1-beta-D gentiobioside with medium dose (120mg/kg) and high dose (240mg/kg) can respectively and obviously reduce 31 percent (P is less than 0.05) and 40 percent (P is less than 0.001) of the hepatic TG content of a model mouse, and the genipin 1-beta-D gentiobioside with low dose (60mg/kg) has no obvious influence on the hepatic TG content of the model mouse. As shown in fig. 3.

After the animal orally takes genipin 1-beta-D gentiobioside and geniposide with equal dose, genipin 1-beta-D gentiobioside (120mg/kg) is found to be capable of remarkably reducing the serum ALT level (P <0.01) and the liver TG content (P <0.05) of a model animal, while geniposide (120mg/kg) with equal dose only remarkably reduces the serum ALT level (P <0.05) of the model animal and has no remarkable influence on the liver TG content (P >0.05) of the model animal. The results show that genipin 1-beta-D gentiobioside has better serum ALT and liver TG reducing capability than geniposide with equal dosage for model animals.

The oil red staining results show: the normal group of liver lobules had only a few scattered red-stained lipid droplets; the model group showed the presence of a large number of red lipid droplets, partially fused into a sheet. Compared with the model group, the lipid drop red staining areas of the low, medium and high dose genipin 1-beta-D-gentiobioside groups are obviously reduced, wherein the high dose reduction is the most obvious. As shown in fig. 4.

Example 3:

effect experiment of genipin 1-beta-D-gentiobioside in vivo and in vitro inhibition of NLRP3

1. Experiments and methods

(in vivo prophase experimental animal and model are as above)

1.1 cell culture and administration methods

Mouse Normal liver cell line AML-12 was inoculated into 6-well plates (density about 1X 10) using DMEM/F-12 medium containing 10% fetal bovine blood⁵One/ml), placing at 37 deg.C and 5% CO₂And after culturing for 24 hours in an incubator with 95% humidity, dividing the culture into a normal control group (Con), a model group (FFA) and a genipin 1-beta-D gentiobioside group (FFA + GG), wherein each group has 4 holes. The normal control group was given DMEM medium, and the model group was added with FFA (oleic acid 0.3 mM: palmitic acid 0.15mM) in DMEM medium; FFA (oleic acid 0.3 mM: palmitic acid 0.15mM) and genipin 1-beta-D gentiobioside (100 mu M) are added into a genipin 1-beta-D gentiobioside group culture medium for co-incubation, and after incubation for 24h, cells are collected.

1.2 preparation and Mass analysis of RNA samples

② adding 400 mu L chloroform into each tube, violently oscillating and uniformly mixing for 30s, standing for 3min, and centrifuging under the conditions of 4 ℃, 12000rpm and 10 min.

③ sucking 200. mu.L of the upper aqueous phase, transferring to a new 1.5mL tube, adding 1/2 volumes of absolute ethyl alcohol, and mixing.

Sixthly, repeating the step five times.

Seventhly, the adsorption column is placed back into the collection tube and centrifuged for 2min at 10000 rpm.

1.3. Reverse transcription

1.4.Real time PCR

The primers are synthesized and provided by bioTNT company, and the specific primer sequences are as follows:

beta-actin gene:

the forward primer is 5'-CATGTACGTTGCTATCCAGGC-3'

The reverse primer is 5'-CTCCTTAATGTCACGCACGAT-3'

NLRP3 gene:

the forward primer is 5'AACGACCCCTTCATTGAC3'

The reverse primer is 5'GAGGAAGAGGAGGAAGGACA3'

The PCR reaction was prepared according to the following table, in which SYBR Green was purchased from TAKARA.

Reagent	Amount of the composition used
		SYBRPremix Ex Taq	10μL
PCRForward Primer	2μL
		PCR ReversePrimer	2μL
ROX Reference Dye II	0.4μL
		DNA template	4μL
DEPC water	1.6μL

1.5. Preparation of protein samples

Preparation of tissue protein samples: medium-strength RIPA, 100X protease inhibitor and 100X phosphatase inhibitor were mixed to prepare a lysate, and 600. mu.l of lysate and 3 beads were added to a labeled 1.5ml EP tube. Respectively adding 100mg of liver tissue weighed in a refrigerator at-80 ℃ into corresponding EP tubes, homogenizing for 120s at the rate of 60Hz by using a homogenizer, and placing at-80 ℃ after the tissue homogenate is a suspension without obvious tissue blocks? The refrigerator was kept overnight, followed by centrifugation at 12000rpm at 4 ℃. Repeating the steps of the next day on the third day, and sucking the supernatant, namely the protein stock solution to a clean 1.5ml EP tube and storing the supernatant in a refrigerator at the temperature of-80 ℃ for later use.

