阅读说明：本技术 Plap-car-效应细胞 (PLAP-CAR-Effector cells ) 是由 吴力军 维塔·格鲁博斯卡娅 于 2019-05-24 设计创作，主要内容包括：本发明涉及一种嵌合抗原受体(CAR)融合蛋白,其从N-末端到C-末端包括：(i)含VH和VL的单链可变片段(scFv),其中,scFv与人PLAP(胎盘碱性磷酸酶)结合,(ii)跨膜结构域,(iii)共刺激结构域CD28、OX-40、GITR,或4-1BB,和(iv)CD3激活结构域。本发明还涉及经修饰以表达本发明CAR的T细胞、自然杀伤(NK)细胞,或巨噬细胞。本发明进一步涉及通过向患者施用PLAP-CAR-T细胞、PLAP-CAR-NK细胞,或PLAP-CAR-巨噬细胞来治疗PLAP阳性癌细胞的方法。(The present invention relates to a Chimeric Antigen Receptor (CAR) fusion protein comprising, from N-terminus to C-terminus: (i) a single chain variable fragment (scFv) comprising a VH and a VL, wherein the scFv binds to human PLAP (placental alkaline phosphatase), (ii) a transmembrane domain, (iii) a co-stimulatory domain CD28, OX-40, GITR, or 4-1BB, and (iv) a CD3 activation domain. The invention also relates to a T cell, Natural Killer (NK) cell, or macrophage modified to express the CAR of the invention. The invention further relates to methods of treating PLAP-positive cancer cells by administering PLAP-CAR-T cells, PLAP-CAR-NK cells, or PLAP-CAR-macrophages to a patient.)

1. A Chimeric Antigen Receptor (CAR) comprising, from N-terminus to C-terminus:

(i) containing V_HAnd V_LThe single chain variable fragment (scFv) of (1), wherein the scFv binds to PLAP (placental alkaline phosphatase),

(ii) (ii) a transmembrane domain which is capable of,

(iii) the co-stimulatory domains CD28, OX-40, GITR or 4-1BB, and

(iv) an activation domain.

2. The CAR of claim 1, wherein the V is_HHas the amino acid sequence of SEQ ID NO 5, and the V_LHas the amino acid sequence of SEQ ID NO. 6.

3. The CAR of claim 1, wherein the V is_HHas the amino acid sequence of SEQ ID NO 21, 26, 30 or 34, and said V_LHas the amino acid sequence of SEQ ID NO. 22.

4. The CAR of claim 3, wherein the V is_HHas the amino acid sequence of SEQ ID NO 21, 26 or 34.

5. The CAR of claim 1, wherein the scFv comprises SEQ ID NO 8, 18, 23, 27, 31, or 35, or an amino acid sequence having at least 95% sequence identity, provided that the sequence variation is located in a non-CDR framework region.

6. The CAR of claim 1, wherein the scFv comprises SEQ ID NO 8, 23, 27 or 35, or an amino acid sequence having at least 95% sequence identity, provided that the sequence variation is located in a framework region other than the CDR.

7. The CAR of claim 1, wherein the activation domain is CD3 ζ.

8. The CAR of claim 1, wherein the co-stimulatory domain is CD 28.

9. The CAR of claim 1, having an amino acid sequence of SEQ ID NO 5, 15, 20, 25, 29 or 33, or an amino acid sequence having at least 95% sequence identity, provided that the sequence variation is not within a CDR region.

10. A nucleic acid sequence encoding the CAR of claim 1.

11. A T cell, natural killer cell, or macrophage modified to express the CAR of claim 1.

12. A method of treating cancer comprising the step of administering the T cell, natural killer cell, or macrophage of claim 11 to a patient having a cancer selected from the group consisting of colon cancer, lung cancer, pancreatic cancer, gastric cancer, testicular cancer, teratoma, seminoma, ovarian cancer, and cervical cancer, wherein the cancer is PLAP positive.

13. The method of claim 12, further comprising administering to the patient a checkpoint inhibitor selected from the group consisting of: PD-1 antibody, PDL-1 antibody, and LAG-3 antibody.

14. An antibody or antigen-binding fragment thereof comprising a VL having the amino acid sequence of SEQ ID NO. 22 and a VH having the amino acid sequence of SEQ ID NO. 21, 26 or 34.

Technical Field

The present invention relates to PLAP (placental alkaline phosphatase) -CAR. The invention also relates to methods of treating PLAP-positive cancer cells by administering PLAP-CAR-T cells, PLAP-CAR-natural killer cells, or PLAP-CAR-macrophages to a patient.

Background

Immunotherapy is becoming a very promising approach to cancer treatment. T cells or T lymphocytes are the armed force of our immune system, constantly looking for foreign antigens and differentiating abnormal (cancer or infected cells) from normal cells. Genetic modification of T cells with CARs has become the most common approach to designing tumor-specific T cells. Delivery of CAR-T cells targeted to Tumor Associated Antigens (TAAs) into patients (known as adoptive cell transfer or ACT) is an effective immunotherapeutic approach. The advantage of CAR-T technology over chemotherapy or antibodies is that reprogrammed engineered T cells can achieve proliferation and persistence in the patient ("an active drug").

CARs (chimeric antigen receptors) generally consist of a single-chain variable fragment (scFv) derived from a monoclonal antibody, linked by a hinge and a transmembrane domain to a variable number of intracellular signaling costimulatory domains: (i) CD28, Ox-40, CD137(4-1BB), GITR, or other costimulatory domains; and (ii) a single cell following the costimulatory domain activates the CD 3-zeta domain (figure 1). The evolution of CARs has gone from a first generation (no co-stimulatory domain) to a second generation (with one co-stimulatory domain) to a third generation (with several co-stimulatory domains). CARs with multiple co-stimulatory domains (so-called third generation CARs) can enhance cytolytic activity and significantly improve the persistence of CAR-T cells, thereby enhancing their anti-tumor activity.

Natural Killer (NK) cells are CD56⁺CD3^-Large granular lymphocytes, which kill virus-infected and transformed cells, are a critical subset of cells that make up the innate immune system. Unlike cytotoxic CD8+ T lymphocytes, NK cells do not require prior sensitization to produce cytotoxicity against tumor cells, and can also eradicate MHC-I negative cells.

CAR-T cell therapy has been successful in the clinic for the treatment of patients with hematological tumors [1-5 ]. The chimeric antigen receptor comprises a single chain variable fragment (ScFv) of an antibody targeting a cancer cell surface antigen linked to a hinge, transmembrane domain, costimulatory domain (CD28, 41-BB or other domain) and CD3 activation domains [1, 6], [7, 8 ]. Recently, based on the high response rate of two CD19-CAR-T cell therapies (kymeriah and yescata) in clinical trials to acute lymphoblastic leukemia and other hematologic tumors, the FDA approved them for the treatment of the corresponding hematologic tumors [3], [9-11 ]. There are several other CAR-T cells that have been clinically tested, for example: CD22-CAR-T cells for B-cell lymphoma [12], BCMA-CAR-T cells for multiple myeloma [13-14], and the like.

In the case of solid tumors, CAR-T cell therapy still faces many challenges in targeting solid tumors due to off-target off-tumor effects, inhibitory tumor microenvironment, CAR-T cell depletion into tumors, T cell depletion, and low persistence [15], [16-18 ]. A major challenge facing CAR-T cells targeting solid tumors is that most tumor antigens of solid tumors are expressed in normal tissues.

PLAP

PLAP is a placental alkaline phosphatase encoded by the ALPP gene. PLAP is a metalloenzyme that catalyzes the hydrolysis of phosphate monoesters. PLAP is expressed predominantly in placental and endometrial tissues, and not in normal tissues.

PLAP is highly expressed in placenta [19] and not expressed in most normal tissues except testis [20 ]. It has been found to be overexpressed in malignant seminomas, teratomas [20], [21], ovarian and cervical cancers [22], [23], [24], and colon adenocarcinomas [25 ]. PLAP was also detected in lung, pancreas and stomach tumors [39 ]. PLAP is also detected in several other membrane-bound proteins in exosomes of non-small cell lung cancer patients and is likely to be a prognostic marker [26 ].

Human PLAP is a 535-amino acid glycosylated protein encoded by the ALPP gene, with 1-22 being a signal peptide followed by an extracellular domain (23-506), 513-529 being a transmembrane domain (the sequence is shown below, the transmembrane domain is underlined) ((Uniprot database))www.uniprot.org/Uniprot/P05187; NM _ 001632). The sequence is shown below (SEQ ID NO: 1).

There are four different but related alkaline phosphatases: intestinal type (ALPI) (NM — 001631); a placenta; placenta-like types (ALPPL2) (NM — 031313), each encoded by a gene on chromosome 2; liver/bone/kidney type (ALPL) (tissue non-specific) (NM — 000478), encoded by a gene on chromosome 1.

Drawings

FIG. 1 shows the structure of the CAR. On the left side: first generation (costimulatory domain-free) structures, in the middle: second generation (one co-stimulatory domain CD28 or 4-BB), on the right: third generation CARs (two or several costimulatory domains) [7 ].

FIG. 2 shows the structure of the mouse and humanized PLAP-CAR constructs.

FIG. 3 shows the probability of relapse free survival in high and low expression PLAP patients as a function of the number of months followed.

FIG. 4A shows the expression of PLAP in several PLAP-negative and PLAP-positive colon cancer cell lines by FACS analysis. The MFI (mean fluorescence intensity)/isotype ratio for each cell line is shown. FIG. 4B shows the PLAP expression levels of three positive and three negative cell lines by mRNA and protein. PLAP negative: HCT116, SW620 and HT-29 cell lines; PLAP positive: lovo, Caco-2, LS123 cell lines.

Figure 5A shows that PLAP-CAR-T cells specifically killed PLAP-positive colon cancer cells more significantly than T cells and mock-CAR-T cells. As described in materials and methods, a real-time cytotoxicity assay (RTCA) was used. The ratio of CAR-T cells to target cells (E: T) was 10: 1. FIG. 5B shows that PLAP-CAR-T cells have significant killing activity against Lovo and LS-123 colon cancer target cells, but not against PLAP-negative HCT116 and HT29 colon cancer cell lines, compared to normal T cells. Figure 5C shows significant levels of CAR-T secreting IFN- γ against PLAP positive cells. The bar graph shows the mean level of IFN-. gamma.in three independent experiments. p <0.05, Student's t test.

FIG. 6A shows the detection of PLAP h 2-and PLAPH4-CAR-T positive cells by FACS with FAB antibodies. FIG. 6B shows the detection of PLAP CAR-T positive cells by FACS with biotinylated recombinant PLAP protein. Fig. 6C (1) and 6C (2) show quantification of real-time cytotoxicity as described in materials and methods. The humanized PLAP-CAR-T specifically killed PALP-positive colon cancer cells, but did not kill PALP-negative colon cancer cells. P <0.06, Student's T-test, increased cytotoxicity of PLAP-CAR-T cells compared to mock-CAR-T cells. FIGS. 6D (1) and 6D (2) show that the levels of IFN- γ, IL-2, and IL-6 secretion by PLAP-CAR-T cells were significantly increased against PLAP-positive colon cancer cell lines but not against PLAP-negative colon cancer cell lines, as compared to mock-CAR-T cells. p <0.05, Student's t-test.

Figure 7A shows that humanized PLAP-CAR-T cells significantly reduced growth of Lovo xenograft tumors. The tumor volume treated with CAR-T cells was significantly smaller than the tumor volume treated with mock control cells. p <0.05, Student's t test. Figure 7B shows that humanized PLAP-CAR-T cell treated tumors were significantly smaller in size than control mice. p <0.05, Student's t test. Figure 7C shows that the tumor weight of hPLAP-CAR-T treated mice was significantly lower than control mice. p <0.05, Student's t test. FIG. 7D shows that AST, ALT and amylase levels were not significantly affected in the serum of humanized PLAP-CAR-T cell treated mice. The samples were analyzed as described in materials and methods.

FIGS. 8A (1) -8A (3) show that PLAP h5-CAR-T cells significantly killed PLAP-positive colon cancer cells (Caco-2 cells and Lovo cells), but not PLAP-negative colon cancer cells (HCT 116). FIG. 8B shows that PLAP h5-CAR-T cells secrete significantly higher levels of IFN- γ against PLAP-positive colon cancer cells (Caco-2 cells and Lovo cells), but not PLAP-negative colon cancer cells (HCT 116).

FIG. 9A is a quantification of FACS data showing PDL-1 expression in colon cancer cell lines before and after PLAP-CAR-T treatment by FACS analysis. IFN-gamma (20/ng/ml) was added as a positive control for PDL-1 induction. In contrast to T cells and mock-CAR-T cells, PLAP-positive Lovo cells induced significantly PDL-1 expression in response to hPALAP-CAR-T cells, whereas Caco-2, HCT116, HT29 cells did not. FIG. 9B shows the response of PDL-1 expression up-regulation in different doses of CAR-T cells. FIG. 9C shows time dependence of PDL-1 in hPLAP-CAR-T cell-induced Lovo cancer cells. FIG. 9D shows that PD-1 expression was induced in CAR-T cells after co-incubation with PLAP positive target cells. FACS analysis using PD-1 antibody showed that the PD-1 levels of CAR-T cells showed a significant increase before and after co-incubation with target cells. p <0.05, Student's t test. FIG. 9E shows that LAG-3 expression is upregulated after co-incubation of PLAP-CAR-T cells with PLAP-positive cells. LAG-3 levels were significantly upregulated relative to mock CAR-T cells or CAR-T cells without target cells. p <0.05, Student's t test. FIG. 9F shows that combination of PLAP-CAR-T cells with PD-1 antibody or LAG-3 antibody increases cytotoxicity of CAR-T cells against target cells. The RTCA assay was performed using PLAPH2-CAR-T cells at a 3:1 ratio, either alone or in combination with PD-1 antibody or PDL-1 antibody. Quantitation of RTCA after overnight co-incubation with Lovo target cells is shown. Figure 9G shows a significant increase in secreted IFN- γ when PLAP-CAR-T cells were combined with PD-1 or LAG-3 antibodies as compared to either PLAP-CAR-T cells alone or antibodies alone. P <0.05, Student's single tail T-test, compared to PLAP-CAR-T cells plus isotype antibody.

Detailed Description

Definition of

As used herein, "adoptive cell therapy" (ACT) is a therapeutic method that uses cancer patients' own T lymphocytes or NK cells or other hematopoietic cells (such as macrophages) to induce expansion of pluripotent cells with anti-tumor activity in vitro and reinfusion into cancer patients.

As used herein, "affinity" is the strength of binding of a single molecule to its ligand. Affinity is generally determined by the equilibrium dissociation constant (K)_DOr Kd) for the evaluation and ranking of the strength of the intermolecular interactions.

As used herein, "Chimeric Antigen Receptor (CAR)" refers to a fusion protein comprising an extracellular domain capable of binding to an antigen, a transmembrane domain composed of a polypeptide not derived from the extracellular domain, and at least one intracellular domain. "Chimeric Antigen Receptors (CARs)" are sometimes referred to as "chimeric receptors", "T-bodies", or "Chimeric Immunoreceptors (CIRs)". "extracellular domain capable of binding to an antigen" refers to any oligopeptide or polypeptide capable of binding to an antigen. "intracellular domain" refers to any oligopeptide or polypeptide known to function as a domain that transmits a signal to activate or inhibit a biological process within a cell.

As used herein, "domain" refers to a region in a polypeptide that folds into a particular structure independently of other regions.

As used herein, "single chain variable fragment (scFv)" refers to a single chain polypeptide derived from an antibody that retains the ability to bind to an antigen. One example of an scFv includes an antibody polypeptide formed by recombinant DNA techniques, and in which the Fv regions of immunoglobulin heavy (H chain) and light (L chain) chain fragments are linked by a spacer sequence. Various methods for making scFv are known to those skilled in the art.

As used herein, "tumor antigen" refers to an antigenic biomolecule, the expression of which causes cancer.

The present inventors have found that PLAP is a unique tumor marker and that PLAP can be advantageously used to prepare PLAP-CAR-T cells or PLAP-NK cells useful for CAR-T cell therapy or CAR-NK cell therapy because PLAP is not expressed in normal tissues. Unlike other tumor markers expressed at low levels in normal tissues, the advantage of PLAP targets is that they are not expressed in most normal tissues but only in placenta and testis, leaving PLAP-CAR-T cells/PLAP-NK cells unreactive with normal tissues, and therefore they are safe and have low toxicity.

The present invention provides CAR-T cells and NK cells that target PLAP tumor antigens that are highly overexpressed in various types of cancer, such as ovarian cancer, seminoma, and colon cancer. The PLAP-CAR-T cells and PLAP-NK cells of the present invention have high cytotoxicity against several cancer cells of colon cancer cell lines and ovarian cancer cell lines: .

The present invention relates to a chimeric antigen receptor fusion protein comprising, from N-terminus to C-terminus: (i) containing V_HAnd V_LThe single chain variable fragment (scFv) of (i), which scFv binds to human PLAP, (ii) a transmembrane domain, (iii) a costimulatory domain CD28, and (iv) an activation domain.

In one embodiment, the PLAP antibody is a mouse antibody, and V_HHaving the amino acid sequence of SEQ ID NO. 5, and V_LHas the amino acid sequence of SEQ ID NO. 6.

In one embodiment, the PLAP antibody is a humanized antibody, and V_HHaving the amino acid sequence of SEQ ID NO 16, 21, 26, 30 or 34, and V_LHas the amino acid sequence of SEQ ID NO. 22.

In one embodiment, the scFv comprises the amino acid sequence of SEQ ID NO 8, 18, 23, 27, 31 or 35; or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% sequence identity, provided that the sequence variation is located in a non-CDR framework region.

In one embodiment, the CAR comprises the amino acid sequence of SEQ ID NO 5, 15, 20, 25, 29 or 33; or an amino acid sequence having at least 95%, 96%, 97%, 98% or 99% sequence identity, provided that the sequence variation is not within a CDR region. .

Sequence changes (i.e., amino acid changes) are preferably minor amino acid changes, such as conservative amino acid substitutions. Conservative amino acid substitutions are well known to those skilled in the art.

The present invention relates to an adoptive cell therapy method for treating cancer, comprising the step of administering to a subject having cancer a PLAP CAR-T cell, a PLAP CAR-NK cell or a PLAP CAR-macrophage, wherein the cancer is selected from the group consisting of colon cancer, lung cancer, pancreatic cancer, gastric cancer, testicular cancer, teratoma, seminoma, ovarian cancer and cervical cancer, and the cancer is PLAP positive.

Antibodies suitable for use with the PLAP CAR include mouse PLAP antibodies to PLAP and humanized PLAP antibodies to PLAP. In one embodiment, the antibody has a high affinity for PLAP.

The CAR of the invention comprises a single chain variable fragment (scFv) that specifically binds PLAP. The heavy chain (H chain) and light chain (L chain) fragments of the anti-PLAP antibody are linked by a linker sequence. For example, the linker may be 5-20 amino acids. The scFv structure may be VL-linker-VH, or VH-linker-VL, from N-terminus to C-terminus.

The CAR of the invention comprises a transmembrane domain spanning the membrane. The transmembrane domain may be derived from a native polypeptide or may be artificially designed. The transmembrane domain derived from a native polypeptide can be obtained from any membrane-bound or transmembrane protein. For example, the transmembrane domains of the alpha or beta chain of the T cell receptor, CD3 zeta chain, CD28, CD 3-epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR may be used. An artificially designed transmembrane domain is a polypeptide that mainly comprises hydrophobic residues such as leucine and valine. Preferably, triplets of phenylalanine, tryptophan and valine are found at each end of the synthetic transmembrane domain. In preferred embodiments, the transmembrane domain is derived from CD28 or CD8, which provides good receptor stability.

In the present invention, the costimulatory domain is a costimulatory signal molecule for a protein selected from the group consisting of: human CD28, 4-1BB (CD137), ICOS-1, CD27, OX 40(CD137), DAP10, and GITR (AITR).

The intracellular domain (activation domain) is the signaling portion of the CAR. Upon antigen recognition, the receptors aggregate and signals are transmitted to the cells. The most commonly used intracellular domain component is CD 3-zeta (CD 3Z or CD3 zeta) which contains 3 ITAMs. The activation signal is transmitted to the T cells upon antigen binding. CD 3-zeta may not provide a completely adequate activation signal and may require an additional costimulatory signal. For example, one or more costimulatory domains can be used with CD 3-zeta to deliver a proliferation/survival signal.

The CAR of the invention may comprise a signal peptide at the N-terminus of the ScFv such that when the CAR is expressed within a cell (such as a T cell, NK cell or macrophage), the nascent protein is directed to the endoplasmic reticulum and subsequently to the cell surface where it is expressed. The core of the signal peptide may comprise a long stretch of hydrophobic amino acids with a tendency to form a single alpha-helix. The signal peptide may start with a small fraction of positively charged amino acids, which facilitates the formation of the correct topology of the polypeptide during translocation. At the terminus of the signal peptide, there is usually a stretch of amino acids that can be recognized and cleaved by the signal peptidase. The signal peptidase may cleave during translocation or after translocation is complete, producing a free signal peptide that is digested by the particular protease and the mature protein. For example, the signal peptide may be derived from human CD8 or GM-CSF, or from a variant having 1 or 2 amino acid mutations, provided that the signal peptide still functions to cause expression of a cell surface CAR.

The CAR of the invention may include a spacer as a hinge region, linking the scFv to the transmembrane domain, and spatially separating the antigen binding domain from the intracellular domain. The flexible spacer enables the binding domains to be oriented in different directions to enable them to bind to a tumor antigen. The spacer sequence may be: an IgG1 Fc region, an IgG1 hinge region, a CD8 stem (talk), or a combination thereof. Preferably human CD28 or CD8 stem.

The invention provides a nucleic acid encoding the CAR described above. The nucleic acid encoding the CAR can be prepared from the amino acid sequence of the particular CAR by conventional methods. The base sequence encoding the amino acid sequence can be obtained from the aforementioned NCBI RefSeq ID or genbank accession number of each domain amino acid sequence, and the nucleic acid of the present invention can be prepared using standard molecular biological and/or chemical methods. For example, a nucleic acid can be synthesized based on the base sequence, and the nucleic acid of the present invention can be prepared by using a DNA fragment obtained from a cDNA library by Polymerase Chain Reaction (PCR).

The nucleic acid encoding the CAR of the invention can be inserted into a vector, and the vector can be introduced into a cell. For example, viral vectors such as retroviral vectors (including tumor retroviral vectors, lentiviral vectors, and pseudotyped vectors), adenoviral vectors, adeno-associated virus (AAV) vectors, simian viral vectors, vaccinia viral vectors, or sendai viral vectors, epstein-barr virus (EBV) vectors, and HSV vectors can be used. As the viral vector, it is preferable to use a viral vector which lacks replication ability and thus cannot replicate itself in infected cells.

For example, when a retroviral vector is used, the method of the present invention can be carried out by selecting an appropriate packaging cell based on the LTR sequence and packaging signal sequence possessed by the vector and preparing a retroviral particle using the packaging cell. Examples of packaging cells include PG13(ATCC CRL-10686), PA317(ATCC CRL-9078), GP + E-86 and GP + envAm-12, and Psi-Crip. Retroviral particles can also be prepared from 293 cells or 293T cells with high transfection efficiency. A variety of retroviral vectors produced based on retroviruses and packaging cells are useful for packaging retroviral vectors, which are widely available from a number of companies.

The present invention provides T cells, or NK cells, or macrophages modified to express the chimeric antigen receptor fusion proteins described above. The CAR-T cells, CAR-NK cells, or CAR-macrophages of the invention bind to a specific antigen through the CAR, thereby transmitting a signal into the cell, and thereby activating the cell. Activation of the CAR-expressing cell varies depending on the kind of host cell and the intracellular domain of the CAR, and can be confirmed based on, for example, release of cytokines, increase in cell proliferation rate, change in cell surface molecules, and the like as indicators.

T cells or NK cells or macrophages modified to express the CAR can be used as therapeutic agents for diseases. The therapeutic agent includes CAR-expressing T cells as an active ingredient, and may further include a suitable excipient. Examples of excipients include pharmaceutically acceptable excipients known to those skilled in the art.

The present application demonstrates the efficacy of CAR-T cells to target the PLAP antigen that is overexpressed in colon cancer tumors. The present application demonstrates that PLAP-CAR-T cells specifically reduce the viability of PLAP-positive colon cancer cells, but not PLAP-negative cancer cells. PLAP-CAR-T cells secreted significant levels of IFN- γ after co-incubation with PLAP-positive colon cancer cells, but did not secrete significant levels of IFN- γ after co-incubation with PLAP-negative cancer cells. The application demonstrates that PLAP-CAR-T cells significantly reduce in vivo Lovo (positive PLAP-colon cancer cells) xenograft tumor growth. After treatment of mice with hPLAP-CAR-T cells, there was no increase in AST, ALT or amylase levels in the blood and no decrease in body weight, demonstrating that hPLAP-CAR-T cells have no toxic effects in vivo. Furthermore, the combination of hPLAP-CAR-T cells with PD-1 or LAG-3 antibodies increases the efficacy of CAR-T cells against colon cancer cells.

The inventors found that PLAP-CAR-T cells significantly killed all PLAP positive cancer cells, but not PLAP negative colon cancer. This means a high specificity of the PLAP-CAR-T cells. Furthermore, the upregulation of PDL-1 by CAR-T cells in Lovo and Caco-2 colon cancer cells was different. Lovo colon cancer cells induced PDL-1 production in response to PLAP-CAR-T cells, whereas Caco-2 cells did not. Both cell lines were effectively killed by hPALAP-CAR-T cells, independent of the induction of PDL-1 expression. Humanized PLAP-CAR-T cells killed Lovo cells faster than Caco-2 cells and secreted more IFN- γ against Lovo colon cancer cells than against Caco-2 cells. Furthermore, T cells and mock CAR-T cells were more active in Lovo cells than Caco-2 cells. This indicates that hPLAP-CAR-T cells can overcome the up-regulation of PDL-1 in Lovo cells. This indicates that PLAP-CAR-T cells efficiently killed Lovo cells when the PDL-1 was upregulated by pre-treatment of Lovo cells with IFN- γ. Colon cancer with Kras mutations is resistant to therapies such as cetuximab (Erbitux) [40], while hPLAP-CAR-T cells effectively kill two different colon cancer cell lines: lovo (codon 13 mutation: G13D) and LS123 (codon 12 mutation: G12D). This is another advantage of hPLAP-CAR-T cells against solid tumors that are resistant to other therapies due to Kras mutations.

PLAP-CAR-T cells upregulated PD-1 and LAG-3 upon co-culture with PLAP-positive colon cancer cell lines, but did not increase upon co-culture with PLAP-negative colon cancer cell lines. The inventors have found that PDL-1 is dose-dependent upregulated in response to PLAP-CAR-T cells in the Lovo colon cancer cell line. The PD-1, PDL-1 or LAG-3 antibody in combination with PLAP-CAR-T cells significantly increased CAR-T induced cytotoxicity and IFN- γ secretion against Lovo cancer cells. Thus, checkpoint inhibitors may reduce CAR-T cell depletion and provide a basis for combination therapy.

PLAP scFv- (CD28, OX-40, 4-1BB or GITR) -CD3 zeta-CAR-T cells, CAR-NK cells or CAR-macrophages can be used in combination with different chemotherapies: (ii) a checkpoint inhibitor; targeted therapies, small molecule inhibitors and antibodies.

Tag (Flag tag or other tag) conjugated PLAP scFv can be used to prepare the CAR.

Third generation CAR-T or other co-activation signaling domains can be used for the PLAP-scFv within CAR.

CAR-T cells, CAR-NK cells, or CAR-macrophages of bispecific PLAP antigens and other antigens (EGFR, HER-2, VEGFR, NGFR) are useful for immunotherapy. The construct of the bispecific CAR-T cell comprises a first scFv targeting PLAP, and a second scFv targeting a second tumor antigen. CAR-T cells with bispecific antibodies can target cancer cells overexpressing both tumor antigens more efficiently and more specifically.

The combination of a PLAP-CAR-T cell, CAR-NK cell, or CAR-macrophage with CAR-T cells, CAR-NK cells, or CAR-macrophages targeted to other tumor antigens or tumor microenvironments (such as VEGFR-1-3), i.e., dual CAR-T cells, CAR-NK cells, or CAR-macrophages, can be used to enhance the activity of monotherapy PLAP-CAR.

PLAP-CAR-T cells, CAR-NK cells, or CAR-macrophages can be used to activate phagocytosis and block "uncoytosed" signaling.

PLAP-CAR-NK cells are safe effector cells because they can avoid potentially lethal complications such as cytokine storm, tumor lysis syndrome, and off-target effects.

anti-PLAP antibodies h2, h4 and h5 VH and VL sequences were used as one arm of a bispecific antibody.

Both the PLAP-CAR-T cells and bispecific antibodies containing anti-PLAP VH and VL can be used in combination with checkpoint inhibitors (PDL-1 antibody, PD-1 antibody, LAG-3 antibody, TIM-3 antibody, TIGIT antibody and others), and chemotherapy to enhance the therapeutic effect on cancer cells.

The following examples further illustrate the invention. These examples are intended to illustrate the invention only and are not intended to limit the invention.

Examples

Example 1 materials and methods

Cells and culture media

HEK293FT cells from AlStem (Richmond, Calif.) were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin. Human Peripheral Blood Mononuclear Cells (PBMC) were isolated from whole blood from Stanford hospital blood center, Stanford, Calif. using Ficoll-Paque solution (GE Healthcare) according to the IRB approved protocol. Colon cancer cell lines: PLAP-negative: SW620, HT29, HCT116 and PLAP-positive: lovo, Caco-2, LS123 were obtained from Volter Bordetella (Oxford, UK), his laboratory identified cell lines as described [28-29] using SNPs, Sequenom MassARRAY iPLEX and HumanOmniexpress-24 bead chip arrays and tested for the presence of the mycoplasma. Cell lines were cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin. A list of 117 colon cancer cell lines from w. bordermor laboratory for detection of PLAP mRNA levels is shown in the supplement.

Cell lines were additionally identified by FACS using cell-specific surface markers and humidified at 5% CO₂Culturing in an incubator.

Antibodies

Monoclonal PD-1(EH122H7), PDL-1 (clone 29E2A3), TIGIT (clone A15152G), LAG3 (clone 7H2C65), CD62L (clone DREG-56), CD45RO (clone UCHL1), CD4 (clone RPA-T4) and CD8 (clone RPA-T8) antibodies were from Biolegend. PLAP antibody (clone H17E2) was obtained from Thermo Fisher. The remaining antibodies are described in [30 ].

CAR constructs

A second generation CAR containing the CD8 α signal peptide, PLAP Ab ScFv [21], CD8 hinge region, CD28 costimulatory domain, and CD3 activation domain was cloned down into the modified lentiviral vector pCD510(Systems Bioscience) starting from the EF1 promoter. The same constructs were generated with humanized PLAP ScFv (called humanized PLAP or PLAPh2, h4 (clone 2 or 4)) and with ScFv of intracellular proteins or mock control comprising 45 amino acid sequences of the three epitopes of the transferrin antibody (called mock-CAR). Mouse PLAP-CAR was generated by Synbio. The humanized PLAP ScFv sequence was synthesized from IDT as the gBlock sequence, with Nhe I and Xho I restriction sites flanking the ScFv and subcloned into the lentiviral vector between the CD 8a signal peptide and the CD8 hinge sequence.

Humanization of PLAP

Humanization of PLAP was performed as described in [31 ]. The human coding frames from the human antibody clones with the highest homology were subjected to humanization pairing using the computer bioinformatics method described in [32, 33 ]. Mouse CDRs were inserted into these clones, and CAR constructs were generated and CAR-T cell functional tested using different humanized ScFv variants.

Preparation of lentiviruses in 293FT cells

The lentiviral CAR constructs were used to generate lentiviruses by transfecting 293FT cells with transfection reagent (Alstem) and lentiviral packaging mix as described [34 ]. According to the instructions, lentivirus titers in pfu/ml were detected by RT-PCR using a Lenti-X qRT-PCR kit (Takara) and a 7900HT thermal cycler (Thermo Fisher).

CAR lentivirus transduction and amplification of CAR-T cells

PBMC cells were cultured at 1X 10⁶Cells/ml were resuspended in AIM V-Albumax medium (Thermo Fisher) containing 10% FBS and 300U/ml IL-2(Thermo Fisher). PBMCs were activated with CD3/CD28Dynabeads (Invitrogen) and cultured in 24-well plates. Such as [30, 31, 34]]The CAR lentiviruses were added to PBMC cultures using a TransPlus transduction enhancer (AlStem) at 24 and 48 hours in culture. CAR-T cells were cultured and expanded for 14 days by adding fresh medium to maintain cell density at 1X 10⁶Cells/ml.

Fluorescence Activated Cell Sorting (FACS) analysis

To detect the expression of CAR, 5X 10⁵Cells were suspended in 1 XPBS + 0.5% BSA buffer and incubated on ice with human serum (Jackson injective search, West Grove, Pa.) for 10 min. Allophycocyanin (APC) -labeled anti-CD 3(eBioscience, San Diego, CA), 7-amino actinomycin D (7-AAD, BioLegend, San Diego, CA), anti-f (ab)2, or its isotype control, was then added and the cells were incubated on ice for 30 min. Cells were then washed with buffer and analyzed on a FACSCalibur (BD biosciences) light scatter versus 7-AAD staining first, followed by F (ab)2 staining or isotype control staining for CD3 staining, and 7-AAD negative valve gated cell maps were generated. The PLAP levels of colon cancer cell lines were measured by FACS using mouse monoclonal PLAP antibody (H17E2) from Ximbio (London, UK) and analyzed on a FACSCalibur.

Blitz ForteBio binding assay

Binding assays of PLAP antibodies to recombinant PLAP extracellular domain proteins from Sino Biological were performed using the Blitz forteBio system as described [30 ]. Briefly, anti-mouse capture (AMC) biosensors were soaked in kinetic buffer (PBS, 0.1% Tween, 0.05% BSA) for 10min and then in the same buffer with 0.1mg/mL of mouse anti-PLAP antibody for 30 min. After washing, different concentrations of PLAP antigen were bound using biosensors. Kd was detected using Blitz system software.

Real-time cytotoxicity assay (RTCA)

Adherent colon cancer target cells (10000 cells per well) were seeded into 96-well E plates (ace Biosciences, San Diego, CA) and cultured overnight using an impedance-based real-time cell analysis (RTCA) icellegence system (ace Biosciences). After 20-24 hours, 1X 10 in AIM V-ALB max medium containing 10% FBS⁵Effector cells (CAR-T cells, mock CAR-T cells, or untransduced T cells) were substituted for the medium in triplicate. In some experiments, 10 μ g/ml of the checkpoint protein antibody PD-1, LAG-3 or isotype antibody was added to effector cells alone or in combination with CAR-T cells. In some series of experiments, target cells were pretreated with 20ng/ml IFN-. gamma.for 24 h. Cells were monitored for 1-2 days using the RTCA system and impedance (proportional to cell index) was plotted against time. Cytotoxicity was calculated as (target cell impedance of non-effector cells-target cell impedance of effector cells) × 100/target cell impedance of non-effector cells.

ELISA assay for cytokine secretion

Target cells were cultured in triplicate in U-bottom 96-well plates of AIM V-Albumax medium supplemented with 10% FBS, along with effector cells (CAR-T cells or untransduced T cells). After 16 hours, the supernatant was removed and centrifuged to remove residual cells. In some experiments, ELISA cytokine assays were performed using supernatants after RTCA analysis. The supernatant was transferred to a new 96-well plate and human cytokines were analyzed by ELISA using the Thermo Fisher kit according to the instructions.

Study of xenografts in mice

Six-week old male NSG mice (Jackson Laboratories, Bar Harbor, ME) were housed according to the Institutional Animal Care and Use Committee (IACUC) protocol. Each mouse was injected subcutaneously with 2X 10 aliquots in sterile 1X PBS⁶A colon cancer cell. Mice were injected intravenously with CAR-T cells (1X 10) on days 1, 7 and 13⁷CAR-T cells/mouse). Caliper measurement of swelling twice weeklyTumor size and using the formula W²L/2 determination of tumor volume (in mm)³) Wherein W is the tumor width and L is the tumor length. At the end, 0.1ml of blood was collected for toxicological marker analysis.

A toxicology marker.

Mouse serum samples were processed by IDEX Bioanalytics (West sacrmento, CA) using a clinical chemistry analyzer (Beckman-Coulter AU680) to detect levels of toxicological markers: ALT (alanine aminotransferase), AST (aspartate aminotransferase), amylase, in U/ml.

Primary tumor sample

Samples with different types of normal or tumor tissue were obtained from archival slides of Promab (Richmond, CA). TMA slides containing 106 primary colon carcinoma adenocarcinomas were obtained from Biomax (Rockville, MD) and used in IHC analysis with PLAP antibodies.

Immunohistochemical (IHC) staining

Primary tumor tissue or normal tissue section slides or primary TMA slides were incubated twice in xylene for 10 minutes each, then hydrated in ethanol and washed in 1 x PBS. Heat-induced antigen retrieval was performed using an autoclave in 10mM citrate buffer pH 6.0 for 20 minutes. Slides were washed with PBS at 3% H₂O₂The solution was incubated for 10min, then washed again with 1 × PBS and incubated for 20 min in goat serum. Tissue section slides were incubated with mouse monoclonal PLAP (H17E2) primary antibody overnight at 4 ℃ or 1.5 hours at 37 ℃. Slides were washed 3 times with PBS, incubated with biotin-coupled secondary antibody for 10 minutes, washed with PBS, incubated with streptavidin-coupled peroxidase for 10 minutes, and washed 3 times with 1 x PBS buffer. Slides were incubated under microscope in DAB substrate solution for 2-5 minutes. The reaction was stopped by washing with water, counterstained with hematoxylin, washed with water, and dehydrated in 75%, 80%, 95%, and 100% ethanol and xylene. Isotype antibodies were used for negative controls, while placental samples were used for positive controls. Images were collected on a Motic DMB5-2231PL microscope (Motic, Xiamen, China) using Images Plus 2.0 software. Use ofCorrelation analysis of PLAP expression with progression-free survival prognosis was performed by the R2 genome analysis and visualization platform (http:// r2plant form. com/http:// r2. am. nl).

Example 2 sequence of mouse PLAP-CD28-CD3 zeta CAR

The CAR construct is: human CD8 signal peptide, mouse scFv or humanized antibody derived from the antibody H17E2 (V)_H-linker-3X (GGGGS) -V_L) CD8 hinge region, CD28 transmembrane, co-activation domain, CD3 zeta activation domain (fig. 2). The sequence of the lentiviral vector with the CAR construct within Eco R1 and Xho I sites is shown below. This scFv was flanked by Nhe I and Xho I sites and could potentially be recloned into other constructs. The nucleotide sequence of PLAP-CD28-CD3 is shown below,

2, tctagagccgccacc-flanking vector sequence starting with the Xba I site (italics):

3 (mouse PLAP CAR, named PMC262), starting with ATG and ending with the stop codon TAA (underlined), the signal peptide is shown in bold, with the VH of CDR 1, 2, 3 (bold underlined); the linker is in italics and has a VL of CDRs 1, 2, 3 (bold underlined); ScFV flanked by 5 'Nhe and 3' Xho sites in small font

4, SEQ ID NO: taggaattc flanking vector with EcoR I site (italics)

SEQ ID NO. 5 is the amino acid sequence of SEQ ID NO. 3 (mouse PLAP-CD28-CD3 ζ CAR): signal peptide-VH-linker (in italic small font GSSSS X3) -VL-h-CD28-CD 3. Bold sequence is mouse PLAP scFv; CDR 1, 2, 3 are underlined; VH-linker in italics-VL.

Mouse VH (with underlined CDRs 1, 2, 3), SEQ ID NO:6

Mouse VL (with underlined CDRs 1, 2, 3), SEQ ID NO:7

Mouse PLAP scFv, SEQ ID NO 8

The scheme for the CAR construct is shown below, showing the sub-domain sequence of SEQ ID NO 3.

< huCD8 Signal peptide > SEQ ID NO 9

ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCG

< NheI restriction site >

GCTAGC

< mouse PLAP scFv (VH-linker-VL) > SEQ ID NO 10

< XhoI restriction site >

CTCGAG

<CD8>SEQ ID NO:11

< CD28 TM/activation > SEQ ID NO 12

<CD3ζ>SEQ ID NO:13

< EcoRI restriction site >

Gaattc

Example 3, PLAP CAR with humanized antibody h 1.

14 (human h1 PLAP CAR), starting with ATG and ending with the stop codon TAA (underlined). The sequence starts with a signal peptide, followed by humanized PLAP scFv h 1. The nucleotide sequence is identical in structure to SEQ ID NO 2 except for the scFv portion. The bold sequence is humanized h1 PLAP-1 scFv (CDR 1, 2, 3 underlined). In comparison to mice, humanized framework region in different nucleotides underlined, but not bold.

15 is the humanized h1 PLAP-1 CAR amino acid sequence; except for the scFv portion, it is structurally identical to mouse PLAP-CAR; the bold sequence is humanized h1 PLAP-1 ScFv, CDR 1, 2, 3 in italics and underlined; the joint is in a smaller font; the different amino acids in the CDR regions are in conventional font; different amino acids from the mouse sequence in the framework regions are underlined.

Humanized h1 PLAP-1 VH (SEQ ID NO:16)

Humanized h1 PLAP-1 VL (SEQ ID NO:17)

Humanized h1 PLAP-1 scFv (SEQ ID NO:18)

Example 4, PLAP CAR with humanized antibody h 2.

Additional humanized versions of the PLAP CAR were generated using bioinformatic methods. The sequence was codon optimized to improve expression of the CAR.

The sequence starts with a signal peptide (underlined, codon optimized) followed by a humanized PLAP scFv (bold). The nucleotide sequence is identical in structure to SEQ ID NO 3 except for the scFv portion. The bold sequence was humanized PLAP-h2(PMC409) scFv, the remaining structure being identical to mouse PLAP-CAR (SEQ ID NO: 5).

Humanized PLAP h 2-CAR. Nucleotide sequence (codon optimized), SEQ ID NO 19

The humanized PLAP h2 CAR amino acid sequence is shown in SEQ ID NO: 20. Except for the scFv portion, it is structurally identical to mouse PLAP-CAR; the bold sequence is a humanized PLAP ScFv consisting of a VL-linker-VL.

Humanized PLAP h2 VH (SEQ ID NO:21)

Humanized PLAP h2 VL (SEQ ID NO:22), CDR 1, 2, 3 are underlined

Humanized PLAP h2 scFv (SEQ ID NO:23)

Example 5, PLAP CAR with humanized antibody h 4.

The nucleotide sequence of codon optimized humanized PLAP h4 CAR (PMC410) was initiated with a signal peptide (underlined, SEQ ID NO:9, codon optimized) followed by humanized PLAP scFv (bold). The bold sequence is PLAP-h4(PMC410) scFv of human origin,

SEQ ID NO:24 is a humanized PLAP h4-CAR nucleotide sequence (codon optimized).

SEQ ID NO:25 is the humanized PLAP h4 CAR amino acid sequence: the ScFv sequence is shown in bold.

Humanized PLAP h4 VH (SEQ ID NO:26), CDR 1, 2, 3 are underlined

Humanized PLAP h4 VL (SEQ ID NO:22)

Humanized PLAP h4 scFv (SEQ ID NO:27)

Example 6 PLAP CAR with humanized antibody h 3.

SEQ ID NO 28 is a humanized PLAP-h3(PMC407) nucleotide sequence:

SEQ ID NO:29 is the PLAP h3 CAR amino acid sequence (ScFv sequence bold).

Humanized PLAP-h3 VH, SEQ ID NO 30

Humanized PLAP h3 VL, SEQ ID NO:22

Humanized PLAP h3 scFv, SEQ ID NO 31

Example 7, PLAP CAR with humanized antibody h 5.

32 is a humanized PLAP-h5 scFv nucleotide sequence inserted between Xho and NheI sites:

humanized PLAP-h5 CAR amino acid sequence (SEQ ID NO:33)

Humanized PLAP-h5 VH, SEQ ID NO: 34. CDR 1, 2, 3 are underlined

Humanized PLAP h5 VL, SEQ ID NO:22

Humanized PLAP h5 scFv, SEQ ID NO 35

Example 8 PLAP is expressed negatively in most normal tissues, but in gastrointestinal cancers

We performed IHC staining of placenta, testis, colon, ovarian cancer and other normal or malignant tissues from different types of cancer with PLAP antibodies. Placenta staining was strongest, positive for testicular, colon and ovarian cancers, other types of cancer (breast, lung, prostate) and normal tissue: pancreas, tonsil, rectum, muscle, esophagus, brain, etc. are all negative. Furthermore, we assessed in silico expression of PLAP mRNA from 1457 different malignant cell lines, including 63 colon cancer cell lines, using the Cancer Cell Line Encyclopedia (CCLE). High expression of PLAP in Gastrointestinal (GI) cancer: esophageal cancer, upper aerodigestive tract cancer, gastric cancer, pancreatic cancer, and colon cancer. We also used the genotype-tissue expression (GTEx) database of PLAP expression in non-malignant normal tissues for analysis. PLAP mRNA is expressed very little in many normal tissues and TMP (per million kb transcript) mRNA levels are 0 in many tissues. In contrast, when we analyzed EpCAM as a positive control, its expression was at a medium-high level in many normal tissues, 445 TMP (per million kb transcript) in the colon, 391 in the small intestine and 259 in the thyroid gland. Thus, PLAP is negatively expressed in most normal tissues compared to other tumor associated markers.

Example 9 expression of PLAP in Primary Colon tumors and Colon cancer cell lines

We used 106 primary colon cancer tumors, IHC staining with mouse PLAP antibody and found PLAP expression in 25 out of 106 samples, 23.8% of all colon cancer tumors. We also examined PLAP expression in 557 primary colon cancer tumors by R2 genomics analysis and visualization platform and correlated with patient outcomes (fig. 3). Survival of patients with high expression of PLAP was shorter than that of patients with low expression of PLAP, demonstrating that PLAP expression correlates with a poor prognosis for colon cancer. These data indicate that PLAP is overexpressed in primary colon cancer tumors.

In addition, we examined the PLAP mRNA levels of 117 colon cancer cell lines using microarray technology, and detected that 21.3% of the colon cancer cell lines expressed PLAP mRNA. We performed FACS analysis and detected PLAP in colon cancer cell lines (Lovo, Caco-2 and LS123 cell lines) with high PLAP mRNA expression (FIG. 4A). We detected very little PLAP expression in PLAP negative colon cancer cell lines (such as HCT116, HT-29 and SW620 cell lines) (FIG. 4B). Thus, PLAP mRNA and PLAP protein levels corresponded to each other (fig. 4B). To confirm the specificity of the PLAP antibody H17E2, we detected by BLI BLITZ analysis that its Kd recognizing the purified recombinant PLAP protein was 3.2 nM. The PLAP antibody H17E2 also recognized the PLAP protein expressed in 293 cells. Thus, PLAP is expressed in colon cancer and PLAP antibodies can detect PLAP antigen, suggesting that it may be useful for CAR-T therapy.

Example 10, PLAP-CAR-T cells specifically killed PLAP positive cells, but not PLAP negative cells.

We designed a second generation CAR construct using the mouse monoclonal PLAP antibody ScFv, CD 8a hinge, CD28 transmembrane and costimulatory domain, and CD3 activation domain (figure 2). We prepared lentiviral PLAP-CARs and mock CARs with intracellular protein ScFv and transduced T cells to generate CAR-T cells. PLAP-CAR-T cells expanded > 200-fold, similar to mock-CAR-T cells or T cells. CAR-T positive cells were detected by FACS with mouse FAB antibody (fig. 5A).

Detection of PLAP-CAR-T cells against PLAP positive target colon cancer cell lines using a real-time cytotoxicity assay (RTCA): lovo and LS-123; and PLAP negative colon cancer cell lines: killing by HT29 and HCT 116. PLAP-CAR-T cells had significant killing activity against Lovo and LS-123 colon cancer target cells, but not against PLAP-negative HCT116 and HT29 colon cancer cell lines, compared to normal T cells (FIG. 5B). Furthermore, all CAR-T cell lines secreted significant levels of IFN- γ against PLAP positive target colon cancer cells, but not against PLAP negative colon cancer cells (fig. 5C). There was also no significant secretion of IFN- γ for normal 293 and CHO cell lines (fig. 5C). These data show the specific functional activity of PLAP-CAR-T cells on PLAP positive colon cancer cell lines.

Example 11 humanized PLAP-CAR-T cells (h2 and h4) specifically kill PLAP positive cells

To improve the mPALP-CAR-T cells, we humanized the mouse PLAP ScFv and generated humanized PLAP-CAR cells (FIG. 2). Humanized PLAP h2 had 44.1% CAR positive cells and humanized PLAP h4 CAR-T cells had 50.6% CAR positive cells as detected by FACS using FAB antibody (FIG. 6A). To confirm the specificity of the PLAP-CAR-T cells for the PLAP antigen, we performed FACS using biotinylated PLAP recombinant protein (FIG. 6B). The biotinylated PLAP protein recognized PLAP-CAR as well as FAB antibodies, demonstrating that the humanized PLAP-ScFv specifically binds to the PLAP antigen (FIG. 6B).

The PLAP-CAR-T cells (h2 and h4) significantly killed PLAP positive cells, but not PLAP negative cells in RTCA assay compared to mock control CAR-T cells (fig. 6C). In addition, PLAP-CAR-T cells secreted significant levels of IFN- γ, IL-2, and IL-6 against PLAP-positive colon cancer cells, but did not secrete significant levels of IFN- γ, IL-2, and IL-6 against PLAP-negative colon cancer cells (FIG. 6D). These data indicate that humanized PLAP-CAR-T cells specifically and efficiently kill PLAP-positive colon cancer cells.

Example 12, humanized PLAP-CAR-T cells (h2 and h4) significantly reduced the growth of colon cancer xenograft tumors.

We analyzed PLAP-CAR-T cell efficacy in vivo in a model of Lovo xenografted mice (FIG. 7). NSG mice were injected subcutaneously with Lovo cancer cells and then with CAR-T cells on days 1, 7, and 13, respectively. Humanized PLAP h2 and PLAPh4-CAR-T cells significantly reduced Lovo xenograft tumor growth (fig. 7A). The humanized PLAP-CAR-T cells significantly reduced tumor size (FIG. 7B) and tumor weight (FIG. 7C). PLAP-CAR-T cells did not reduce mouse body weight, indicating that CAR-T cytotoxicity was negative. At day 16, human T cells and CAR-T cells were detected in mouse blood using anti-human CD3 antibody, demonstrating the persistence of humanized PLAP-CAR-T cells in vivo.

To test the toxicity of CAR-T cells, we analyzed several enzymes (AST, ALT, and amylase) from mouse sera (fig. 7D). PLAP-CAR-T cells had no toxic effect on these enzymes (FIG. 7D), indicating that PLAP-CAR-T cells were not toxic in vivo. Therefore, the PLAP-CAR-T cell has the characteristics of high efficiency and no toxicity in vivo.

Example 13 humanized PLAP-CAR-T cells (h5) specifically killed PLAP positive cells

Real-time cytotoxicity assay (RCTA) and IFN- γ assay were performed according to example 1.

FIG. 8A shows that PLAP h5-CAR-T cells significantly killed PLAP positive colon cancer cells (Caco-2 cells and Lovo cells) compared to using T cells and target cells alone. RTCA showed that PLAP h5-CAR-T cells (h5) did not kill PLAP negative colon cancer cells (HCT 116). FIG. 8B shows that PLAP h5-CAR-T cells secreted significantly higher levels of IFN- γ against PLAP-positive colon cancer cells (Caco-2 cells and Lovo cells), but not against PLAP-negative colon cancer cells (HCT 116).

These data indicate that humanized PLAP h5-CAR-T cells specifically and efficiently killed PLAP-positive colon cancer cells and secreted IFN- γ specifically against PLAP-positive colon cancer cell lines.

Example 14, PLAP-CAR-T cells in combination with checkpoint inhibitors can increase the activity of CAR-T cells.

After co-culturing hPLAP-CAR-T cells and colon cancer target cells for 24 hours, we detected PDL-1 expression on colon cancer target cells in response to hPLAP-CAR-T cells (fig. 9A). We also used IFN- γ (an agent known to induce PDL-1 in cancer cells) [35] as a positive control for PDL-1 induced expression. PLAP negative cells HT29 and HCT116 cells activated PDL-1 in response to hPLAP-CAR-T cells, similar to their responses to T cells, mock CAR-T cells, and IFN- γ (FIG. 9A). In contrast, PLAP-positive Lovo cells significantly upregulated PDL-1 in response to CAR-T cells compared to responses to T cells and mock CAR-T cells, and were higher than the response to IFN- γ (FIG. 9A). Both Caco-2 cells did not activate PDL-1 in response to IFN- γ and PLAP-CAR-T cells (FIG. 9A). These data indicate that CAR-T cells caused significant upregulation of PDL-1 in PLAP-positive cancer cells, and that different PLAP-positive cancer cells did not have upregulated PDL-1 levels, and that PLAP-CAR-T cells did not cause significant upregulation of PDL-1 in PLAP-negative colon cancer cells, compared to mock CAR-T cells and untransduced T cells.

Since the response of Lovo cells to PLAP-CAR-T cells was more able to activate PDL-1 than IFN- γ (FIG. 9A), we focused on PDL-1 upregulation in this cell line in more detail. Expression of PDL-1 was low at 1 and 4 hours after CAR-T cell addition and caused a significant upregulation of PDL-1 at 24 hours (fig. 9B), the level of which did not increase more at 49 hours (not shown). We added different doses of hPLAP-CAR-T cells to Lovo cells, co-cultured for 24 hours, and examined PDL-1 upregulation in Lovo colon cancer target cells for a dose-dependent response to hPLAP-CAR-T cells (fig. 9C). PDL-1 was significantly upregulated even when small doses of PLAP-CAR-T cells were added to the targeted cancer cells (effector to target ratio, E: T ═ 0.3:1) (fig. 9C).

To assess the upregulation of checkpoint proteins in CAR-T cells after co-incubation with colon cancer cells, we tested several checkpoint proteins: PD-1, TIM-3, TIGIT and LAG-3. Only PD-1 was significantly upregulated in CAR-T cells after co-culture with positive colon cancer target cells compared to before co-culture (fig. 9D). PD-1 protein levels were upregulated after co-culture with PLAP positive cells (Caco-2 and Lovo cells), but not after co-culture with PLAP negative HCT116 and HT29 cells (FIG. 9D). LAG-3 was also significantly upregulated after co-culture with the Lovo cancer cell line (fig. 9E). Thus, the PLAP-positive target cells up-regulate PDL-1, and PLAP-CAR-T cells up-regulate the expression of PD-1 or LAG-3.

To test checkpoint inhibitors in combination with PLAP-CAR-T cells, we combined PLAP-h2-CAR-T cells with either PD-1 antibody or LAG-3 antibody and performed RTCA analysis with Lovo target cells (fig. 9F). The combined use of PLAP-CAR-T cells and PD1 or LAG3 antibody significantly upregulated cytotoxicity compared to either PLAP-CAR-T cells using the same type of antibody alone or to PD-1 or LAG3 antibody alone (fig. 9F). In Lovo cells, PLAP-CAR-T cells in combination with PD-1 antibody or LAG-3 antibody significantly increased IFN- γ secretion compared to each individual treatment (fig. 9G). This data was confirmed by the increased secretion of IFN-. gamma.also observed when PLAP-CAR-T cells and PD-1 antibody were co-cultured with target cells that were up-regulated by IFN-g pre-treatment PDL-1 prior to treatment (not shown). Thus, the use of hPLAP-CAR-T cells in combination with checkpoint inhibitors (PD1 antibody or LAG3 antibody) is an effective method to induce PLAP-CAR-T cells to increase IFN- γ secretion against colon cancer.

Reference to the literature

1.Eshhar,Z.,et al.Cancer J 2014,20,123-126.

2.Maus,M.V.,et al.Clin Cancer Res 2016,22,1875-1884.

3.Locke,F.L.,et al.Lancet Oncol 2019,20,31-42.

4.Locke,F.L.,et al.Mol Ther 2017,25,285-295.

5.Grupp,S.A.Best Pract Res Clin Haematol 2014,27,222-228.

6.Eshhar,Z.,et al.Br J Cancer Suppl 1990,10,27-29.

7.Golubovskaya,V.,et al.Cancers(Basel)2016,8.

8.Golubovskaya,V.Cancers(Basel)2017,9.

9.June,C.H.,et al.Science 2018,359,1361-1365.

10.Fraietta,J.A.,et al.Nature 2018,558,307-312.

11.Fraietta,J.A.,et al.Nat Med 2018,24,563-571.

12.Fry,T.J.,et al.Nat Med 2018,24,20-28.

13.Carpenter,R.O.,et al.Clin Cancer Res 2013,19,2048-2060.

14.Cohen,A.D.,et al.J Clin Invest 2019,130.

15.Anurathapan,U.,et al.Cytotherapy 2014,16,713-733.

16.Beatty,G.L.,et al.Oncoimmunology 2014,3,e970027.

17.Chen,N.,et al.Oncoimmunology 2017,6,e1273302.

18.Gilham,D.E.,et al.Trends Mol Med 2012,18,377-384.

19.Durbin,H.,et al.Int J Cancer Suppl 1988,2,50-58.

20.Tucker,D.F.,et al.Br J Cancer 1985,51,631-639.

21.Epenetos,A.A.,et al.Br J Cancer 1985,51,641-644.

22.Epenetos,A.A.,et al.Lancet 1985,2,350-353.

23.Orsaria,M.,et al.Cancer Biomark 2016,17,479-486.

24.Vergote,I.B.,et al.Tumour Biol 1992,13,168-174.

25.Harmenberg,U.,et al.Tumour Biol 1991,12,237-248.

26.Sandfeld-Paulsen,B.,et al.Mol Oncol 2016,10,1595-1602.

27.Kalyan,A.,et al.J Gastrointest Oncol 2018,9,160-169.

28.Bacac,M.,et al.Clin Cancer Res 2016,22,3286-3297.

29.Hsia,L.T.,et al.Proc Natl Acad Sci U S A 2016,113,E2162-2171.

30.Berahovich,R.,et al.Cancers(Basel)2018,10.

31.Golubovskaya,V.,et al.Cancers(Basel)2017,9.

32.Almagro,J.C.,et al.Front Biosci 2008,13,1619-1633.

33.Gilliland,G.L.,et al.Methods Mol Biol 2012,841,321-349.

34.Berahovich,R.,et al.Front Biosci(Landmark Ed)2017,22,1644-1654.

35.Rozman,P.,et al.Cytokine Growth Factor Rev 2018,41,40-53.

36.Waks,A.G.,et al.Pathol Res Pract 2019,215,251-255.

38.Kosmas,C.,et al.Oncology 1998,55,435-446.

39.Muensch,H.A.,et al.Cancer 1986,58,1689-1694.

40.Dunn,E.F.,et al.Oncogene 2011,30,561-574.