Preparation of cell protein sample: culturing cells in a small culture dish of 6cm, removing the culture medium when the cells grow to be about 90% of the area of the bottom of the dish, and rinsing the cells for 2 times by precooling PBS. Premelting protease inhibitors and phosphatase inhibitors, RIPA and their ratio as 50: 1: 1 was prepared as a cell lysate. The dish was transferred to ice surface, 100. mu.l of cell lysate was added to each dish of cells, and the mixture was allowed to stand for 15min for sufficient lysis. The cells were gently and thoroughly scraped to the dish side using a cell scraper and the cell lysate was collected in a 1.5ml clean EP tube. The EP tube was inserted on ice and allowed to stand for 20 min. The EP tube 30 was then shaken using a vortex shaker to fully lyse it. The supernatant was collected in a fresh clean 1.5ml EP tube by centrifugation at 12000rpm for 10 minutes at 4 ℃ in advance in a precooled centrifuge and stored in a freezer at-80 ℃ for further use.

Determination of protein concentration: 2ul of protein samples were diluted 20 fold and the contents of the sample were measured as solution A: solution B is 50: 1, adding 20ul of sample to be detected and 200ul of BCA detection reagent into each hole of a 96-hole plate, diluting a protein standard substance by multiple times to draw a standard protein curve, incubating in a constant temperature box at 37 ℃ for 30 minutes, and detecting the absorbance value of each hole at a wavelength of 562nm by using a multifunctional microplate reader. And (4) converting the protein concentration of the sample to be detected according to a standard curve formula. The lowest protein concentration sample was used as the baseline, and Loading Buffer and RIPA were added to correct the protein concentrations of the remaining samples to a uniform level. All protein samples are put into a constant temperature heater at 100 ℃ for denaturation for 10min, denatured for three times, subpackaged and put into a refrigerator at minus 80 ℃.

Westernblot experimental procedure:

firstly, preparing a film transfer liquid according to the proportion of 5.8g of Tris, 2.6g of glycine, 200ml of methanol and 800ml of double distilled water in advance, uniformly mixing, and storing in a refrigerator at 4 ℃ overnight. TBS (20X) solution was prepared in 50ml of TBS + 950ml of double distilled water + Tween-201 ml of TBS.

Secondly, according to the instructions of the enzyme kit, preparing separation glue and concentrated glue in a clean glass plate in sequence, and gelling for 30 minutes at room temperature.

Thirdly, preparing an electrophoresis solution according to the proportion of Tris 3g, glycine 14.4g, SDS1g and double distilled water 1L, and uniformly mixing for later use.

Fixing a glass plate in the electrophoresis tank, pouring the electrophoresis liquid, carefully and slowly pulling out the comb, adding samples into the holes, adding 6ul of Marker, adding 15ul of sample into each hole, avoiding the overflow of the samples from the holes, and carrying out electrophoresis after the electrophoresis liquid is filled to the scribing position. Setting the voltage at 180V for 60 minutes, and finishing electrophoresis after the target protein is run into the corresponding band (experimental record) and modified.

Cutting the PVDF membrane according to the size of 6.0cm x 8.0cm, and activating the methanol for 2 minutes for standby. Soaking two pieces of thick filter paper in the membrane transferring solution, spreading the filter paper 1, the PVDF membrane, the glue and the filter paper 2 on a membrane transferring instrument in sequence, carefully avoiding air bubbles in each middle layer, and setting the voltage of the membrane transferring instrument to be 12V for 80 minutes.

Sixthly, after the membrane transfer is finished, taking out the PVDF membrane, and placing the PVDF membrane in TBST of about 8ml for washing for 3 times, 6 minutes each time.

Sealing the sealing liquid for 1.5 hours, adding the target protein corresponding to the primary antibody after the sealing liquid is sealed, and shaking the table in a refrigerator at 4 ℃ overnight.

Recovering primary antibody the next day, storing in 4 deg.C refrigerator. The membrane was washed 3 times with TBST for 6 minutes, followed by addition of horseradish peroxidase-labeled biological secondary antibody and incubation for 1 hour on a light-shielded shaker.

And ninthly, washing the membrane by TBST after the second anticaking, adding 4ml of developing solution into each membrane (solution A: solution B: 1), developing by using an ECL imager, and performing statistical analysis.

2. Results of the experiment

Liver tissue: compared with a normal control group (NC), the expression level of the model group liver tissue NLRP3mRNA (P <0.01) is obviously increased. The expression level of mRNANLRP3 (P <0.01) in liver tissue was significantly reduced in genipin 1- β -D-gentiobiose-administered group compared to model group (HFHC), as shown in a in fig. 5.

The Westernblot results show: compared with a normal control group, the expression level of the model group liver tissue NLRP3 protein (P <0.01) is obviously increased. Compared with the model group, the expression level of NLRP3 protein (P <0.01) in liver tissues of the genipin 1-beta-D-gentiobiose administration group is remarkably reduced, as shown in A in figure 5.

Liver cell: compared with a normal control group (Con), the expression level of NLRP3mRNA (P <0.01) of model group (FFA) cells is remarkably increased. Compared with the model group, the expression level (P <0.01) of NLRP3mRNA in the genipin 1-beta-D-gentiobiose administration group cells is remarkably reduced, as shown in B in figure 5.

The Westernblot results show: compared with a normal control group, the expression level of model cell NLRP3 protein (P <0.01) is obviously increased. Compared with the model group, the expression level (P <0.01) of NLRP3 protein in the genipin 1-beta-D-gentianobiose administration group cells is remarkably reduced, as shown in B in figure 5.

The results prove that genipin 1-beta-D gentiobioside can inhibit the expression of liver NLRP3 related genes in vitro and in vivo, and is considered to be one of the mechanisms of the genipin 1-beta-D gentiobioside for resisting liver inflammation.

Example 4:

comparison of liver toxicity of genipin 1-beta-D-gentiobioside, geniposide and genipin

1. Experiments and methods

1.1 Experimental materials

Human hepatoma cell line HepG2, purchased from ATCC cell bank. DMEM cell culture medium, fetal bovine serum were purchased from Gibco; the double antibody, 0.25% pancreatin, was purchased from Corning Cellgro, and the CCK-8 kit was purchased from Shanghai Bogu Biotech Ltd

1.2 Experimental methods

And taking a dish of cells in a better growth state, sucking away the culture medium, digesting the culture medium by using trypsin for 3 minutes, adding 2ml of the culture medium, and blowing the dish bottom cells to a suspension state by using a pipette gun. The cell suspension in the dish was transferred to a 15ml EP tube and centrifuged at 1000rpm for 5 minutes. Discarding the upper layer of culture medium, leaving the bottom cell precipitate, adding 2ml of culture medium again, blowing for several times to mix thoroughly, taking 10 μ l of cell suspension, and counting under microscope. Cells were evenly seeded in a 96-well plate at a cell density of 5000/well, 100. mu.l of medium/well, and after 24 hours of cell attachment, the culture supernatant was discarded, followed by culture for 24 hours by replacement of DMEM medium containing 0, 25, 50, 100, 200, 400, 800. mu. M G01, with 6 wells for each group of drug. After 24 hours, the supernatant was discarded, and a medium containing CCK8 reagent was prepared in a ratio of 100. mu.l of DMEM medium + 10. mu.l of CCK8, and 100. mu.l was added to each well, followed by incubation in a 37 ℃ cell culture chamber. And (3) respectively putting the 96-well plate into a multifunctional microplate reader for 0.5h, 1h and 2h, reading the absorbance value at the wavelength of 490nm, and performing statistical analysis.

2. Results of the experiment

Genipin 1-beta-D-gentiobioside and geniposide have no influence on the activity of HepG2 cells at the maximum administration concentration of 2mM, but genipin can cause the activity of HepG2 cells to be reduced, and the IC of the genipin is IC₅₀It was 0.216mM, as shown in FIG. 6.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai pharmaceutical research institute of Chinese academy of sciences

Affiliated eosin hospital of Shanghai medical university

<120> medical application of iridoid glycoside compound

<130> P2020-0786

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA