Cellobiohydrolase variants and polynucleotides encoding same

文档序号：1668322 发布日期：2019-12-31 浏览：30次中文

阅读说明：本技术 纤维二糖水解酶变体和编码它们的多核苷酸 (Cellobiohydrolase variants and polynucleotides encoding same ) 是由 K·博尔奇 K·詹森 K·克罗赫 B·麦克布拉耶 P·韦斯特 J·卡尔 J·奥尔森 T 于 2014-03-07 设计创作，主要内容包括：本发明涉及纤维二糖水解酶变体和编码它们的多核苷酸。本发明还涉及编码这些变体的多核苷酸；包括这些多核苷酸的核酸构建体、载体以及宿主细胞；以及使用这些变体的方法。(The present invention relates to cellobiohydrolase variants and polynucleotides encoding them. The invention also relates to polynucleotides encoding these variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using these variants.)

1. A variant of a parent cellobiohydrolase, which variant has been deleted at a position corresponding to position 199 of the mature polypeptide of SEQ ID No. 2 or has been substituted at a position corresponding to position 198 of the mature polypeptide of SEQ ID No. 2, wherein said substitution at a position corresponding to position 198 is with Ala, wherein the variant has cellobiohydrolase activity and wherein the variant has at least 99% but less than 100% sequence identity to the mature polypeptide of the parent cellobiohydrolase and wherein the parent cellobiohydrolase is selected from the group consisting of:

(a) a polypeptide having at least 99% sequence identity to a mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20, 22 or 73; and

(b) mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20, 22 or 73.

2. The variant of claim 1, which further comprises a substitution at a position corresponding to position 197 of the mature polypeptide of SEQ ID NO 2, wherein said substitution at a position corresponding to position 197 is with Ala.

3. The variant of claim 1, which further comprises a substitution at a position corresponding to position 200 of the mature polypeptide of SEQ ID NO 2, wherein the substitution at the position corresponding to position 200 is with Ala, Gly or Trp.

4. The variant of any of claims 1-3, wherein the parent is a hybrid or chimeric polypeptide in which the carbohydrate binding domain of the parent is replaced by a different carbohydrate binding domain or a fusion protein in which a heterologous carbohydrate binding domain is fused to the parent.

5. The variant of any of claims 1-4, which has increased specific properties relative to the parent.

6. An isolated polynucleotide encoding the variant of any one of claims 1-5.

7. A method of producing a cellobiohydrolase variant, the method comprising: (a) cultivating a host cell comprising the polynucleotide of claim 6 under conditions suitable for expression of the variant, and optionally (b) recovering the variant.

8. A method of producing the variant of any of claims 1-5, the method comprising: (a) cultivating a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant; and optionally (b) recovering the variant.

9. A method for obtaining a cellobiohydrolase variant, the method comprising: (a) introducing a deletion in a parent cellobiohydrolase at a position corresponding to position 199 of the mature polypeptide of SEQ ID No. 2, or a substitution at a position corresponding to position 198 of the mature polypeptide of SEQ ID No. 2, wherein the substitution at the position corresponding to position 198 is with Ala, and wherein the variant has cellobiohydrolase activity, and optionally (b) recovering the variant, and wherein the parent cellobiohydrolase is selected from the group consisting of:

(a) a polypeptide having at least 99% sequence identity to a mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20, 22 or 73; and

(b) mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20, 22 or 73.

10. The method of claim 9, further comprising substituting the parent cellobiohydrolase at a position corresponding to position 197 of the mature polypeptide of SEQ ID No. 2, wherein the substitution at the position corresponding to position 197 is with Ala.

11. The method of claim 9, further comprising substituting the parent cellobiohydrolase at a position corresponding to position 200 of the mature polypeptide of SEQ ID NO 2, wherein the substitution at the position corresponding to position 200 is with Ala, Gly or Trp.

12. A composition, whole broth formulation, or cell culture composition comprising the variant of any of claims 1-5.

13. A method for degrading a cellulosic material, the method comprising: treating the cellulosic material with an enzyme composition in the presence of the variant of any one of claims 1-5.

14. A method for producing a fermentation product, the method comprising:

(a) saccharifying a cellulosic material with an enzyme composition in the presence of the variant of any of claims 1-5;

(b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce a fermentation product; and is

15. A method of fermenting a cellulosic material, the method comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition in the presence of the variant of any of claims 1-5.

Technical Field

The present invention relates to cellobiohydrolase variants, polynucleotides encoding the variants, and methods of making and using the variants.

Background

Summary of The Invention

The present invention relates to isolated cellobiohydrolase variants comprising an alteration at one or more of positions 197, 198, 199 and 200 of the mature polypeptide corresponding to SEQ ID No. 2, wherein the alteration at one or more of positions corresponding to positions 197, 198 and 200 is a substitution and the alteration at position corresponding to position 199 is a deletion, and wherein the variants have cellobiohydrolase activity.

The invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing such variants.

The present invention also relates to methods of producing a fermentation product, comprising: (a) saccharifying a cellulosic material with an enzyme composition in the presence of a cellobiohydrolase variant of the present invention; (b) fermenting the saccharified cellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

The present invention also relates to methods of fermenting a cellulosic material, the methods comprising: fermenting the cellulosic material with one or more (e.g., several) fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition in the presence of the cellobiohydrolase variant of the present invention. In one aspect, fermenting the cellulosic material produces a fermentation product. In another aspect, the methods further comprise recovering the fermentation product from the fermentation.

In particular, the invention relates to the following:

1. a variant cellobiohydrolase which has a variant cellobiohydrolase activity at a nucleotide sequence corresponding to SEQ ID NO:2 at one or more of positions 197, 198, 199, and 200, wherein the change at one or more of positions 197, 198 and 200 is a substitution and the change at the position corresponding to position 199 is a deletion, wherein the variant has cellobiohydrolase activity and wherein the variant has at least 60% of the mature polypeptide of the parent cellobiohydrolase, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity.

2. The variant of item 1, wherein the parent cellobiohydrolase is selected from the group consisting of:

(a) a polypeptide having at least 60% sequence identity to a mature polypeptide of SEQ ID No. 2, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20, or SEQ ID No. 22;

(b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19, or SEQ ID NO 21, or the full-length complement thereof;

(c) a polypeptide encoded by a polynucleotide having at least 60% identity to the mature polypeptide coding sequence of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 7, SEQ ID No.9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, or SEQ ID No. 21;

(d) mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20, or 22; and

(e) 2, 8, 10, 12, 14, 16, 18, 20, or 22 having cellobiohydrolase activity.

3. The variant of item 1 or 2, which variant comprises a substitution at a position corresponding to position 197.

4. The variant of claim 3, wherein the substitution is with Ala.

5. The variant of any of claims 1-4, which comprises a substitution at a position corresponding to position 198.

6. The variant of claim 5, wherein the substitution is with Ala.

7. The variant of any of items 1-6, which comprises a substitution at a position corresponding to position 200.

8. The variant of claim 7, wherein the substitution is with Ala, Gly, or Trp.

9. The variant of any of items 1-8, which comprises a deletion at a position corresponding to position 197.

10. The variant of any of items 1-9, which comprises one or more alterations at the position corresponding to the mature polypeptide of SEQ ID No. 2 selected from the group consisting of: N197A, N198A, a199, and N200A, G, W.

11. The variant of any of claims 1-10, wherein the parent is a hybrid or chimeric polypeptide in which the carbohydrate binding domain of the parent is replaced with a different carbohydrate binding domain or a fusion protein in which a heterologous carbohydrate binding domain is fused to the parent.

12. The variant of any of items 1-11, which has increased specific performance relative to the parent.

13. An isolated polynucleotide encoding the variant of any of claims 1-12.

14. A method of producing a cellobiohydrolase variant, the method comprising: (a) culturing a host cell comprising the polynucleotide of item 13 under conditions suitable for expression of the variant, and optionally (b) recovering the variant.

15. A transgenic plant, plant part, or plant cell transformed with the polynucleotide of claim 13.

16. A method of producing the variant of any of items 1-12, the method comprising: (a) cultivating a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant; and optionally (b) recovering the variant.

17. A method for obtaining a cellobiohydrolase variant, the method comprising: (a) introducing an alteration into a parent cellobiohydrolase at one or more positions corresponding to positions 197, 198, 199 and 200 of the mature polypeptide of SEQ ID No. 2, wherein the alteration at one or more positions corresponding to positions 197, 198 and 200 is a substitution and the alteration at position corresponding to position 199 is a deletion, and wherein the variant has cellobiohydrolase activity, and optionally (b) recovering the variant.

18. A composition, whole broth formulation or cell culture composition comprising the variant of any of claims 1-12.

19. A method for degrading a cellulosic material, the method comprising: treating the cellulosic material with an enzyme composition in the presence of the variant of any one of claims 1-12.

20. A method for producing a fermentation product, the method comprising:

(a) saccharifying a cellulosic material with an enzyme composition in the presence of the variant of any of claims 1-12;

(b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce a fermentation product; and is

21. A method of fermenting a cellulosic material, the method comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition in the presence of the variant of any of items 1-12.

Variants

In one embodiment, the variant has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the parent cellobiohydrolase or mature polypeptide thereof.

In another embodiment, the variant has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID No. 2.

In one aspect, the number of changes in a variant of the invention is 1-4, e.g., 1, 2, 3, or 4 changes. In another aspect, the number of substitutions in a variant of the invention is 1-3, e.g., 1, 2, or 3 substitutions. In another aspect, the number of deletions in a variant of the invention is 1 deletion.

In another aspect, a variant comprises an alteration at one or more of positions 197, 198, 199, and 200 of the mature polypeptide corresponding to SEQ ID No. 2, wherein the alteration at one or more of positions corresponding to positions 197, 198, and 200 is a substitution and the alteration at the position corresponding to position 199 is a deletion. In another aspect, a variant comprises an alteration at two positions corresponding to any of positions 197, 198, 199, and 200 of the mature polypeptide of SEQ ID No. 2, wherein the alteration at one or more of positions corresponding to positions 197, 198, and 200 is a substitution and the alteration at the position corresponding to position 199 is a deletion. In another aspect, a variant comprises an alteration at three positions corresponding to any of positions 197, 198, 199, and 200 of the mature polypeptide of SEQ ID No. 2, wherein the alteration at one or more of positions corresponding to positions 197, 198, and 200 is a substitution and the alteration at the position corresponding to position 199 is a deletion. In another aspect, a variant comprises a substitution at each of positions corresponding to positions 197, 198 and 200 and a deletion at a position corresponding to position 199.

In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 197. In another aspect, the amino acid at the position corresponding to position 197 is substituted with Ala, Arg, Asn, Asp, Cys, gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises or consists of the substitution N197A of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 198. In another aspect, the amino acid at a position corresponding to position 198 is substituted with Ala, Arg, Asn, Asp, Cys, gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala. In another aspect, the variant comprises or consists of the substitution N198A of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of a deletion at a position corresponding to position 199. In another aspect, the amino acid at a position corresponding to position 199 is Ala, Arg, Asn, Asp, Cys, gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably Ala. In another aspect, the variant comprises or consists of deletion a199 of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 200. In another aspect, the amino acid at the position corresponding to position 200 is substituted with Ala, Arg, Asn, Asp, Cys, gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala, Gly, or Trp. In another aspect, the variant comprises or consists of the substitution N200A, G, W of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of a change at a position corresponding to positions 197 and 198, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 197 and 199, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 197 and 200, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 198 and 199, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 198 and 200, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 199 and 200, such as those described above.

In another aspect, the variant includes or consists of alterations at positions corresponding to positions 197, 198 and 199, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 197, 198 and 200, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 197, 199, and 200, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 198, 199, and 200, such as those described above.

In another aspect, the variant comprises or consists of alterations at positions corresponding to positions 197, 198, 199, and 200, such as those described above.

In another aspect, the variant comprises or consists of one or more alterations selected from the group consisting of: N197A, N198A, a199, and N200A, G, W.

In another aspect, the variant comprises or consists of alteration N197A + N198A of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of the alteration N197A + a199 of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of alterations N197A + N200A, G, W of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of alteration N198A + a199 of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of alterations N198A + N200A, G, W of the mature polypeptide of SEQ ID NO. 2.

In another aspect, the variant comprises or consists of alterations a199 × N200A, G, W of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of the alteration N197A + N198A + a199 of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of the alterations N197A + N198A + N200A, G, W of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of the alterations N197A + a199 + N200A, G, W of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of alterations N198A + a199 + N200A, G, W of the mature polypeptide of SEQ ID No. 2.

In another aspect, the variant comprises or consists of the alterations N197A + N198A + a199 + N200A, G, W of the mature polypeptide of SEQ ID No. 2.

In one embodiment, the variant comprises or consists of SEQ ID No. 6 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO 45 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO 47 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO. 49 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO 51 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO 66 or a mature polypeptide thereof.

In another embodiment, the variant comprises or consists of SEQ ID NO 76 or a mature polypeptide thereof.

These variants may further comprise one or more additional alterations, e.g., substitutions, insertions, or deletions, at one or more (e.g., several) other positions.

These amino acid changes may be of a minor nature, i.e., conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; typically a small deletion of 1-30 amino acids; small amino-or carboxy-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing the net charge or another function, such as a polyhistidine segment (trace), an epitope, or a binding domain.

Examples of conservative substitutions are within the following group: basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generally alter specific activity are known in the art and are described, for example, by h. novalac (h. neurath) and r.l. hill (r.l.hill), 1979, in proteins (the proteins), Academic Press, new york. Common substitutions are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

Alternatively, the amino acid change has the property of altering the physicochemical properties of the polypeptide. For example, amino acid changes can improve the thermostability of the polypeptide, change substrate specificity, change the pH optimum, and the like.

These variants may further or even further include one or more (e.g., several) substitutions at positions corresponding to the positions disclosed in WO 2011/050037, WO 2011/050037, WO 2005/02863, WO 2005/001065, WO 2004/016760, and U.S. Pat. No. 7,375,197, which are incorporated herein in their entirety.

Essential amino acids in polypeptides can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Canning Han (Cunningham) and Weirs (Wells), 1989, Science 244: 1081-1085). In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the resulting mutant molecules are tested for cellobiohydrolase activity to identify amino acid residues that are critical to the activity of the molecule. See also Hilton (Hilton) et al, 1996, J.Biol.chem.)271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by combining mutations in the putative contact site amino acids, such as by physical analysis of the structure as determined by techniques such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling. See, for example, German Fries (de Vos) et al, 1992, Science 255: 306-); smith (Smith) et al, 1992, journal of molecular biology (J.mol.biol.)224: 899-904; wuledaville et al, 1992, FeBS Lett et al, 309:59-64, Happy Federation of European Biochemical society. The identification of essential amino acids can also be inferred from alignment with related polypeptides.

These variants may consist of 370 to 507 amino acids, e.g., 370 to 380, 380 to 390, 390 to 400, 400 to 410, 410 to 420, 420 to 430, 430 to 440, 450 to 460, 460 to 470, 470 to 480, 480 to 490, 490 to 500, or 500 to 507 amino acids.

In each of the above-described embodiments, the variant of the invention may be a hybrid polypeptide (chimera) in which a region of the variant is replaced with a region of another polypeptide. In one aspect, the region is a carbohydrate-binding domain. The carbohydrate-binding domain of the variant may be replaced by another (heterologous) carbohydrate-binding domain.

In each of the above-described embodiments, the variant of the invention may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or C-terminus of the variant. In one aspect, the other polypeptide is a carbohydrate-binding domain. The catalytic domain of the variants of the invention without a carbohydrate binding domain may be fused to one carbohydrate binding domain. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide encoding a variant of the present invention. Techniques for producing fusion polypeptides are known in the art and include ligating the coding sequences encoding the polypeptides such that they are in frame and expression of the fusion polypeptide is under the control of the same promoter or promoters and terminators. Fusion polypeptides can also be constructed using intein techniques in which the fusion polypeptide is produced post-translationally (Cooper et al, 1993, J. European society of molecular biology (EMBO J.)12: 2575-.

The fusion polypeptide may further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved, thereby releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in the following documents: martin (Martin) et al, 2003, journal of Industrial microbiology and Biotechnology (J.Ind.Microbiol.Biotechnol.)3: 568-576; svetina et al, 2000, J.Biotechnol., 76: 245-; Lamussian-Wilson et al, 1997, applied and environmental microbiology (apple. environ. Microbiol.)63: 3488-; ward (Ward) et al, 1995, Biotechnology (Biotechnology)13: 498-503; and Borrelas (Contreras) et al, 1991, Biotechnology 9: 378-; eton et al, 1986, Biochemistry (Biochemistry)25: 505-; coriins-Racie (Collins-Racie), et al, 1995, Biotechnology 13: 982-; carte (Carter) et al, 1989, protein: structure, Function and Genetics (Proteins: Structure, Function, and Genetics)6: 240-; and Stevens (Stevens), 2003, Drug Discovery World (Drug Discovery World)4: 35-48.

In one embodiment, the variant is a hybrid or chimeric polypeptide in which the carbohydrate-binding domain of the variant is replaced by a different carbohydrate-binding domain. In another embodiment, the variant is a fusion protein in which a heterologous carbohydrate binding domain is fused to the variant. In one aspect, the carbohydrate binding domain is fused to the N-terminus of the variant. In another aspect, the carbohydrate-binding domain is fused to the C-terminus of the variant.

In one embodiment, the variant has an increased specific performance as compared to the parent enzyme.

Parent cellobiohydrolases

The parent cellobiohydrolase may be any cellobiohydrolase I.

In one embodiment, the parent cellobiohydrolase may be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID No. 2; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No. 1, SEQ ID No. 3, or SEQ ID No. 4, or the full complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO: 4.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO. 8; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No. 7, or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO. 7.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO. 10; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No.9, or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO. 9.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO 12; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No. 11 or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO. 11.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO. 14; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID NO:13 or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO 13.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 16; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No. 15 or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO. 15.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO. 18; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID No. 17, or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO 17.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 20; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID NO:19 or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO 19.

In another embodiment, the parent cellobiohydrolase may also be (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 22; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions to the mature polypeptide coding sequence of SEQ ID NO:21, or the full-length complement thereof; or (c) a polypeptide encoded by a polynucleotide having at least 60% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 21.

In one aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 2, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 2 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 8, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 8 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 10, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 10 by up to 10 amino acids, e.g., 1, 2, 3,4, 5, 6, 7, 8, 9, or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 12, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 12 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 14, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 14 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 16, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 16 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 18, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1, 2, 3,4, 5, 6, 7, 8, 9, or 10, from the mature polypeptide of SEQ ID No. 18.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 20, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1, 2, 3,4, 5, 6, 7, 8, 9, or 10, from the mature polypeptide of SEQ ID NO: 20.

In another aspect, the parent has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID No. 22, which mature polypeptide has cellobiohydrolase activity. In another aspect, the amino acid sequence of the parent differs from the mature polypeptide of SEQ ID No. 22 by up to 10 amino acids, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO. 2. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO. 2. In another aspect, the parent comprises or consists of amino acids 1 to 497 of SEQ ID NO. 2.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO 8. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO 8. In another aspect, the parent comprises or consists of amino acids 1 to 506 of SEQ ID NO. 8.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO. 10. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO. 10. In another aspect, the parent comprises or consists of amino acids 1 to 437 of SEQ ID NO. 10.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO 12. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO 12. In another aspect, the parent comprises or consists of amino acids 1 to 437 of SEQ ID No. 12.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO. 14. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO. 14. In another aspect, the parent comprises or consists of amino acids 1 to 507 of SEQ ID NO. 14.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO 16. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO 16. In another aspect, the parent comprises or consists of amino acids 1 to 507 of SEQ ID NO 16.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO 18. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO 18. In another aspect, the parent comprises or consists of amino acids 1 to 437 of SEQ ID No. 18.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO. 20. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO. 20. In another aspect, the parent comprises or consists of amino acids 1 to 430 of SEQ ID NO. 20.

In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO. 22. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO. 22. In another aspect, the parent comprises or consists of amino acids 1 to 511 of SEQ ID NO 22.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 2, which fragment contains at least 420 amino acid residues, such as at least 445 amino acid residues or at least 470 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 8, which fragment contains at least 430 amino acid residues, such as at least 455 amino acid residues or at least 480 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 10, which fragment contains at least 380 amino acid residues, such as at least 400 amino acid residues or at least 420 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 12, which fragment contains at least 380 amino acid residues, such as at least 400 amino acid residues or at least 420 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO. 14, which fragment contains at least 430 amino acid residues, such as at least 455 amino acid residues or at least 480 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 16, which fragment contains at least 430 amino acid residues, such as at least 455 amino acid residues or at least 480 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 18, which fragment contains at least 380 amino acid residues, such as at least 400 amino acid residues or at least 420 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO 20, which fragment contains at least 370 amino acid residues, such as at least 390 amino acid residues or at least 410 amino acid residues.

In another aspect, the parent is a fragment of the mature polypeptide of SEQ ID NO. 22, which fragment contains at least 435 amino acid residues, such as at least 460 amino acid residues or at least 485 amino acid residues.

In another aspect, the parent is encoded by a polynucleotide that hybridizes under very low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 1, SEQ ID NO. 3, or SEQ ID NO. 4; or its full-length complement (Sambrook et al, 1989, Molecular Cloning: A laboratory Manual, second edition, Cold Spring Harbor, N.Y.).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 7; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 9; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 11; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 13; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 15; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 17; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 19; or its full-length complement (Sambrook et al, 1989, supra).

In another aspect, the parent is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO. 21; or its full-length complement (Sambrook et al, 1989, supra).

The polynucleotides of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO.9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, or SEQ ID NO. 21, or subsequences thereof, and the polypeptides of SEQ ID NO. 2, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, or SEQ ID NO. 22, or fragments thereof, can be used to design nucleic acid probes for identifying and cloning DNA encoding parents of strains from different genera or species according to methods well known in the art. In particular, such probes can be used to hybridize to genomic DNA or cDNA of a cell of interest according to standard southern blotting procedures in order to identify and isolate the corresponding gene therein. Such probes may be significantly shorter than the complete sequence, but should be at least 15, such as at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, for example at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides or at least 900 nucleotides in length. Both DNA and RNA probes may be used. The probes are typically labeled (e.g., with)³²P、³H、³⁵S, biotin, or avidin) to detect the corresponding gene. The present invention encompasses such probes.

Genomic DNA or cDNA libraries prepared from such other strains may be screened for DNA that hybridizes with the probes described above and encodes one parent. Genomic or other DNA from such other strains may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the library or isolated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. To identify clones or DNAs that hybridize with SEQ ID NO 1,3, 4, 7, 9, 11, 13, 15, 17, 19 or 21 or subsequences thereof, vector material is used in a southern blot.

For the purposes of the present invention, hybridization indicates that the polynucleotide hybridizes under very low to very high stringency conditions with labeled nucleic acid probes corresponding to: (i) 1,3, 4, 7, 9, 11, 13, 15, 17, 19, or 21 SEQ ID NO; (ii) mature polypeptide coding sequence of SEQ ID NO 1,3, 4, 7, 9, 11, 13, 15, 17, 19 or 21; (iii) its full-length complement; or (iv) subsequences thereof. Molecules that hybridize to the nucleic acid probe under these conditions can be detected using, for example, an X-ray film or any other detection means known in the art.

In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19, or SEQ ID NO 21. In another aspect, the nucleic acid probe is nucleotides 52 to 1673 of SEQ ID NO. 1, nucleotides 52 to 1542 of SEQ ID NO. 3, nucleotides 52 to 1542 of SEQ ID NO. 4, nucleotides 79 to 1596 of SEQ ID NO. 7, nucleotides 52 to 1371 of SEQ ID NO.9, nucleotides 55 to 1482 of SEQ ID NO. 11, nucleotides 76 to 1596 of SEQ ID NO. 13, nucleotides 76 to 1596 of SEQ ID NO. 15, nucleotides 55 to 1504 of SEQ ID NO. 17, nucleotides 61 to 1350 of SEQ ID NO. 19, or nucleotides 55 to 1587 of SEQ ID NO. 21. In another aspect, the nucleic acid probe is a polypeptide encoding SEQ ID NO 2, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, or SEQ ID NO 22; a mature polypeptide thereof; or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19, or SEQ ID NO 21.

In another aspect, the parent is encoded by a polynucleotide having at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID No. 1, SEQ ID No. 3, or SEQ ID No. 4.

In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20 or 22.

The parent may also be a hybrid or chimeric polypeptide in which a region of the parent is replaced by a region of another polypeptide. In one aspect, the region is a carbohydrate-binding domain. The parent carbohydrate binding domain may be replaced by another (heterologous) carbohydrate binding domain.

The parent may also be a fusion polypeptide or cleavable fusion polypeptide wherein the other polypeptide is fused at the N-terminus or C-terminus of the parent. In one aspect, the other polypeptide is a carbohydrate-binding domain. The catalytic domain of the parent without the carbohydrate binding domain may be fused to one carbohydrate binding domain. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide encoding a parent. Techniques for producing fusion polypeptides are described above. The fusion polypeptide may further comprise a cleavage site between the two polypeptides, as described above.

In one embodiment, the parent is a hybrid polypeptide in which the carbohydrate binding domain of the parent is replaced with a different carbohydrate binding domain. In another embodiment, the parent is a fusion protein in which a heterologous carbohydrate binding domain is fused to the parent without a carbohydrate binding domain. In one aspect, the carbohydrate binding domain is fused to the N-terminus of the parent. In another aspect, the carbohydrate binding domain is fused to the C-terminus of the parent. In another aspect, the fusion protein comprises or consists of SEQ ID NO. 73 or a mature polypeptide thereof. SEQ ID NO 73 is encoded by SEQ ID NO 72.

The parent may be obtained from a microorganism of any genus. For the purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the parent encoded by the polynucleotide is produced by the source or by a strain in which the polynucleotide from the source has been inserted. In one aspect, the parent is secreted extracellularly.

The parent may be a filamentous fungal cellobiohydrolase. For example, the parent may be a filamentous fungal cellobiohydrolase, such as an Aspergillus, Chaetomium, Chrysosporium, myceliophthora, Penicillium, Talaromyces, Thermoascus, or Trichoderma cellobiohydrolase.

In one aspect, the parent is Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chaetomium thermophilum, Chrysosporium angustifolia (Chrysosporium inops), Chrysosporium keratinophilum (Chrysosporium keratinophilum), Chrysosporium lucknowense (Chrysosporium lucknowense), Chrysosporium modafinium (Chrysosporium merdarium), Chrysosporium hirsutum (Chrysosporium pannicola), Chrysosporium japonicum (Chrysosporium queenslandicum), Chrysosporium tropicalium (Chrysosporium tropicum), Chrysosporium striatum (Chrysosporium zonatum), myceliophthora thermophila, Penicillium mermanii, Penicillium funiculosum, Talaromyces latus (Talaromyces Chrysosporium), Trichoderma viride, Trichoderma longibrachiatum, or Trichoderma longibrachiatum.

In another aspect, the parent is a Trichoderma reesei cellobiohydrolase, e.g., a cellobiohydrolase of SEQ ID NO:2 or a mature polypeptide thereof.

In another aspect, the parent is an Aspergillus fumigatus cellobiohydrolase, such as the cellobiohydrolase of SEQ ID NO 8 or its mature polypeptide.

In another aspect, the parent is a Thermoascus aurantiacus cellobiohydrolase, such as that of SEQ ID NO:10 or a mature polypeptide thereof.

In another aspect, the parent is a Penicillium emersonii or Rasamsonia emersonii cellobiohydrolase, e.g., a cellobiohydrolase of SEQ ID NO:12 or a mature polypeptide thereof.

In another aspect, the parent is a Talaromyces leycettanus cellobiohydrolase, such as the cellobiohydrolase of SEQ ID NO:14 or a mature polypeptide thereof.

In another aspect, the parent is another Talaromyces leycettanus cellobiohydrolase, such as the cellobiohydrolase of SEQ ID NO:16 or a mature polypeptide thereof.

In another aspect, the parent is a Talaromyces myceliophthora cellobiohydrolase, e.g., a cellobiohydrolase of SEQ ID NO:18 or a mature polypeptide thereof.

In another aspect, the parent is another myceliophthora thermophila cellobiohydrolase, e.g., a cellobiohydrolase of SEQ ID NO:20 or a mature polypeptide thereof.

In another aspect, the parent is another Chaetomium thermophilum cellobiohydrolase, such as that of SEQ ID NO:22 or its mature polypeptide.

It will be understood that for the above mentioned species, the invention encompasses both the complete and incomplete states (perfect and incomplete states), as well as other taxonomic equivalents, such as anamorphs, regardless of the species name they know. Those of ordinary skill in the art will readily recognize the identity of appropriate equivalents.

Strains of these species are readily available to the public at a number of culture collections, such as the American Type Culture Collection (ATCC), the German Collection of microorganisms and cell cultures (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, DSMZ), the Netherlands collection of species (CBS), and the northern regional research center of the American Collection of agricultural research species (NRRL).

The parent may be identified and obtained from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.) using the above-mentioned probes. Techniques for the direct isolation of microorganisms and DNA from the natural living environment are well known in the art. The polynucleotide encoding the parent can then be obtained by similarly screening a genomic DNA or cDNA library of another microorganism or mixed DNA sample. Once a polynucleotide encoding a parent is detected with one or more probes, the polynucleotide can be isolated or cloned by using techniques known to those of ordinary skill in the art (see, e.g., sambrook et al, 1989, supra).

Preparation of variants

The present invention also relates to methods for obtaining a cellobiohydrolase variant, comprising: (a) introducing an alteration into a parent cellobiohydrolase at one or more positions corresponding to positions 197, 198, 199 and 200 of the mature polypeptide of SEQ ID No. 2, wherein the alteration at one or more positions corresponding to positions 197, 198 and 200 is a substitution and the alteration at position corresponding to position 199 is a deletion, and wherein the variant has cellobiohydrolase activity; and optionally (b) recovering the variant.

These variants can be made using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, and the like.

Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercially available kits that can be used to prepare variants.

Site-directed mutagenesis can be achieved in vitro by using PCR involving oligonucleotide primers containing the desired mutation. In vitro site-directed mutagenesis may also be performed by cassette mutagenesis, which involves cleavage by a restriction enzyme at a site in a plasmid comprising a polynucleotide encoding a parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Typically, the restriction enzymes that digest the plasmid and the oligonucleotide are the same to allow the cohesive ends of the plasmid and the insert to ligate to each other. See, for example, Sheer (Scherer) and Davis (Davis), 1979, Proc. Natl. Acad. Sci. USA 76: 4949-; and Barton et al, 1990, Nucleic Acids research (Nucleic Acids Res.)18: 7349-4966.

Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. patent application publication nos. 2004/0171154; storci (Storici) et al 2001, Nature Biotechnol 19: 773-776; caren (Kren) et al, 1998, Nature medicine (nat. Med.)4: 285-; and Kalisano (Calissano) and Marcino (Macino), 1996, Fungal genetics advisory (Fungal Genet. Newslett.)43: 15-16.

Site-saturation mutagenesis systematically replaces the polypeptide coding sequence with a sequence encoding all 19 amino acids at one or more (e.g., several) specific positions (Parikh and Matsumura 2005, J.Mol.biol.)352: 621-628).

Synthetic gene construction requires in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed using a variety of techniques, such as the multiplex microchip-based technique described by Tian (Tian) (Tian) et al (2004), Nature (Nature)432: 1050-.

Single or multiple amino acid substitutions, deletions and/or insertions can be made and tested using known methods of mutagenesis, recombination and/or shuffling, followed by relevant screening procedures, such as those described by reed har-olsen (Reidhaar-Olson) and sao el (Sauer), 1988, Science (Science)241: 53-57; bowie (Bowie) and saoer, 1989, proceedings of the national academy of sciences of the united states (proc. natl. acad. sci. usa)86: 2152-; WO 95/17413; or those disclosed in WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Loman et al, 1991, Biochemistry 30: 10832-.

The activity of cloned, mutagenized polypeptides expressed by host cells can be detected by a combination of mutagenesis/shuffling methods and high throughput automated screening methods (endos (Ness) et al, 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from the host cells and rapidly sequenced using methods standard in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.

Semi-synthetic gene construction is achieved by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling. Semi-synthetic construction typically utilizes a process of synthesizing polynucleotide fragments in conjunction with PCR techniques. Thus, defined regions of a gene can be synthesized de novo, while other regions can be amplified using site-specific mutagenesis primers, while still other regions can be subjected to error-prone or non-error-prone PCR amplification. The polynucleotide subsequences may then be shuffled.

Polynucleotide

The invention also relates to isolated polynucleotides encoding the variants of the invention.

Nucleic acid constructs

The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

The polynucleotide can be manipulated in a variety of ways to provide for expression of a variant. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to its insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

The control sequence may be a promoter, i.e., a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a variant of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the variant. The promoter may be any polynucleotide that exhibits transcriptional activity in the host cell, including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

Examples of suitable promoters for directing transcription of the nucleic acid construct of the invention in a bacterial host cell are promoters obtained from the following genes: bacillus amyloliquefaciens alpha-amylase Gene (amyQ), Bacillus licheniformis alpha-amylase Gene (amyL), Bacillus licheniformis penicillinase Gene (penP), Bacillus stearothermophilus maltogenic amylase Gene (amyM), Bacillus subtilis levansucrase Gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryIIIA Gene (Agaisse) and Lerellus (Lerecus), 1994, Molecular Microbiology (Molecular Microbiology)13:97-107), Escherichia coli lac operon, Escherichia coli trc promoter (Egong (Egon) et al, 1988, Gene (Gene)69:301-, And the tac promoter (Debol (DeBoer) et al, 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Other promoters are described in Gilbert et al (Gilbert), 1980, Scientific Americans (Scientific American)242:74-94, "Useful proteins from recombinant bacteria (Useful proteins)"; and in Sambrook et al (Sambrook), 1989, supra. Examples of tandem promoters are disclosed in WO 99/43835.

Examples of suitable promoters for directing transcription of the nucleic acid construct of the invention in a filamentous fungal host cell are promoters obtained from the genes for: aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei (Rhizomucor miehei) lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Aspergillus niger glucoamylase V, Aspergillus niger, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translational elongation factor, as well as the NA2-tpi promoter (a modified promoter from the Aspergillus neutral alpha-amylase gene wherein the untranslated leader is replaced by the untranslated leader of the Aspergillus triose phosphate isomerase gene; non-limiting examples include a modified promoter from the Aspergillus niger neutral alpha-amylase gene wherein the untranslated leader is replaced by the untranslated leader of the Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant promoters, truncated promoters, and hybrid promoters thereof. Other promoters are described in U.S. patent No. 6,011,147.

In yeast hosts, useful promoters are obtained from the genes for: saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae Triose Phosphate Isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for Yeast host cells are described by Romanos et al, 1992, Yeast (Yeast)8: 423-488.

The control sequence may also be a transcription terminator which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3' -terminus of the polynucleotide encoding the variant. Any terminator which is functional in the host cell may be used in the present invention.

Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

Preferred terminators for filamentous fungal host cells are obtained from the genes for: aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase and Trichoderma reesei translational elongation factor.

Preferred terminators for yeast host cells are obtained from the genes for: saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al, 1992, supra.

The control sequence may also be a stable region of the mRNA downstream of the promoter and upstream of the coding sequence of the gene, which increases the expression of the gene.

Examples of suitable mRNA stabilizing regions are obtained from: bacillus thuringiensis cryIIIA gene (WO 94/25612) and Bacillus subtilis SP82 gene (Hua (Hue) et al, 1995, Journal of bacteriology 177: 3465-.

The control sequence may also be a leader sequence, a region of untranslated mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' -terminus of the polynucleotide encoding the variant. Any leader sequence that is functional in the host cell may be used.

Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

Suitable leader sequences for yeast host cells are obtained from the genes for: saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH 2/GAP).

The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the polynucleotide and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell may be used.

Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for: aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

Useful polyadenylation sequences for yeast host cells are described in Guo (Guo) and Sherman (Sherman), 1995, molecular cell biology (mol. cellular Biol.)15: 5983-5990.

The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway. The 5' end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence encoding the variant. Alternatively, the 5' end of the coding sequence may include a signal peptide coding sequence that is foreign to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, an exogenous signal peptide coding sequence may be required. Alternatively, the foreign signal peptide coding sequence may simply replace the native signal peptide coding sequence in order to increase secretion of the variant. However, any signal peptide coding sequence that directs the expressed variant into the secretory pathway of a host cell may be used.

An effective signal peptide coding sequence for a bacterial host cell is a signal peptide coding sequence obtained from the genes for: bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus alpha-amylase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Simmonna (Simonen) and Parlva (Palva), 1993, Microbiological Reviews (Microbiological Reviews)57: 109-.

An effective signal peptide coding sequence for use in a filamentous fungal host cell is a signal peptide coding sequence obtained from a gene: aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase and Rhizomucor miehei aspartic proteinase.

Useful signal peptides for yeast host cells are obtained from the genes: saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al (1992), supra.

The control sequence may also be a propeptide coding sequence that codes for a propeptide positioned at the N-terminus of a variant. The resulting polypeptide is called a pro-enzyme (proenzyme) or propolypeptide (or zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active variant by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for: bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.

When both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of the variant and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.

It may also be desirable to add regulatory sequences that regulate the expression of the variant relative to the growth of the host cell. Examples of regulatory sequences are those that cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory sequences in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those which allow gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the polynucleotide encoding the variant will be operably linked to the regulatory sequence.

Expression vector

The invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the variant at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In generating the expression vector, the coding sequence is located in the vector such that the coding sequence is operably linked with the appropriate control sequences for expression.

The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may comprise any means for ensuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome or chromosomes into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids (which together contain the total DNA to be introduced into the genome of the host cell) or a transposon may be used.

The vector preferably comprises one or more selectable markers that allow for easy selection of transformed, transfected, transduced or the like cells. A selectable marker is a gene the product of which provides biocide or viral resistance, heavy metal resistance, prototrophy to auxotrophs, and the like.

Examples of bacterial selectable markers are the Bacillus licheniformis or Bacillus subtilis dal genes, or markers that confer antibiotic resistance (e.g., ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance). Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA 3. Selectable markers for use in filamentous fungal host cells include, but are not limited to: adeA (phosphoribosylaminoimidazole-succinamide synthase), adeB (phosphoribosylaminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5' -phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in Aspergillus cells are the Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and the Streptomyces hygroscopicus (Streptomyces hygroscopicus) bar gene. Preferred for use in Trichoderma cells are the adeA, adeB, amdS, hph, and pyrG genes.

The selectable marker may be the dual selectable marker system described in W02010/039889. In one aspect, the dual selectable marker is a hph-tk dual selectable marker system.

The vector preferably contains one or more elements that allow the vector to integrate into the genome of the host cell or the vector to replicate autonomously in the cell, independently of the genome.

For integration into the host cell genome, the vector may rely on the polynucleotide sequence encoding the variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may comprise additional polynucleotides for directing integration by homologous recombination into one or more precise locations in one or more chromosomes in the genome of the host cell. To increase the likelihood of integration at a precise location, these integrated elements should contain a sufficient number of nucleic acids, e.g., 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity with the corresponding target sequence to increase the likelihood of homologous recombination. These integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, these integrational elements may be non-encoding polynucleotides or encoding polynucleotides. Alternatively, the vector may be integrated into the genome of the host cell by non-homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicon that mediates autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicon" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184, which allow replication in E.coli, and the origins of replication of plasmids pUB110, pE194, pTA1060, and pAM β 1, which allow replication in Bacillus.

Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication ARS1, ARS4, the combination of ARS1 and CEN3 and the combination of ARS4 and CEN 6.

Examples of origins of replication useful in filamentous fungal cells are AMA1 and ANS1 (Gems et al, 1991, Gene (Gene)98: 61-67; Caren (Cullen et al, 1987, Nucleic Acids research (Nucleic Acids Res.)15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of a plasmid or vector comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase production of the variant. Increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by comprising an amplifiable selectable marker gene with the polynucleotide, wherein cells comprising amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected for by culturing the cells in the presence of the appropriate selectable agent.

Procedures for ligating the elements described above to construct the recombinant expression vectors of the invention are well known to those of ordinary skill in the art (see, e.g., Sambrook et al, 1989, supra).

Host cell

The present invention also relates to recombinant host cells comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the production of the variant of the present invention. The construct or vector comprising the polynucleotide is introduced into a host cell such that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extra-chromosomal vector, as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of host cell will depend to a large extent on the gene encoding the variant and its source.

The host cell may be any cell useful in the recombinant production of a variant, such as a prokaryotic cell or a eukaryotic cell.

The prokaryotic host cell may be any gram-positive or gram-negative bacterium. Gram-positive bacteria include, but are not limited to: bacillus, Clostridium, enterococcus, Geobacillus, Lactobacillus, lactococcus, marine Bacillus, Staphylococcus, Streptococcus and Streptomyces. Gram-negative bacteria include, but are not limited to: campylobacter, Escherichia coli, Flavobacterium, Clostridium, helicobacter, Citrobacter, Neisseria, Pseudomonas, Salmonella, and Urethania.

The bacterial host cell may be any bacillus cell, including but not limited to: bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

The bacterial host cell may also be any streptococcal cell, including but not limited to: like streptococcus equi, streptococcus pyogenes, streptococcus uberis and streptococcus equi zooepidemicus subspecies cells.

The bacterial host cell may also be any streptomyces cell, including but not limited to: streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus and Streptomyces lividans cells.

Introduction of DNA into bacillus cells can be achieved by: protoplast transformation (see, for example, Chang and Cohen, 1979, molecular genetics and genomics (mol. Gen. Genet.)168:111-115), competent cell transformation (see, for example, Yang (Young) and Stepidemiz (Spizzen), 1961, journal of bacteriology (J. bacteriol.)81: 823-829; or Dubarnou (Dubnau) and Duwei-Abelson (Davidoff-Abelson), 1971, journal of molecular biology (J. mol. biol.)56:209-221), electroporation (see, for example, metallocene (Shigekawa) and Dalton (Dower), 1988, biotechnologies (Biotechniques)6:742-751), or conjugation (see, for example, gram (Kohler) and sohn (1987), 52169). Introduction of DNA into E.coli cells can be achieved by: protoplast transformation (see, e.g., Hanahan (Hanahan), 1983, journal of molecular biology (J.mol.biol.)166:557-580) or electroporation (see, e.g., Dalton (Dower) et al, 1988, Nucleic Acids Res. 16: 6127-6145). The introduction of DNA into Streptomyces cells can be achieved by: protoplast transformation, electroporation (see, e.g., Gong et al, 2004, leaf-line microbiology (Folia Microbiol.) (Praha (Bragg)) 49:399-405), conjugation (see, e.g., Mazodie et al, 1989, journal of bacteriology (J.bacteriol.)171:3583-3585), or transduction (see, e.g., Burk (Burke) et al, 2001, Proc. Natl.Acad.Sci. USA 98: 6289-. The introduction of DNA into a Pseudomonas cell can be achieved by: electroporation (see, e.g., zea (Choi) et al, 2006, journal of microbiological methods (j. microbiological methods)64: 391-. Introduction of DNA into streptococcus cells can be achieved by: natural competence (see, e.g., Perry and sumac (Kuramitsu), 1981, infection and immunity (infection. immun.)32:1295-1297), protoplast transformation (see, e.g., kat (Catt) and jorick (Jollick), 1991, microbiology (Microbios)68: 189-380207), electroporation (see, e.g., Buckley (Buckley), et al, 1999, applied and environmental microbiology (appl. environ. microbiol.)65:3800-3804), or conjugation (see, e.g., clevell (Clewell), 1981, microbiology review (microbiol. rev.)45: 409-436). However, any method known in the art for introducing DNA into a host cell may be used.

The host cell may also be a eukaryotic cell, such as a mammalian, insect, plant, or fungal cell.

The host cell may be a fungal cell. "Fungi" as used herein include Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, along with Oomycota and all mitosporic Fungi (as defined by Howsorth (Hawksworth) et al in The Anschofus and Beesbi Fungi Dictionary (Ainsworth and Bisby's Dictionary of The Fungi), 8 th edition, CAB 1995, International centers for applied biosciences (International), University Press, Cambridge (Cambridge, UK).

The fungal host cell may be a yeast cell. "Yeast" as used herein includes Saccharomycetes producing (Endomycetales), basidiomycetes and yeasts belonging to the Deuteromycetes (Sporophyceae). Since the classification of yeasts may change in the future, for the purposes of the present invention, yeasts should be edited as the Biology and activity of yeasts (Biology and Activities of Yeast) (scanner, Passimore, and Davenport), defined using the society for bacteriology as described in the society for bacteriology, Series No. 9(Soc. App. bacteriol. symposium Series No.9, 1980).

The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis (Kluyveromyces lactis), Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Kluyveromyces, Saccharomyces norbensis, Saccharomyces ovulosa, or Yarrowia lipolytica (Yarrowia lipolytica) cell.

The fungal host cell may be a filamentous fungal cell. "filamentous fungi" include all filamentous forms of the phylum Eumycota and the subdivision Oomycota (as defined by Hoxorth et al, 1995, supra). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, while carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding (budding) of a unicellular thallus, whereas carbon catabolism may be fermentative.

The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, BjerKandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus (Coriolus), Cryptococcus, Calcilomyces (Filibasidium), Fusarium, Humicola, Pyricularia, Mucor, myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia (Phlebia), Rumex, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

For example, the filamentous fungal host cell may be Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Curvularia nigra (Bjerkandra adusta), Ceriporiopsis ariscina (Ceriporiopsis ceneriana), Ceriporiopsis carinii (Ceriporiopsis caregiea), Ceriporiopsis superficiana (Ceriporiopsis gilvescens), Ceriporiopsis panniculata (Ceriporiopsis panocina), Ceriporiopsis annulata (Ceriporiopsis rivulosa), Ceriporiopsis micus (Ceriporiopsis subrufa), Ceriporiopsis capitata (Ceriporiopsis punctatus), Ceriporiopsis flava (Ceriporiopsis sp), Ceriporiopsis flava (Ceriporiopsis flava), Chrysosporium (Chrysosporium lucorhizomorphria, Chrysosporium), Chrysosporium (Fusarium trichothecoides), Chrysosporium (Fusarium luteum), Chrysosporium (Fusarium trichothecoides), Chrysosporium (Fusarium, Fusarium trichothecorum), Chrysosporium (Fusarium trichothecorum), Chrysosporium), Fusarium trichothecorum (Fusarium trichothecorum), Fusarium (Fusarium trichothecorum), Fusarium trichothecorum (Corona), Fusarium trichothecorum (Corona), Fusarium trichothecorum (Corona, Fusarium graminearum, Fusarium heterosporum, Fusarium albizium, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium sporotrichioides, Fusarium venenatum, Humicola lanuginosa, Mucor miehei, myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium (Phanerochosporium), Phlebia radiata, Pleurotus eryngii (Pleurotus eryngii), Talaromyces mersenii, Thielavia terrestris, Trametes versicolor (Trastoma latum), Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

Fungal cells may be transformed by methods involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Jolton (Yelton) et al, 1984, Proc.Natl.Acad.Sci.USA 81: 1470-. Suitable methods for transforming Fusarium species are described by Maladel (Malardier) et al, 1989, Gene (Gene)78:147-156 and WO 96/00787. Yeast can be transformed using procedures described in the following documents: becker (Becker) and melon (Guarente) in aberson (Abelson), j.n. and Simon (Simon), m.i. eds, Guide on Yeast Genetics and molecular biology, Methods in Enzymology (Guide to Yeast Genetics and molecular biology, Methods in Enzymology), volume 194, page 182-; ita (Ito) et al, 1983, journal of bacteriology (j.bacteriol.)153: 163; and hanien (hinen) et al, 1978, proceedings of the national academy of sciences of the united states (proc.natl.acad.sci.usa)75: 1920.

Generation method

The present invention also relates to methods of producing a variant, comprising (a) culturing a recombinant host cell of the invention under conditions conducive for production of the variant; and optionally (b) recovering the variant.

The host cells are cultured in a nutrient medium suitable for producing the variant using methods known in the art. For example, the cell may be cultured by shake flask culture in a suitable medium and under conditions allowing expression and/or isolation of the variant, or small-or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors. The culturing occurs in a suitable nutrient medium, which includes carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American type culture Collection). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from the cell lysate.

These variants can be detected using methods known in the art that are specific for these variants. These detection methods include, but are not limited to, the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates. For example, an enzymatic assay can be used to determine the activity of the variant.

The variants can be recovered using methods known in the art. For example, the variant can be recovered from the nutrient medium by a variety of conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, a whole fermentation broth comprising a variant of the invention is recovered.

Variants can be purified by a variety of procedures known in the art to obtain substantially pure variants, including but not limited to: chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatofocusing, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification (Protein Purification), Janson (Janson) and Reiden (Ryden) editors, VCH Publishers (VCH Publishers), New York, 1989).

Fermentation broth formulations or cell compositions

The invention also relates to a fermentation broth formulation or a cell composition comprising the variant of the invention. The fermentation broth product further comprises additional components used in the fermentation process, such as, for example, cells (including host cells containing a gene encoding a variant of the invention, which are used to produce the variant), cell debris, biomass, fermentation media, and/or fermentation products. In some embodiments, the composition is a cell-killed whole broth comprising one or more organic acids, killed cells and/or cell debris, and culture medium.

The term "fermentation broth" as used herein refers to a preparation produced by fermentation of cells, which has not undergone or has undergone minimal recovery and/or purification. For example, fermentation broth is produced when a microbial culture is grown to saturation, incubated under carbon-limited conditions to allow protein synthesis (e.g., expression of an enzyme by a host cell) and secreted into the cell culture medium. The fermentation broth may comprise the unfractionated or fractionated contents of the fermented material obtained at the end of the fermentation. Typically, the fermentation broth is unfractionated and includes spent culture medium and cell debris present after removal of microbial cells (e.g., filamentous fungal cells), e.g., by centrifugation. In some embodiments, the fermentation broth comprises spent cell culture medium, extracellular enzymes, and viable and/or non-viable microbial cells.

In one embodiment, the fermentation broth formulation and cell composition comprises a first organic acid component comprising at least one 1-5 carbon organic acid and/or salt thereof and a second organic acid component comprising at least one 6 or more carbon organic acid and/or salt thereof. In a particular embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing acids; and the second organic acid component is benzoic acid, cyclohexane carboxylic acid, 4-methyl pentanoic acid, phenylacetic acid, salts thereof, or mixtures of two or more of the foregoing acids.

In one aspect, the composition comprises one or more organic acids, and optionally further comprises killed cells and/or cell debris. In one embodiment, these killed cells and/or cell debris are removed from the cell-killed whole broth to provide a composition free of these components.

The fermentation broth formulations or cell compositions may further comprise a preservative and/or antimicrobial (e.g., bacteriostatic) agent, including but not limited to sorbitol, sodium chloride, potassium sorbate, and other agents known in the art.

The fermentation broth formulations or cell compositions may further comprise enzyme activities, such as one or more (e.g., several) enzymes selected from the group consisting of: cellulases, hemicellulases, catalases, esterases, patulin, laccases, ligninolytic enzymes, pectinases, peroxidases, proteases, and swollenin. The fermentation broth formulations or cell compositions may also include one or more (e.g., several) enzymes selected from the group consisting of: hydrolases, isomerases, ligases, lyases, oxidoreductases or transferases, for example alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.

The cell-killed whole broth or composition may comprise an unfractionated content of the fermented mass obtained at the end of the fermentation. Typically, the cell-killing whole broth or composition comprises spent medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of cellulase and/or glucosidase enzyme (s)). In some embodiments, the cell-killing whole broth or composition contains spent cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, methods known in the art may be used to permeabilize and/or lyse microbial cells present in a cell-killed whole broth or composition.

The whole culture broth or cell composition described herein is typically a liquid, but may contain insoluble components, such as killed cells, cell debris, culture media components, and or one or more insoluble enzymes. In some embodiments, insoluble components may be removed to provide a clear liquid composition.

The whole broth formulations and cell compositions of the invention may be produced by the methods described in WO 90/15861 or WO 2010/096673.

Examples of preferred uses of the compositions of the present invention are given below. The dosage of the composition and other conditions under which the composition is used can be determined based on methods known in the art.

Enzyme composition

The invention also relates to compositions comprising a variant of the invention. Preferably, these compositions are enriched for such variants. The term "enriched" indicates that the cellobiohydrolase activity of the composition has been increased, e.g., an enrichment factor of at least 1.1.

These compositions may comprise a variant of the invention as the major enzyme component, e.g. a one-component composition. Alternatively, the compositions may comprise enzyme activities, for example one or more (e.g. several) enzymes selected from the group consisting of: cellulases, hemicellulases, GH61 polypeptides with cellulolytic enhancing activity, catalases, esterases, patulin, laccases, ligninolytic enzymes, pectinases, peroxidases, proteases, and swollenin. The compositions may also include one or more (e.g., several) enzymes selected from the group consisting of: hydrolases, isomerases, ligases, lyases, oxidoreductases or transferases, for example alpha-galactosidase, alpha-glucosidase, aminopeptidase, amylase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase. These compositions may be prepared according to methods known in the art and may be in the form of liquid or dry compositions. These compositions may be stabilized according to methods known in the art.

Use of

The present invention is also directed to the following methods of using the variants having cellobiohydrolase I activity of the present invention or compositions thereof.

The present invention also relates to methods for degrading cellulosic material, the methods comprising: treating the cellulosic material with an enzyme composition in the presence of the cellobiohydrolase variant of the present invention. In one aspect, the methods further comprise recovering the degraded cellulosic material. The soluble products of the degradation of the cellulosic material can be separated from the insoluble cellulosic material using methods known in the art, such as, for example, centrifugation, filtration, or gravity settling.

The methods of the present invention can be used to saccharify cellulosic material into fermentable sugars and convert the fermentable sugars into a variety of useful fermentation products, such as fuels (ethanol, n-butanol, isobutanol, biodiesel, jet fuel) and/or platform compounds (e.g., acids, alcohols, ketones, gases, oils, etc.). The production of the desired fermentation product from the cellulosic material typically involves pretreatment, enzymatic hydrolysis (saccharification), and fermentation.

Processing of the cellulosic material according to the invention can be accomplished using methods conventional in the art. Further, the methods of the present invention may be practiced using any conventional biomass processing equipment configured to operate in accordance with the present invention.

Separate or simultaneous hydrolysis (saccharification) and fermentation include, but are not limited to: split Hydrolysis and Fermentation (SHF), Simultaneous Saccharification and Fermentation (SSF), simultaneous saccharification and co-fermentation (SSCF), Hybrid Hydrolysis and Fermentation (HHF), split hydrolysis and co-fermentation (SHCF), hybrid hydrolysis and co-fermentation (HHCF), and Direct Microbial Conversion (DMC), sometimes also referred to as Combined Bioprocessing (CBP). SHF uses separate processing steps to first enzymatically hydrolyze the cellulosic material to fermentable sugars (e.g., glucose, cellobiose, and pentose monomers) and then ferment the fermentable sugars to ethanol. In SSF, enzymatic hydrolysis of cellulosic material and fermentation of sugars to ethanol are combined in one step (Philippidis G.P. (Philippidis, G.P.), 1996, Cellulose bioconversion technology, Bioethanol Handbook: Production and Utilization (Handbook on Bioethanol: Production and Ultilization), Huaman C.E (Wyman, C.E.) editing, Taylor-Francis publishing group (Taylor & Francis), Washington D.C., 179-212)). SSCF involves the co-fermentation of multiple sugars (Schen (Sheehan) and Himmel (Himmel), 1999, Biotechnology Advance (Biotechnol. prog.)15: 817-827). HHF involves a separate hydrolysis step and additionally a simultaneous saccharification and hydrolysis step, which steps may be performed in the same reactor. The steps in the HHF process may be performed at different temperatures, i.e. high temperature enzymatic saccharification, followed by SSF at lower temperatures that the fermenting strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis, and fermentation) in one or more (e.g., several) steps, using the same organisms to produce enzymes for converting cellulosic material to fermentable sugars and enzymes for converting fermentable sugars to end products (linde (Lynd) et al, 2002, review of microbiology and molecular biology (microbiol. mol. biol. reviews)66: 506-. It is understood herein that any method known in the art, including pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof, may be used to practice the methods of the present invention.

Conventional apparatus may comprise a fed-batch stirred reactor, a continuous flow stirred reactor with ultrafiltration, and/or a continuous plug-flow column reactor (continuous plug-flow reactor) (De Castighurz Corazza et al, 2003, proceedings of the technical Acta scientific. technology 25: 33-38; Gusakov and Sinitson (Sinitsyn), 1985, enzymology and microbiology (Enz. Microb. Technol. 7:346-352), a milling reactor (Liu (Ryu) and Li (Lee), 1983, Biotechnology and bioengineering (Biotechnology. Bioeng. 25: 53-65). Additional reactor types include: fluidized bed reactors for hydrolysis and/or fermentation, upflow blanket reactors, immobilization reactors, and extruder type reactors.

And (4) preprocessing.In the practice of the method of the present invention,plant cell wall components of cellulosic material may be disrupted using any pretreatment process known in the art (Chandra et al, 2007, Biochemical engineering/Biotechnology Adv. biochem. Engin./Biotechnol.). 108: 67-93; Galbe (Galbe) and saki (Zachhi), 2007, Biochemical engineering/Biotechnology Advance, 108: 41-65; Hedriks (Hendriks) and Seeman (Zeeman), 2009, Bioresource technology (Bioresource Tehnol.). 100: 10-18; Massel et al, 2005, Bioresource technology 96: 673-; Taherzadeh and Lader (Taherzadeh) and Carlim (Karimi), 2008, molecular biology (Int J. of mol.) 9: Yang. 1; Yang, Yan 1 and Yang, 1651; Biotechnology, Biotechnologies, Biofine, Biotechnology, Biofine, Biofpr, Biofine, JP, Vol.J. Sci., 9:1, Biofine, 12, Biofine, Vol.

The cellulosic material may also be size reduced, sieved, pre-soaked, wetted, washed and/or conditioned prior to pretreatment using methods known in the art.

Conventional pretreatment includes, but is not limited to: steam pretreatment (with or without explosion), dilute acid pretreatment, hot water pretreatment, caustic pretreatment, lime pretreatment, wet oxidation, wet explosion, ammonia fiber explosion, organic solvent pretreatment, and biological pretreatment. Additional pretreatment includes ammonia percolation, sonication, electroporation, microwave, supercritical CO₂Supercritical H₂O, ozone, ionic liquid and gamma radiation pretreatment.

The cellulosic material may be pretreated prior to hydrolysis and/or fermentation. Preferably, the pretreatment is carried out before the hydrolysis. Alternatively, pretreatment with enzymatic hydrolysis may be performed simultaneously to release fermentable sugars, such as glucose, xylose, and/or cellobiose. In most cases, the pretreatment step itself results in the conversion of the biomass into fermentable sugars (even in the absence of enzymes).

And (4) steam pretreatment. In steam pretreatment, the cellulosic material is heated to disrupt plant cell wall components, including lignin, hemicellulose, and cellulose, to make the cellulose and other fractions, e.g., hemicellulose, accessible to enzymes. The cellulosic material is passed through or over a reaction vessel, steam is injected into the reaction vessel to increase the temperature to the desired temperature and pressure, and the steam is maintained therein for the desired reaction time. The steam pretreatment is preferably carried out at 140 ℃ to 250 ℃, e.g., 160 ℃ to 200 ℃ or 170 ℃ to 190 ℃, with the optimum temperature range depending on the optional addition of chemical catalyst. The residence time of the steam pretreatment is preferably 1 to 60 minutes, such as 1 to 30 minutes, 1 to 20 minutes, 3 to 12 minutes, or 4 to 10 minutes, with the optimum residence time depending on the temperature and optional addition of chemical catalyst. Steam pretreatment allows for relatively high solids loadings such that the cellulosic material typically only becomes moist during pretreatment. Steam pretreatment is often combined with explosive discharge of the pretreated material, which is called steam explosion, i.e. rapid flashing to atmospheric pressure and material turbulence, to increase the accessible surface area by fragmentation (Duff and Murray (Murray), 1996, biological resource Technology (bioreource Technology)855: 1-33; gabor (Galbe) and berlin (zacch), 2002, applied microbiology and biotechnology (appl. microbiol. biotech.) 59: 618-. During steam pretreatment, hemicellulose acetyl groups are cleaved and the resulting acids autocatalytically hydrolyze the hemicellulose moieties into monosaccharides and oligosaccharides. Lignin is removed only to a limited extent.

Chemical pretreatment: the term "chemical treatment" refers to any chemical pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin. This pretreatment can convert crystalline cellulose to amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, ammonia fiber/freeze expansion (AFEX), Ammonia Percolation (APR), ionic liquids, and organic solvent pretreatment.

Sometimes a chemical catalyst (e.g. H) is added prior to steam pretreatment₂SO₄Or SO₂) (typically 0.3 to 5% w/w) which reduces time and lowers temperature, increases recovery, and improves enzymatic hydrolysis (Balesteros et al 2006, applied biochemistry and biotechnology (appl. biochem. Biotechnol.)129-132: 496-508; varga et al 2004, applied BiochemicalChemistry and Biotechnology 113: 509-; selener et al, 2006, Enzyme and microbiological techniques (Enzyme Microb. Technol.)39:756- > 762. In dilute acid pretreatment, the cellulosic material is reacted with dilute acid (typically H)₂SO₄) And water to form a slurry, heated to the desired temperature by steam, and flashed to atmospheric pressure after a residence time. A variety of reactor designs can be employed for dilute acid pretreatment, such as plug flow reactors, countercurrent flow reactors, or continuous countercurrent contracted bed reactors (Duff and Murray, 1996, supra; Schell et al, 2004, Bioresource Technology 91: 179-188; Li (Lee) et al, 1999, Biochemical engineering/Biotechnology Adv. biochem. Eng. Biotechnology.) 65: 93-115).

Several pretreatment methods under alkaline conditions may also be used. These alkaline pretreatments include, but are not limited to: sodium hydroxide, lime, wet oxidation, Ammonia Percolation (APR), and ammonia fiber/freeze expansion (AFEX) pretreatment.

Lime pretreatment is carried out with calcium oxide or calcium hydroxide at a temperature of 85-150 ℃ and a residence time of from 1 hour to several days (Wyman et al, 2005, Bioresource Technol 96: 1959-. WO 2006/110891, WO 2006/110899, WO 2006/110900 and WO 2006/110901 disclose pretreatment methods using ammonia.

Wet oxidation is a thermal pretreatment typically carried out at 180 ℃ -200 ℃ for 5-15 minutes with the addition of an oxidizing agent (e.g. hydrogen peroxide or overpressure oxygen) (Schmidt and Thomsen (1998), Bioresource technology (Bioresource Technol.)64: 139-. The pre-treatment is preferably carried out at 1% to 40% dry matter, for example 2% to 30% dry matter or 5% to 20% dry matter, and the initial pH is usually raised by addition of a base, for example sodium carbonate.

A modification of the wet oxidation pretreatment method known as wet explosion (combination of wet oxidation and steam explosion) is able to treat up to 30% of dry matter. In wet explosion, after a certain residence time, an oxidizing agent (oxidizing agent) is introduced during the pretreatment. The pretreatment is then ended by flash evaporation to atmospheric pressure (WO 2006/03228).

Ammonia Fibre Expansion (AFEX) involves treating the cellulose material with liquid or gaseous ammonia at moderate temperatures, such as 90-150 ℃ and high pressures, such as 17-20 bar, for 5-10 minutes, wherein the dry matter content can be as high as 60% (Gollapalli et al, 2002, applied biochemistry and biotechnology (appl. biochem. Biotechnology.) 98: 23-35; Jundawatt (Chundawat) et al, 2007, Biotechnology and bioengineering (Biotechnology. Bioeng.)96: 219-231; Arizade (Alizadeh) et al, 2005, applied biochemistry and biotechnology 121: 1133-1141; Teymouri et al, 2005, biological resource Technology (Bioresource Technology)96: 20148). During AFEX pretreatment, cellulose and hemicellulose remain relatively intact. The lignin-carbohydrate complex is cleaved.

Organic solvent pretreatment cellulosic material is delignified by extraction with aqueous ethanol (40% -60% ethanol) at 160 ℃ -200 ℃ for 30-60 minutes (Pan) et al, 2005, Biotech & bioengineering (Biotechnol. Bioeng.)90: 473-. Sulfuric acid is usually added as a catalyst. In the organosolv pretreatment, most of the hemicellulose and lignin are removed.

Other examples of suitable pretreatment methods are described by Schell (Schell) et al, 2003, application of biochemistry and biotechnology (appl. biochem. biotechnol.) 105-.

In one aspect, the chemical pretreatment is preferably performed as a dilute acid treatment, and more preferably as a continuous dilute acid treatment. The acid is typically sulfuric acid, but other acids such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof may also be used. The weak acid treatment is preferably carried out in a pH range of 1 to 5, for example 1 to 4 or 1 to 2.5. In one aspect, the acid concentration is preferably in the range of from 0.01 wt.% to 10 wt.% acid, for example 0.05 wt.% to 5 wt.% acid or 0.1 wt.% to 2 wt.% acid. The acid is contacted with the cellulosic material and maintained at a temperature preferably in the range of 140 ℃ to 200 ℃, for example 165 ℃ to 190 ℃, for a time in the range of from 1 to 60 minutes.

In another aspect, the pretreatment is performed in an aqueous slurry. In a preferred aspect, the cellulosic material is present during pretreatment in an amount preferably between 10 wt% to 80 wt%, such as 20 wt% to 70 wt% or 30 wt% to 60 wt%, such as about 40 wt%. The pretreated cellulosic material may be unwashed or washed using any method known in the art, for example, with water.

Mechanical or physical pretreatment: the term "mechanical pretreatment" or "physical pretreatment" refers to any pretreatment that promotes particle size reduction. For example, such pre-treatment may involve various types of milling or grinding (e.g., dry milling, wet milling, or vibratory ball milling).

The cellulosic material may be pre-treated physically (mechanically) and chemically. Mechanical or physical pre-treatment may be combined with: steam/steam explosion, hydrothermolysis, dilute or weak acid treatment, high temperature, high pressure treatment, radiation (e.g., microwave radiation), or combinations thereof. In one aspect, high pressure means a pressure in the range of preferably about 100 to about 400psi, for example about 150 to about 250 psi. In another aspect, elevated temperature means a temperature in the range of from about 100 ℃ to about 300 ℃, for example from about 140 ℃ to about 200 ℃. In a preferred aspect, the mechanical or physical pretreatment is carried out in a batch process using a steam gun hydrolyzer system, such as the cisternate hydrolyzer (Sunds Defibrator AB) available from cisternator corporation, sweden, which uses high pressures and temperatures as defined above. These physical pretreatment and chemical pretreatment may be performed sequentially or simultaneously as necessary.

Thus, in a preferred aspect, the cellulosic material is subjected to a physical (mechanical) or chemical pretreatment, or any combination thereof, to facilitate the separation and/or release of cellulose, hemicellulose, and/or lignin.

Biological pretreatment: the term "biological pretreatment" refers to any biological pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin from a cellulosic material. The biological pretreatment technique may involve the use of lignin-solubilizing microorganisms and/or enzymes (see, for example, U.S. T. -A. (Hsu, T.S. -A.), 1996, pretreatment of Biomass (pretreatment of Biomass), Bioethanol Handbook, Production and Utilization (Handbook on Bioethanol: Production and Utilization), Mann C.E. (Wyman, C.E.) editor, Theler-Francisels publishing group, Washington D.C., 179. 212; Hichish (Ghosh) and Singh (Singh), 1993, Adv.Appl. Microbiol. (39: 295) and 295. 333; Mikland J.D. (Mglan, J.D.), review, pretreatment of lignin (pretreatment of lignins: lignin-oxidizing biological), Biomass Production of Biomass (Biozyme: 82, modification of Biozyme), Biozyme M.E, Biozyme, M.E, Biozyme, M.E, J.O.), and ovrenon R.P, (everend, R.P), the American society for chemistry discussions 566(ACS Symposium Series 566), the American chemical society (American chemical society), washington, dc, chapter 15; gong C.S. (Gong, C.S.), caro n.j. (Cao, n.j.), Du j. (Du, J.), and Cao G.T. (Tsao, G.T.), 1999, production of Ethanol from renewable resources (Ethanol production from renewable resources), Advances in biochemical engineering/Biotechnology (Advances in biochemical engineering/Biotechnology), schepel T. (Scheper, T.), editors, press publishers (Springer-Verlag), berlin, heidelberg, germany, 65: 207-; olson (Olsson) and Haen-Hagadard (Hahn-Hagerdal), 1996, enzyme and microbial technology (Enz. Microb. Tech.)18: 312-; and Wadbard (Vallander) and Erikson (Eriksson), 1990, advances in biochemical engineering/biotechnology 42: 63-95).

Saccharification. In the hydrolysis step (also referred to as saccharification), the (e.g., pretreated) cellulosic material is hydrolyzed to break down the cellulose and/or hemicellulose into fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose, and/or soluble oligosaccharides. The hydrolysis is performed enzymatically by an enzyme composition in the presence of the cellobiohydrolase variant of the present invention. The enzymes of these compositions may be added simultaneously or sequentially.

The enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions readily determinable by one skilled in the art. In one aspect, the hydrolysis is carried out under conditions suitable for the activity of, i.e., optimal for, the one or more enzymes. The hydrolysis may be carried out as a fed batch process or a continuous process, wherein the cellulosic material is gradually fed into e.g. an enzyme-containing hydrolysis solution.

Saccharification is typically carried out in a stirred tank reactor or fermentor under controlled pH, temperature, and mixing conditions. Suitable treatment times, temperatures and pH conditions can be readily determined by one skilled in the art. For example, saccharification may last up to 200 hours, but is typically carried out for preferably about 12 to about 120 hours, such as about 16 to about 72 hours or about 24 to about 48 hours. The temperature is preferably in the range of about 25 ℃ to about 70 ℃, e.g., about 30 ℃ to about 65 ℃, about 40 ℃ to about 60 ℃, or about 50 ℃ to 55 ℃. The pH is preferably in the range of about 3 to about 8, for example about 3.5 to about 7, about 4 to about 6, or about 4.5 to about 5.5. The dry solids content is preferably in the range of about 5 wt% to about 50 wt%, for example about 10 wt% to about 40 wt% or about 20 wt% to about 30 wt%.

These enzyme compositions may comprise any protein useful for degrading cellulosic material.

In one aspect, the enzyme composition comprises or further comprises one or more (e.g., several) proteins selected from the group consisting of: cellulases, GH61 polypeptides having cellulolytic enhancing activity, hemicellulases, esterases, patulin, ligninolytic enzymes, oxidoreductases, pectinases, proteases, and swollenin. In another aspect, the cellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of: endoglucanases, cellobiohydrolases, and beta-glucosidases. In another aspect, the hemicellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of: acetyl mannan esterase, acetyl xylan esterase, arabinanase, arabinofuranosidase, coumaroyl esterase, feruloyl esterase, galactosidase, glucuronidase, mannanase, mannosidase, xylanase and xylosidase. In another aspect, the oxidoreductase enzyme is preferably one or more (e.g., several) enzymes selected from the group consisting of: catalase, laccase and peroxidase.

In another aspect, the enzyme composition includes one or more (e.g., several) cellulolytic enzymes. In another aspect, the enzyme composition comprises or further comprises one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition includes one or more (e.g., several) cellulolytic enzymes and one or more (e.g., several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (e.g., several) enzymes selected from the group of cellulolytic enzymes and hemicellulolytic enzymes. In another aspect, the enzyme composition comprises an endoglucanase. In another aspect, the enzyme composition comprises a cellobiohydrolase. In another aspect, the enzyme composition includes a beta-glucosidase. In another aspect, the enzyme composition comprises a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase and a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a cellobiohydrolase and a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a β -glucosidase and a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase and a beta-glucosidase. In another aspect, the enzyme composition comprises a beta-glucosidase and a cellobiohydrolase. In another aspect, the enzyme composition comprises a β -glucosidase and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a GH61 polypeptide having cellulolytic enhancing activity, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase, a GH61 polypeptide having cellulolytic enhancing activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a β -glucosidase, a GH61 polypeptide having cellulolytic enhancing activity, and a cellobiohydrolase. In another aspect, the enzyme composition comprises a β -glucosidase, a GH61 polypeptide having cellulolytic enhancing activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II. In another aspect, the enzyme composition comprises an endoglucanase, a cellobiohydrolase, a beta-glucosidase, and a GH61 polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase, a GH61 polypeptide having cellulolytic enhancing activity, and a cellobiohydrolase I, a cellobiohydrolase II, or a combination of cellobiohydrolase I and cellobiohydrolase II.

In another aspect, the enzyme composition comprises an acetyl mannan esterase. In another aspect, the enzyme composition comprises an acetyl xylan esterase. In another aspect, the enzyme composition comprises an arabinase (e.g., an alpha-L-arabinase). In another aspect, the enzyme composition includes an arabinofuranosidase (e.g., an alpha-L-arabinofuranosidase). In another aspect, the enzyme composition comprises a coumarate esterase. In another aspect, the enzyme composition comprises a feruloyl esterase. In another aspect, the enzyme composition includes a galactosidase (e.g., alpha-galactosidase and/or beta-galactosidase). In another aspect, the enzyme composition includes a glucuronidase (e.g., alpha-D-glucuronidase). In another aspect, the enzyme composition comprises a glucuronidase. In another aspect, the enzyme composition comprises a mannanase. In another aspect, the enzyme composition includes a mannosidase (e.g., a β -mannosidase). In another aspect, the enzyme composition comprises a xylanase. In a preferred aspect, the xylanase is a family 10 xylanase. In another preferred aspect, the xylanase is a family 11 xylanase. In another aspect, the enzyme composition includes a xylosidase (e.g., a β -xylosidase).

In another aspect, the enzyme composition comprises an esterase. In another aspect, the enzyme composition comprises a patulin. In another aspect, the enzyme composition comprises a ligninolytic enzyme. In a preferred aspect, theThe lignin-degrading enzyme is a manganese peroxidase. In another preferred aspect, the lignin degrading enzyme is a lignin peroxidase. In another preferred aspect, the ligninolytic enzyme is a H₂O₂Producing the enzyme. In another aspect, the enzyme composition comprises a pectinase. In another aspect, the enzyme composition includes an oxidoreductase. In another preferred aspect, the oxidoreductase is a catalase. In another preferred aspect, the oxidoreductase is a laccase. In another preferred aspect, the oxidoreductase is a peroxidase. In another aspect, the enzyme composition comprises a protease. In another aspect, the enzyme composition comprises a swollenin.

In the methods of the invention, the one or more enzymes may be added before or during saccharification, saccharification and fermentation, or fermentation.

One or more (e.g., several) components of the enzyme composition can be a native protein, a recombinant protein, or a combination of a native protein and a recombinant protein. For example, one or more (e.g., several) components can be native proteins of a cell used as a host cell to recombinantly express one or more (e.g., several) other components of the enzyme composition. It is understood herein that a recombinant protein may be heterologous (e.g., foreign) as well as native to the host cell. One or more (e.g., several) components of the enzyme composition can be produced as a single component and then combined to form the enzyme composition. The enzyme composition may be a combination of multi-component and single-component protein formulations.

The enzyme used in the process of the invention may be present in any form suitable for use, such as, for example, a fermentation broth formulation or a cell composition, a cell lysate with or without cell debris, a semi-purified or purified enzyme preparation, or a host cell from which the enzyme is derived. The enzyme composition may be a dry powder or granulate, a non-dusty granulate, a liquid, a stabilized liquid or a stabilized protected enzyme. The liquid enzyme preparation may be stabilized according to established methods, for example by adding a stabilizer, such as a sugar, sugar alcohol or other polyol, and/or lactic acid or another organic acid.

The optimal amount of enzyme and cellobiohydrolase variants depends on several factors including, but not limited to: a mixture of cellulolytic and/or hemicellulolytic enzyme components, a cellulosic material, a concentration of cellulosic material, one or more pretreatments of cellulosic material, a temperature, a time, a pH, and incorporation of a fermenting organism (e.g., for simultaneous saccharification and fermentation).

In one aspect, an effective amount of a cellulolytic enzyme or a hemicellulolytic enzyme on a cellulosic material is about 0.5 to about 50mg, e.g., about 0.5 to about 40mg, about 0.5 to about 25mg, about 0.75 to about 20mg, about 0.75 to about 15mg, about 0.5 to about 10mg, or about 2.5 to about 10mg per gram of cellulosic material.

In another aspect, an effective amount of the cellobiohydrolase variant on the cellulosic material is about 0.01 to about 50.0mg, e.g., about 0.01 to about 40mg, about 0.01 to about 30mg, about 0.01 to about 20mg, about 0.01 to about 10mg, about 0.01 to about 5mg, about 0.025 to about 1.5mg, about 0.05 to about 1.25mg, about 0.075 to about 1.25mg, about 0.1 to about 1.25mg, about 0.15 to about 1.25mg, or about 0.25 to about 1.0mg per g of cellulosic material.

In another aspect, an effective amount of a cellobiohydrolase variant on a cellulolytic or hemicellulolytic enzyme is about 0.005 to about 1.0g, e.g., about 0.01 to about 1.0g, about 0.15 to about 0.75g, about 0.15 to about 0.5g, about 0.1 to about 0.25g, or about 0.05 to about 0.2g/g cellulolytic or hemicellulolytic enzyme.

Polypeptides having cellulolytic or hemicellulolytic enzyme activity, as well as other proteins/polypeptides suitable for degradation of cellulosic material, such as GH61 polypeptides having cellulolytic enhancing activity (hereinafter collectively referred to as "polypeptides having enzyme activity"), may be derived or obtained from any suitable source, including archaeal, bacterial, fungal, yeast, plant or animal sources. The term "obtained" also means herein that the enzyme may have been recombinantly produced in a host organism using the methods described herein, wherein the recombinantly produced enzyme is native or foreign to the host organism, or has a modified amino acid sequence, e.g., has one or more (e.g., several) deleted, inserted, and/or substituted amino acids, i.e., the recombinantly produced enzyme is a mutant and/or fragment of the native amino acid sequence, or an enzyme produced by nucleic acid shuffling methods known in the art. Native variants are encompassed within the meaning of the native enzyme, whereas variants as obtained by site-directed mutagenesis or shuffling are encompassed within the meaning of the exogenous enzyme.

The polypeptide having enzymatic activity may be a bacterial polypeptide. For example, the polypeptide can be a gram-positive bacterial polypeptide having enzymatic activity, such as a bacillus, streptococcus, streptomyces, staphylococcus, enterococcus, lactobacillus, lactococcus, clostridium, geobacillus, pyrocellulose, thermoacidosis, thermobifida (thermobifida), or marine bacillus polypeptide, or a gram-negative bacterial polypeptide having enzymatic activity, such as an escherichia coli, pseudomonas, salmonella, campylobacter, helicobacter, flavobacterium, clostridium, mud bacillus, neisseria, or ureaplasma polypeptide.

In one aspect, the polypeptide is an enzymatically active Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis polypeptide.

In another aspect, the polypeptide is an enzymatically active Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp.

In another aspect, the polypeptide is an enzymatically active Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, or Streptomyces lividans polypeptide.

The polypeptide having enzymatic activity can also be a fungal polypeptide, and more preferably is an enzymatically active yeast polypeptide, such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or yarrowia polypeptide; or more preferably an enzymatically active filamentous fungal polypeptide such as Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Borgyosparia, Ceriporiopsis, Trichosporon, Chrysosporium, Claviceps, Coccidioides, Coprinus, Agomelania, Corynebacteria, Cryptococcus, Chromophthora, Auricularia, Sphaerotheca, Fusarium, Gibberella, Trichuris, Humicola, Rapex, Agaricus, Microlococcus, Pyricularia, Melanocarpus, Polyporus, Mucor, myceliophthora, Neocallimastix, Paecilomyces, Penicillium, Phanerochaete, Rumekrasia, Pseudoplegia, Pseudopilula (Pseudomonilia), Rhizophora, Thermomyces, Achillea, Talaromyces, Thielavia, Tolypocladium, Pseudoperonospora (Pseudoceramyceliophthora), Rhizomucomonas, Thermomyces, Talaromyceliophyces, Talaromyceliophthora, Talaro, A Tolypocladium, Trichoderma, Colletotrichum, Verticillium, Hypsizygus, or Calophyllum polypeptide.

In one aspect, the polypeptide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Nodezymocyte, or Saccharomyces ovatus polypeptide having enzymatic activity.

In another aspect, the polypeptide is enzymatically active Acremonium cellulolyticum, Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium tropicalis, modafinim Chrysosporium, Chrysosporium angustifolia, Chrysosporium hirsutum, Chrysosporium lanuginosum, Chrysosporium striatum, Fusarium sporotrichioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium heterosporum, Fusarium negundi, Fusarium reticulatum, Fusarium roseum, Fusarium sporotrichioides, Fusarium venenatum, Fusarium morum, Fusarium morganii, Fusariu, Penicillium funiculosum, Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia leucotrichum (Thielavia achromatica), Thielavia albospora (Thielavia albomyces), Thielavia leucotrichum (Thielavia collopisa), Thielavia australis, Thielavia philippinarum (Thielavia fimeti), Thielavia microsporum, Thielavia ovasporum, Thielavia peruviana (Thielavia peruviana), Thielavia oncospora, Thielavia lanosporum, Thielavia subthermophila, Thielavia terrestris, Thielavia harzium, Trichoderma longibrachiatum, Trichoderma viride, or Trichoderma fusobacterium fuscophyllum polypeptides.

Chemically modified or protein engineered mutants of polypeptides having enzymatic activity may also be used.

One or more (e.g., several) components of the enzyme composition may be recombinant components, i.e., produced by cloning a DNA sequence encoding the single component and subsequently transforming a cell with the DNA sequence and expressing in a host (see, e.g., WO 91/17243 and WO 91/17244). The host may be a heterologous host (the enzyme is foreign to the host), but the host may also be a homologous host (the enzyme is native to the host) under certain conditions. Monocomponent cellulolytic proteins may also be prepared by purifying such a protein from a fermentation broth.

In one aspect, the one or more (e.g., several) cellulolytic enzymes comprise a commercial cellulolytic enzyme preparation. Examples of commercial cellulolytic enzyme preparations suitable for use in the present invention include, for example:CTec (Novit Co.),CTec2 (Novit Co.),CTec3 (Novitin Co.), CELLUCLAST^TM(Novozym, Inc.), NOVOZYM^TM188 (Novoxil Co., Ltd.), SPEZYME^TMCP (Jennonidae International (Genencor Int.)), ACCELLERASE^TMTRIO (DuPont corporation),NL (DSM Corp.);S/L100 (DSM Corp.), ROHAMENT^TM7069W (Rohm corporation)GmbH)), orCMAX3^TM(Dyadic International Inc. (Dyadic International, Inc.)). The cellulolytic enzyme preparation is added in an effective amount of from about 0.001 wt.% to about 5.0 wt.% solids, for example 0.025 wt.% to about 4.0 wt.% solids, or about 0.005 wt.% to about 2.0 wt.% solids.

Examples of bacterial endoglucanases that may be used in the method of the invention include, but are not limited to: thermobifida cellulolytica (Acidothermus cellulolyticus) endoglucanase (WO 91/05039; WO 93/15186; U.S. patent application No. 5,275,944; WO 96/02551; U.S. patent application No. 5,536,655, WO 00/70031, WO 05/093050), Erwinia carotovora (Erwinia carotovora) endoglucanase (Sarilahi et al, 1990, Gene (Gene)90:9-14), Thermobifida fusca endoglucanase III (WO 05/093050), and Thermobifida fusca endoglucanase V (WO 05/093050).

Examples of fungal endoglucanases that may be used in the present invention include, but are not limited to: trichoderma reesei endoglucanase I (Penttila) et al, 1986, Gene 45:253-263, Trichoderma reesei Cel7B endoglucanase I (GenBank: M15665), Trichoderma reesei endoglucanase II (Saloheimo) et al, 1988, Gene 63:11-22), Trichoderma reesei Cel5A endoglucanase II (GenBank: M19373), Trichoderma reesei endoglucanase III (Okada) et al, 1988, applied to environmental Microbiology (appl. Environ. Microbiol. 64:555-563, GenBank: AB003694), Trichoderma reesei endoglucanase V (Saoheimo et al, 1994, Molecular Microbiology (Mobiol. Microbiol.) 13:219, Banaba. wo 228, GenBank: Z3333694), Aspergillus reesei endoglucanase V (Saoheimia) V (Sarkojic et al, Okamoc) Nukawa et al, 1995, Aspergillus flavus endoglucanase (1990, Aspergillus strain 381, 18, Aspergillus kajiu et al, contemporary Genetics (Current Genetics)27: 435-.

Examples of cellobiohydrolases useful in the present invention include, but are not limited to: aspergillus aculeatus cellobiohydrolase II (WO 2011/059740), Aspergillus fumigatus cellobiohydrolase I (WO 2013/028928), Aspergillus fumigatus cellobiohydrolase II (WO 2013/028928), Chaetomium thermophilum cellobiohydrolase I, Chaetomium thermophilum cellobiohydrolase II, Humicola insolens cellobiohydrolase I, myceliophthora thermophila cellobiohydrolase II (WO 2009/042871), penicillium austeniticum (Penicillium occipitans) cellobiohydrolase I (GenBank: AY690482), Talaromyces emersonii cellobiohydrolase I (GenBank: AF439936), Thielavia Hydaniella Herbacea (Thielavia Hydanie) cellobiohydrolase II (WO 2010/141325), Thielavia terrestris cellobiohydrolase II (CEL6A, WO 2006/074435), Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, and Colletotrichum fulvum candidum cellobiohydrolase II (WO 2010/057086).

Examples of beta-glucosidases that may be used in the present invention include, but are not limited to, beta-glucosidases from: aspergillus aculeatus (Chuankou (Kawaguchi) et al, 1996, Gene (Gene)173:287-288), Aspergillus fumigatus (WO 2005/047499), Aspergillus niger (Dan) et al, 2000, J.Biol.chem.)275:4973-4980), Aspergillus oryzae (WO 02/095014), Penicillium brasiliensis IBT 20888(WO 2007/019442 and WO 2010/088387), Thielavia terrestris (WO 2011/035029), and Trichophyton fulvum (WO 2007/019442).

The beta-glucosidase may be a fusion protein. In one aspect, the beta-glucosidase is an aspergillus oryzae beta-glucosidase variant BG fusion protein (WO 2008/057637) or an aspergillus oryzae beta-glucosidase fusion protein (WO 2008/057637).

Other useful endoglucanases, cellobiohydrolases, and beta-glucosidases are disclosed in a number of glycosyl hydrolase families using the following classifications: henrissat (Henrissat), 1991, journal of biochemistry (biochem. j.)280: 309-; and Henry Satt and Beloch (Bairoch), 1996, J. Biochem 316: 695-.

Other cellulolytic enzymes that may be used in the present invention are described in WO 98/13465, WO 98/015619, WO 98/015633, WO 99/06574, WO 99/10481, WO 99/025847, WO 99/031255, WO 2002/101078, WO2003/027306, WO 2003/052054, WO 2003/052055, WO 2003/052056, WO 2003/052057, WO2003/052118, WO 2004/016760, WO 2004/043980, WO 2004/048592, WO 2005/001065, WO2005/028636, WO 2005/093050, WO 2005/093073, WO 2006/074005, WO 2006/117432, WO2007/071818, WO 2007/071820, WO 2008/008070, WO 2008/008793, U.S. Pat. No. 5,457,046, U.S. Pat. No. 5,648,263, and U.S. Pat. No. 5,686,593.

Any GH61 polypeptide having cellulolytic enhancing activity may be used as a component of the enzyme composition in the methods of the invention.

Examples of GH61 polypeptides useful in the methods of the invention include, but are not limited to, GH61 polypeptides from: thielavia terrestris (WO 2005/074647, WO 2008/148131 and WO 2011/035027), Thermoascus aurantiacus (WO 2005/074656 and WO 2010/065830), Trichoderma reesei (WO 2007/089290 and WO 2012/149344), myceliophthora thermophila (WO 2009/085935, WO 2009/085859, WO 2009/085864, WO 2009/085868 and WO2009/033071), Aspergillus fumigatus (WO 2010/138754), Penicillium pinophilum (WO 2011/005867), Phosphaerella thermophila (WO2011/039319), Penicillium (Penicillium emersonii) (WO 2011/041397 and WO 2012/000892), Thermoascus crustacea (Thermoascus crusteous) (WO 2011/041504), Aspergillus aculeatus (WO 2012/125925), Thermomyces lanuginosus (WO 2012/113340, WO 2012/129699, WO 2012/130964 and WO 2012/129699), Aurantiporus alborubescens (WO 2012/122477), Trichophyton fulvescens (WO 2012/122477), Penicillium torulosum (WO 2012/122477), Talaromyces clavuligerus (WO 2012/135659), Humicola insolens (WO 2012/146171), Scedosporium camphorata (WO 2012/101206), Talaromyces leycettanus (WO 2012/101206), and Chaetomium thermophilum (WO 2012/101206) and Talaromyces thermophilus (Talaromyces thermophilus) (WO 2012/129697 and WO 2012/130950).

In one aspect, GH61 polypeptides having cellulolytic enhancing activity are used in the presence of a soluble activated divalent metal cation (e.g., manganese or copper) according to WO 2008/151043.

In another aspect, GH61 polypeptides having cellulolytic enhancing activity are used in the presence of a dioxygen compound, a bicyclic compound, a heterocyclic compound, a nitrogen-containing compound, a quinone compound, a sulfur-containing compound, or a liquid obtained from a pretreated cellulosic material (e.g., pretreated corn stover) (WO 2012/021394, WO 2012/021395, WO 2012/021396, WO 2012/021399, WO 2012/021400, WO 2012/021401, WO 2012/021408, and WO 2012/021410).

The dioxy compounds may include any suitable compound containing two or more oxygen atoms. In some aspects, the dioxy compound comprises one aryl moiety substituted as described herein. The dioxy compounds may include one or more (e.g., several) hydroxyl groups and/or hydroxyl derivatives, but also include substituted aryl moieties lacking hydroxyl groups and hydroxyl derivatives. Non-limiting examples of dioxy compounds include catechol or catechol; caffeic acid; 3, 4-dihydroxybenzoic acid; 4-tert-butyl-5-methoxy-1, 2-benzenediol; pyrogallol; gallic acid; methyl 3,4, 5-trihydroxybenzoate; 2,3, 4-trihydroxybenzophenone; 2, 6-dimethoxyphenol; sinapic acid; 3, 5-dihydroxybenzoic acid; 4-chloro-1, 2-benzenediol; 4-nitro-1, 2-benzenediol; tannic acid; 4, gallic acid ethyl ester; methyl glycolate; dihydroxy fumaric acid; 2-butyne-1, 4-diol; croconic acid; 1, 3-propanediol; tartaric acid; 2, 4-pentanediol; 3-ethoxy-1, 2-propanediol; 2,4,4' -trihydroxybenzophenone; cis-2-butene-1, 4-diol; 3, 4-dihydroxy-3-cyclobutene-1, 2-dione; dihydroxyacetone; acrolein acetal; 4-hydroxybenzoic acid methyl ester; 4-hydroxybenzoic acid; and methyl 3, 5-dimethoxy-4-hydroxybenzoate; or a salt or solvate thereof.

The bicyclic compounds may include any suitable substituted fused ring system as described herein. These compounds may contain one or more (e.g., several) additional rings and are not limited to a specific number of rings unless otherwise specified. In one aspect, the bicyclic compound is a flavonoid. In another aspect, the bicyclic compound is an optionally substituted isoflavonoid. In another aspect, the bicyclic compound is an optionally substituted anthocyanin ion (flavylium ion), such as an optionally substituted anthocyanidin or optionally substituted anthocyanin, or derivatives thereof. Non-limiting examples of bicyclic compounds include: epicatechin, quercetin, myricetin, taxol, kaempferol, morin, robinin, naringenin, isorhamnetin, apigenin, cyanidin glycoside, black soybean polyphenol, anthocyanin rhamnoside, or a salt or solvate thereof.

The heterocyclic compound may be any suitable compound as described herein, such as an optionally substituted aromatic or non-aromatic ring comprising a heteroatom. In one aspect, the heterocycle is a compound comprising an optionally substituted heterocycloalkyl moiety or an optionally substituted heteroaryl moiety. In another aspect, the optionally substituted heterocycloalkyl moiety or optionally substituted heteroaryl moiety is an optionally substituted 5-membered heterocycloalkyl or an optionally substituted 5-membered heteroaryl moiety. In another aspect, the optionally substituted heterocycloalkyl or optionally substituted heteroaryl moiety is an optionally substituted moiety selected from: pyrazolyl, furyl, imidazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrrolyl, pyridyl, pyrimidinyl, pyridazinyl, thiazolyl, triazolyl, thienyl, dihydrothienopyrazolyl, thioindenyl, carbazolyl, benzimidazolyl, benzothienyl, benzofuranyl, indolyl, quinolinyl, benzotriazolyl, benzothiazolyl, benzoxazolyl, benzimidazolyl, isoquinolinyl, isoindolyl, acridinyl, benzisoxazolyl, dimethylhydantoin, pyrazinyl, tetrahydrofuranyl, pyrrolinyl, pyrrolidinyl, morpholinyl, indolyl, diazepinyl, azepinyl, thiazepinyl, piperidinyl, and oxazepinyl. In another aspect, the optionally substituted heterocycloalkyl moiety or optionally substituted heteroaryl moiety is an optionally substituted furyl group. Non-limiting examples of heterocyclic compounds include (1, 2-dihydroxyethyl) -3, 4-dihydroxyfuran-2 (5H) -one; 4-hydroxy-5-methyl-3-furanone; 5-hydroxy-2 (5H) -furanone; [1, 2-dihydroxyethyl ] furan-2, 3,4(5H) -trione; α -hydroxy- γ -butyrolactone; ribono gamma-lactone; hexuronic acid (aldohexuronaldheuronic acid) γ -lactone; glucono delta-lactone; 4-hydroxycoumarin; dihydrobenzofuran; 5- (hydroxymethyl) furfural; bi-furfural; 2(5H) -furanone; 5, 6-dihydro-2H-pyran-2-one; and 5, 6-dihydro-4-hydroxy-6-methyl-2H-pyran-2-one; or a salt or solvate thereof.

The nitrogen-containing compound may be any suitable compound having one or more nitrogen atoms. In one aspect, the nitrogen-containing compound comprises an amine, imine, hydroxylamine, or nitroxide moiety. Non-limiting examples of nitrogen-containing compounds include acetoxime; purple uric acid; pyridine-2-aldoxime; 2-aminophenol; 1, 2-phenylenediamine; 2,2,6, 6-tetramethyl-1-piperidinyloxy; 5,6,7, 8-tetrahydrobiopterin; 6, 7-dimethyl-5, 6,7, 8-tetrahydropterin; and maleic acid amide; or a salt or solvate thereof.

The quinone compound may be any suitable compound comprising a quinone moiety as described herein. Non-limiting examples of quinone compounds include: 1, 4-benzoquinone, 1, 4-naphthoquinone, 2-hydroxy-1, 4-naphthoquinone, 2, 3-dimethoxy-5-methyl-1, 4-benzoquinone or coenzyme Q₀2,3,5, 6-tetramethyl-1, 4-benzoquinone or duroquinone, 1, 4-dihydroxyanthraquinone, 3-hydroxy-1-methyl-5, 6-indolinedione or adrenaline red4-tert-butyl-5-methoxy-1, 2-benzoquinone, pyrroloquinoline quinone, or a salt or solvate thereof.

The sulfur-containing compound may be any suitable compound containing one or more sulfur atoms. In one aspect, the sulfur-containing compound comprises a moiety selected from: sulfinyl, thioether, sulfinyl, sulfonyl, sulfamide, sulfonamide, sulfonic acid, and sulfonate ester. Non-limiting examples of sulfur-containing compounds include ethanethiol; 2-propanethiol; 2-propene-1-thiol; 2-mercaptoethanesulfonic acid; thiophenol; benzene-1, 2-dithiol; (ii) cysteine; (ii) methionine; glutathione; cystine; or a salt or solvate thereof.

In one aspect, an effective amount of such a compound is added to the cellulosic material in the following molar ratio of the compound to glucosyl units of cellulose as described above: about 10^-6To about 10, e.g. about 10^-6To about 7.5, about 10^-6To about 5, about 10^-6To about 2.5, about 10^-6To about 1, about 10^-5To about 1, about 10^-5To about 10^-1About 10^-4To about 10^-1About 10^-3To about 10^-1Or about 10^-3To about 10^-2. In another aspect, an effective amount of such a compound is about 0.1 μ M to about 1M, e.g., about 0.5 μ M to about 0.75M, about 0.75 μ M to about 0.5M, about 1 μ M to about 0.25M, about 1 μ M to about 0.1M, about 5 μ M to about 50mM, about 10 μ M to about 25mM, about 50 μ M to about 25mM, about 10 μ M to about 10mM, about 5 μ M to about 5mM, or about 0.1mM to about 1 mM.

The term "liquor (liqor)" means the solution phase (aqueous phase, organic phase or combination thereof) resulting from the treatment of lignocellulosic and/or hemicellulosic material, or monosaccharides thereof (e.g., xylose, arabinose, mannose, etc.) in the pulp, and soluble contents thereof, under conditions as described in WO 2012/021401. A liquor for cellulolytic enhancement of a GH61 polypeptide can be produced by treating a lignocellulosic or hemicellulosic material (or feedstock) by applying heat and/or pressure, optionally in the presence of a catalyst (e.g., an acid), optionally in the presence of an organic solvent, and optionally in combination with physically disrupting the material, and then separating the solution from residual solids. The degree to which enhanced cellulolytic activity can be obtained from the combination of a liquid and a GH61 polypeptide during hydrolysis of a cellulosic substrate by a cellulolytic enzyme preparation is determined by such conditions. The liquid formulation may be separated from the treated material using standard methods in the art, such as filtration, sedimentation or centrifugation.

In one aspect, the effective amount of liquid to cellulose is about 10^-6To about 10g/g of cellulose, e.g. about 10^-6To about 7.5g, about 10^-6To about 5g, about 10^-6To about 2.5g, about 10^-6To about 1g, about 10^-5To about 1g, about 10^-5To about 10^-1g. About 10^-4To about 10^-1g. About 10^-3To about 10^-1g. Or about 10^-3To about 10^-2g/g cellulose.

In one aspect, the one or more (e.g., several) hemicellulolytic enzymes comprise a commercial hemicellulolytic enzyme preparation. Examples of commercial hemicellulolytic enzyme preparations suitable for use in the present invention include, for example, SHEARZYME^TM(Novit Co.) of,HTec (Novit Co.),HTec2 (Novit Co.),HTec3 (Novit Co.),(Novit Co.) of,(Novit Co.) of,HC (Novit Co.),Xylanase (Jenko Co., Ltd.),XY (Jenko Co., Ltd.),XC (Jennonidae Corp.),TX-200A (AB Enzymes), HSP 6000 xylanase (DSM), DEPOL^TM333P (Biocatalysts Limit, Wilms, UK), DEPOL^TM740L (biocatalyst, Inc., Wales, UK) and DEPOL^TM762P (biocatalyst, Inc., Wales, UK), ALTERNA FUEL 100P (Dyadic Inc.) and ALTERNA FUEL 200P (Dyadic Inc.).

Examples of xylanases useful in the methods of the invention include, but are not limited to, xylanases from: aspergillus aculeatus (GeneSeqP: AAR 63790; WO 94/21785), Aspergillus fumigatus (WO 2006/078256), Penicillium pinophilum (WO2011/041405), Penicillium (WO 2010/126772), Thermomyces lanuginosus (GeneSeqP: BAA22485), Talaromyces thermophilus (GeneSeqP: BAA22834), Thielavia terrestris NRRL 8126(WO 2009/079210), and Trichophyton fulvum (WO 2011/057083).

Beta-xylosidases useful in the methods of the invention include, but are not limited to, beta-xylosidases from: neurospora crassa (SwissProt: Q7SOW4), Trichoderma reesei (UniProtKB/TrEMBL: Q92458), Talaromyces emersonii (SwissProt: Q8X212), and Talaromyces thermophilus (GeneSeqP: BAA 22816).

Examples of acetyl xylan esterases useful in the methods of the present invention include, but are not limited to, acetyl xylan esterases from: aspergillus aculeatus (WO 2010/108918), Chaetomium globosum (Uniprot: Q2GWX4), Chaetomium globosum (Chaetomium gracile) (GeneSeqp: AAB82124), Humicola insolens DSM 1800(WO 2009/073709), Hypocrea erythraea (WO 2005/001036), myceliophthora thermophila (WO 2010/014880), Neurospora crassa (Uniprot: Q7s259), Septoria nodorum (Phaeospora nodorum) (Uniprot: Q0UHJ1), and Thielavia terrestris NRRL 8126(WO 2009/042846).

Examples of feruloyl esterases (feruloyl esterases) useful in the methods of the present invention include, but are not limited to, feruloyl esterases from: humicola insolens DSM 1800(WO 2009/076122), Fusarium fischeri (Neosartorya fischeri) (Uniprot: A1D9T4), Neurospora crassa (Uniprot: Q9HGR3), Penicillium chrysogenum (Penicillium aurantigresum) (WO 2009/127729), and Thielavia terrestris (WO 2010/053838 and WO 2010/065448).

Examples of arabinofuranosidases useful in the methods of the invention include, but are not limited to, arabinofuranosidases from: aspergillus niger (GeneSeqp: AAR94170), Humicola insolens DSM 1800(WO 2006/114094 and WO 2009/073383), and Grifola giganteus (M.giganteus) (WO 2006/114094).

Examples of alpha-glucuronidases useful in the methods of the invention include, but are not limited to, alpha-glucuronidases from: aspergillus clavatus (UniProt: alcc12), Aspergillus fumigatus (SwissProt: Q4WW45), Aspergillus niger (UniProt: Q96WX9), Aspergillus terreus (SwissProt: Q0CJP9), Humicola insolens (WO 2010/014706), Penicillium chrysogenum (WO 2009/068565), Talaromyces emersonii (UniProt: Q8X211), and Trichoderma reesei (UniProt: Q99024).

Examples of oxidoreductases useful in the methods of the invention include, but are not limited to: aspergillus fumigatus catalase, Aspergillus lentilus catalase, Aspergillus niger catalase, Aspergillus oryzae catalase, Humicola insolens catalase, Neurospora crassa catalase, Penicillium emersonii catalase, Scytalidium thermophilum catalase, Talaromyces flavus catalase, Thermoascus aurantiacus catalase, Coprinus cinereus (Coprinus cinerea) laccase, myceliophthora thermophila laccase, Polyporus pinsitus laccase, Microporus rhodochrous (Pcnoporus cinnabarus) laccase, Rhizoctonia solani (Rhizoctonia solani) laccase, Streptomyces coelicolor laccase, Coprinus cinereus peroxidase, soybean peroxidase, and Royal palm (Royal palm) peroxidase.

The enzymatically active polypeptides used in the methods of the invention can be produced by fermentation of the above-described microbial strains on nutrient media containing suitable carbon and nitrogen sources and inorganic salts using procedures known in the art (see, e.g., bannit, J.W (Bennett, J.W.), and la fever, L. (LaSure, L.) (editions), More genetic Manipulations in Fungi (More Gene Manipulations in Fungi, academic press, california, 1991). Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American type culture Collection). Temperature ranges and other conditions suitable for growth and enzyme production are known in the art (see, e.g., belief j.e. (Bailey, j.e.) and orlistat D.F (Ollis, D.F.), biochemical engineering foundation (biochemical engineering Fundamentals), McGraw-Hill Book Company, new york, 1986).

Fermentation may be any method of culturing cells that results in the expression or isolation of an enzyme or protein. Fermentation may therefore be understood as comprising shake flask cultivation, or small-or large-scale fermentation (including continuous, batch, fed-batch or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the enzyme to be expressed or isolated. The resulting enzyme produced by the above-described process can be recovered from the fermentation medium and purified by conventional procedures.

And (5) fermenting.The fermentable sugars obtained from the hydrolyzed cellulosic material can be fermented by one or more (e.g., several) fermenting microorganisms capable of fermenting the sugars directly or indirectly into the desired fermentation product. "fermentation" or "fermentation process" refers to any fermentation process or any process that includes a fermentation step. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry, and tobacco industry. The fermentation conditions depend on the desired fermentationProducts and fermenting organisms, and can be readily determined by one of ordinary skill in the art.

In the fermentation step, the sugars released from the cellulosic material as a result of the pretreatment and enzymatic hydrolysis steps are fermented by a fermenting organism (such as yeast) into a product, e.g., ethanol. Hydrolysis (saccharification) and fermentation may be separate or simultaneous.

Any suitable hydrolyzed cellulosic material can be used in the fermentation step in practicing the present invention. The material is generally selected on the basis of economics, i.e., cost per equivalent sugar potential, and recalcitrance to enzymatic conversion.

The term "fermentation medium" is understood herein to mean the medium prior to addition of one or more fermenting microorganisms, e.g., the medium resulting from a saccharification process, as well as the medium used in a simultaneous saccharification and fermentation process (SSF).

"fermenting microorganism" refers to any microorganism, including bacterial and fungal organisms, suitable for use in a desired fermentation process to produce a fermentation product. The fermenting organism may be a hexose and/or pentose fermenting organism, or a combination thereof. Both hexose and pentose sugar fermenting organisms are well known in the art. Suitable fermenting microorganisms are capable of fermenting (i.e., converting) sugars (such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, and/or oligosaccharides) directly or indirectly into the desired fermentation product. Examples of ethanol producing bacterial and fungal fermenting organisms are described by Lin (Lin) et al, 2006, applied microbiology and biotechnology (appl. Microbiol. Biotechnol.)69: 627-642.

Examples of fermenting microorganisms capable of fermenting hexoses include bacterial organisms and fungal organisms, such as yeast. Yeasts include strains of: candida, Kluyveromyces, and Saccharomyces, such as Candida sannariae (Candida sonorensis), Kluyveromyces marxianus, and Saccharomyces cerevisiae.

Examples of fermenting microorganisms that can ferment pentose sugars in their native state include bacterial and fungal organisms, such as a certain yeast. Xylose-fermenting yeasts include strains of the genus candida, preferably candida shehatae (c.sheatae) or candida sannariensis (c.sonorensis); and strains of the genus pichia, such as pichia stipitis, like pichia stipitis CBS 5773. Pentose-fermenting yeasts include strains of the genus pachysolen, preferably pachysolen tannophilus (p. Organisms incapable of fermenting pentoses (e.g., xylose and arabinose) can be genetically modified to ferment pentoses by methods known in the art.

Examples of bacteria that are capable of efficiently fermenting hexoses and pentoses to ethanol include, for example, Bacillus coagulans, Clostridium acetobutylicum (Clostridium acetobutylicum), Clostridium thermocellum (Clostridium thermocellum), Clostridium phytofermentans (Clostridium phytofermentans), Geobacillus, Thermoanaerobacter saccharolyticum, and Zymomonas mobilis (Philippines, G.P (Philippidis, G.P.), 1996, cellulose bioconversion technology (Cellulosenson conversion technology), the Handbook of Bioethanol: Production and Utilization (Handbook of on Bioethanol: Production and Utilization), Huaman, C.E (Wyman, C.E.) editors, Taylor-Francis group (Taylon & Washington, Wash., D.179, Wash., DC).

Other fermenting organisms include strains of: bacillus, such as Bacillus coagulans; candida species, such as Candida sanariisi, Candida sorboso (c.methanosorbosa), Candida didanosomatica (c.diddensiae), Candida parapsilosis (Candida parapsilosis), c.naedondara, Candida blankii (c.blankii), Candida acidophilus (c.entomophilia), Candida brassicae (c.brassicae), Candida pseudotropical (c.pseudotropical), Candida ebutii (c.boidinii), Candida utilis (c.utilis), and Candida shehatae; clostridia such as clostridium acetobutylicum, clostridium thermocellum, and clostridium zymophyte; coli, particularly strains of escherichia coli that have been genetically modified to improve ethanol yield; (ii) a geobacillus species; hansenula, such as Hansenula anomala; klebsiella (Klebsiella), such as Klebsiella oxytoca (k. oxytoca); kluyveromyces, such as kluyveromyces marxianus (k.marxianus), kluyveromyces lactis (k.lactis), kluyveromyces thermotolerans (k.thermolelans), and kluyveromyces fragilis (k.fragilis); schizosaccharomyces, such as schizosaccharomyces pombe (s.pombe); thermoanaerobacter species (Thermoanaerobacter), such as Thermoanaerobacter saccharolyticum, and Zymomonas species (Zymomonas), such as Zymomonas mobilis.

Commercially available yeasts suitable for ethanol production include, for example, BIOFERM^TMAFT and XR (NABC-North American Bioproducts Corporation, Georgia, USA), ETHANOL RED^TMYeast (Fermantis/Lesafre, USA), FALI^TM(Fleischmann's Yeast, USA), FERMIOL^TM(Disemann batching section (DSM Specialties)), GERT STRAND^TM(Gert Strand AB, Sweden), and SUPERSTART^TMAnd THERMOSACC^TMFresh yeast (Ethanol Technology, wisconsin, usa).

In one aspect, the fermenting microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as xylose-utilizing microorganisms, arabinose-utilizing microorganisms, and xylose and arabinose co-utilizing microorganisms.

Cloning of heterologous genes into various fermenting microorganisms organisms (Chen) and Ho (Ho), 1993, application of biochemistry and Biotechnology (appl. Biochem. Biotechnol.)39-40: 135-147; Ho et al, 1998, application of environmental microbiology (appl. Environ. Microbiol.) 18564: 7762-1859; Kotter and West plug (Ciriacy), 1993, application of microbiology and Biotechnology (appl. Microbiol. Biotechnol.)38: 776-783; Wilford (Walfrsson) et al, 1995, application of environmental microbiology 61: 4184-4190; Kjep et al, 2004, European Union of microbiology (FEMS Yeast Research 296; FERS Yeast Research 296; 1998; Biotech) 664: 664; Bealh et al, Biotechnology (Bergey.) 303; biovar. Biotechnology; 1998), biotechnology and bioengineering 58: 204-214; zhang (Zhang) et al, 1995, Science 267: 240-; deamada et al, 1996, applied and environmental microbiology 62: 4465-4470; WO 2003/062430).

In one aspect, the fermenting organism comprises a polynucleotide encoding a variant of the invention.

In another aspect, the fermenting organism comprises one or more polynucleotides encoding one or more cellulolytic enzymes, hemicellulolytic enzymes, and helper enzymes described herein.

It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.

Typically, the fermenting microorganism is added to the degraded cellulosic material or hydrolysate and the fermentation is carried out for about 8 to about 96 hours, for example about 24 to about 60 hours. The temperature is typically between about 26 ℃ to about 60 ℃, e.g., about 32 ℃ or 50 ℃, and the pH is about pH 3 to about pH8, e.g., pH 4 to 5,6, or 7.

In one aspect, yeast and/or another microorganism is applied to the degraded cellulosic material and fermentation is carried out for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably between about 20 ℃ to about 60 ℃, e.g., about 25 ℃ to about 50 ℃, about 32 ℃ to about 50 ℃, or about 32 ℃ to about 50 ℃, and the pH is typically about pH 3 to about pH7, e.g., about pH 4 to about pH7. However, some fermenting organisms (e.g., bacteria) have a higher optimal fermentation temperature. The yeast or another microorganism is preferably present at about 10 per ml fermentation broth⁵To 10¹²Preferably from about 10⁷To 10¹⁰In particular about 2X 10⁸The amount of viable cell count is administered. Further guidance regarding The use of yeast for fermentation can be found, for example, in "The Alcohol Textbook" (edited by K. yak (K. jacques), t.p. lyon (t.p. lyons) and d.r. kelsell (d.r. kelsall), Nottingham University Press (Nottingham University Press), United Kingdom (United Kingdom)1999), which are hereby incorporated by reference.

Fermentation stimulators may be used in combination with any of the methods described herein to further improve the fermentation process, particularly to improve the performance of the fermenting microorganism, e.g., to increase speed and ethanol yield. "fermentation stimulator" means a stimulator for the growth of fermenting microorganisms, particularly yeast. Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenic acid, nicotinic acid, myo-inositol, thiamine, pyridoxine, p-aminobenzoic acid, folic acid, riboflavin, and vitamins A, B, C, D and E. See, for example, Alfrenodo et al, Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feed strategy during a fed batch process (Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding mechanism) Schrenerger (2002), which is incorporated herein by reference. Examples of minerals include minerals and mineral salts that can supply nutrients including P, K, Mg, S, Ca, Fe, Zn, Mn, and Cu.

Fermentation product:the fermentation product may be any material resulting from fermentation. The fermentation product may be, without limitation: alcohols (e.g., arabitol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1, 3-propanediol (propylene glycol), butylene glycol, glycerol, sorbitol, and xylitol); alkanes (e.g., pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane); cycloalkanes (e.g., cyclopentane, cyclohexane, cycloheptane, and cyclooctane); olefins (e.g., pentene, hexene, heptene, and octene); amino acids (e.g., aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); gases (e.g. methane, hydrogen (H)₂) Carbon dioxide (CO)₂) And carbon monoxide (CO)); isoprene; ketones (e.g., acetone); organic acids (e.g., acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2, 5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylonic acid); and polyketides.

In one aspect, the fermentation product is an alcohol. The term "alcohol" encompasses materials comprising one or more hydroxyl moieties. The alcohol may be, without limitation: n-butanol, isobutanol, ethanol, methanol, arabitol, butanediol, ethylene glycol, glycerol, 1, 3-propanediol, sorbitol, xylitol. See, e.g., palace (Gong) et al, 1999, Ethanol production from renewable resources (Ethanol production from renewable resources), in the Biochemical Engineering/Biotechnology Advance (Advances in Biochemical Engineering/Biotechnology), Sepeler, T. (Scheper, T.) (Schparr, Berlin, Heidelberg, Germany, 65: 207-) -241; silvia (sillveira) and jones (Jonas), 2002, using microbiology and biotechnology (appl. microbiol. biotechnol.)59: 400-; nigam (Nigam) and Cige, 1995, Process Biochemistry (Process Biochemistry)30(2) 117-; escheji (Ezeji) et al, 2003, Journal of the World of Microbiology and Biotechnology (World Journal of Microbiology and Biotechnology)19(6): 595-.

In another aspect, the fermentation product is an alkane. The alkane may be unbranched or branched. Alkanes may be, without limitation: pentane, hexane, heptane, octane, nonane, decane, undecane, or dodecane.

In another aspect, the fermentation product is a cycloalkane. Cycloalkanes may be, without limitation: cyclopentane, cyclohexane, cycloheptane or cyclooctane.

In another aspect, the fermentation product is an olefin. The olefin may be an unbranched or branched olefin. The olefin may be, without limitation: pentene, hexene, heptene or octene.

In another aspect, the fermentation product is an amino acid. The organic acid may be, without limitation: aspartic acid, glutamic acid, glycine, lysine, serine, or threonine. See, for example, Richard and Margaritinis 2004, Biotechnology and Bioengineering 87(4): 501-515.

In another aspect, the fermentation product isA gas. The gas may be, without limitation: methane, H₂、CO₂Or CO. See, e.g., Taoka et al (Kataoka), 1997, Water Science and Technology (Water Science and Technology)36(6-7): 41-47; and Gunaselinan (Gunaseelan), 1997, Biomass and bioenergy (Biomass and Bioenergy)13(1-2): 83-114.

In another aspect, the fermentation product is isoprene.

In another aspect, the fermentation product is a ketone. The term "ketone" encompasses a substance comprising one or more ketone moieties. Ketones may be, without limitation: acetone.

In another aspect, the fermentation product is an organic acid. The organic acid may be, without limitation: acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2, 5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, propionic acid, succinic acid, or xylonic acid). See, for example, Chen (Chen) and Li (Lee), 1997, biochemistry and biotechnology (biochem. Biotechnol.)63-65: 435-448.

In another aspect, the fermentation product is a polyketide.

Recovering. One or more fermentation products may optionally be recovered from the fermentation medium using any method known in the art, including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation, or extraction. For example, the alcohol is separated and purified from the fermented cellulosic material by conventional distillation methods. Ethanol with a purity of up to about 96 vol.% may be obtained, which may be used, for example, as fuel ethanol, potable ethanol, i.e., drinkable neutral spirits, or industrial ethanol.

Plant and method for producing the same

The invention also relates to isolated plants, e.g., transgenic plants, plant parts, or plant cells, which plants comprise a polynucleotide of the invention, such that cellobiohydrolase variants are expressed and produced in recoverable quantities. The variant may be recovered from the plant or plant part. Alternatively, plants or plant parts containing the variant may be used as such for improving the quality of food or feed, e.g. improving nutritional value, palatability, and rheological properties, or to destroy anti-nutritional factors.

The transgenic plant may be dicotyledonous (dicotyledonous) or monocotyledonous (monocotyledonous). Examples of monocotyledonous plants are grasses, such as meadow grass (bluegrass, poa); forage grasses, such as Festuca (Festuca), Lolium (Lolium); temperate grasses, such as bentgrass (Agrostis); and cereals, such as wheat, oats, rye, barley, rice, sorghum, and maize (corn).

Examples of dicotyledonous plants are tobacco, legumes (such as lupins, potatoes, sugar beets (sugar beets), peas, beans (beans) and soybeans (soybeans)), and cruciferous plants (cruciferae) (such as cauliflower, rapeseed, and the closely related model organism arabidopsis thaliana).

Examples of plant parts are stems, callus, leaves, roots, fruits, seeds, and tubers, as well as individual tissues comprising these parts, e.g., epidermis, mesophyll, parenchyma (parenchyme), vascular tissue, meristem. Specific plant cell compartments, such as chloroplasts, apoplasts (apoplasts), mitochondria, vacuoles, peroxisomes and cytoplasms are also considered plant parts. Furthermore, any plant cell, regardless of tissue origin, is considered a plant part. Likewise, plant parts, such as specific tissues and cells isolated to facilitate the utilization of the present invention, are also considered plant parts, such as embryos, endosperms, aleurone, and seed coats.

Also included within the scope of the invention are progeny of such plants, plant parts, and plant cells.

Transgenic plants or plant cells expressing the variants can be constructed according to methods known in the art. Briefly, the plant or plant cell is constructed by: incorporating one or more expression constructs encoding the variants into a plant host genome or chloroplast genome, and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell.

The expression construct is suitably a nucleic acid construct comprising a polynucleotide encoding a variant operably linked to appropriate regulatory sequences required for expression of the polynucleotide in the plant or plant part of choice. Furthermore, the expression construct may comprise a selectable marker for identifying the plant cell into which the expression construct is integrated, and DNA sequences necessary for introducing the construct into the plant in question (the latter depending on the method used for introducing the DNA).

For example, the choice of regulatory sequences such as promoter and terminator sequences and optional signal or transit sequences is determined based on when, where, and how the variant is desired to be expressed (Statklen, 2008, Nature Reviews 9: 433-443). For example, expression of a gene encoding a variant may be constitutive or inducible, or may be developmental, stage, or tissue specific, and the gene product may be targeted to a particular tissue or plant part, such as a seed or leaf. Regulatory sequences are described, for example, by Tager (Tague et al, 1988, Plant Physiology 86: 506.

For constitutive expression, the 35S-CaMV, maize ubiquitin 1, or rice actin 1 promoter (Franck et al, 1980, Cell (Cell)21: 285-. Organ-specific promoters may be, for example, promoters from storage tissue (e.g.seeds, potato tubers and fruits) (Edwards) and Korotz (Coruzzi), 1990, Ann. Rev. Genet.). 24:275-303), or from metabolic library tissue (e.g.meristems) (Ito et al, 1994, Plant molecular biology (Plant mol. biol.). 24:863-878), seed-specific promoters, for example the glutelin, prolamin, globulin or albumin promoters from rice (Wu) et al, 1998, Plant and Cell physiology (Plant Cell physiology.) 39:885-889), the fava bean promoter from legumain B4 and the fava bean seed protein gene from fava bean (Conrad et al, 1998, Plant physiology J. 152: 711), the promoter from the seed oil body protein (Chen) et al, 1998, Plant and cell physiology (Plant CellPhysiol.)39:935-941), the napA promoter from the storage protein of Brassica napA, or any other seed-specific promoter known in the art, for example, as described in WO 91/14772. Furthermore, the promoter may be a leaf-specific promoter, such as the rbcs promoter from rice or tomato (Kyozuka et al, 1993, Plant physiology (Plant physiology.) 102:991-1000), the Chlorella virus adenine methyltransferase gene promoter (Mitra and Higgins, 1994, Plant molecular biology (Plant mol. biol.)26:85-93), the aldP gene promoter from rice (Kagaya et al, 1995, molecular genetics and genes (mol. Gen. Genet.)248:668-674), or a wound-inducible promoter (such as the potato pin2 promoter) (Xu et al, 1993, Plant molecular biology 22: 573-588). Similarly, promoters may be induced by non-biological treatments such as temperature, drought, or salinity changes, or by exogenously applied substances that activate the promoter, such as ethanol, estrogens, phytohormones (such as ethylene, abscisic acid, and gibberellic acid), and heavy metals.

Promoter enhancer elements can also be used to achieve higher expression of variants in plants. For example, a promoter enhancer element can be an intron that is placed between the promoter and the polynucleotide encoding the variant. For example, et al, 1993, supra, disclose the use of the first intron of the rice actin 1 gene to enhance expression.

The selectable marker gene and any other part of the expression construct may be selected from those available in the art.

The nucleic acid construct may be incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biolistic transformation, and electroporation (Gasser et al, 1990, science 244: 1293; Bortekus (Potrykus), 1990, biology/technology 8: 535; Islands (Shimamoto et al, 1989, Nature 338: 274).

Agrobacterium tumefaciens-mediated gene transfer is currently a method for generating transgenic dicotyledonous plants (for review see Hooykas and Schilperort, 1992, Plant molecular biology 19:15-38) and for transforming monocotyledonous plants, but other transformation methods are often used for these plants. A method for the generation of transgenic monocots is the bombardment of the embryogenic callus or developing embryo (Christou, 1992, Plant J. 2: 275-. An alternative method for transforming monocotyledonous plants is based on protoplast transformation, as described by Omilleh et al, 1993, Plant molecular biology (Plant mol. biol.)21: 415. sub.428. Additional transformation methods include those described in U.S. Pat. nos. 6,395,966 and 7,151,204 (both incorporated herein by reference in their entirety).

After transformation, transformants having incorporated the expression construct are selected and regenerated into whole plants according to methods well known in the art. Transformation programs are generally designed for selective elimination of the selection gene during regeneration or in subsequent generations by: for example, co-transformation with two separate T-DNA constructs or site-specific excision of a selection gene using a specific recombinase is used.

In addition to direct transformation of a particular plant genotype with a construct of the invention, a transgenic plant can be produced by crossing a plant having the construct with a second plant lacking the construct. For example, a construct encoding a variant can be introduced into a particular plant variety by crossing, without the need to always directly transform the plant of that given variety. Thus, the present invention encompasses not only plants directly regenerated from cells which have been transformed according to the invention, but also the progeny of such plants. As used herein, progeny may refer to progeny of any generation of the parent plant prepared according to the present invention. Such progeny may comprise a DNA construct made according to the present invention. Crossing results in the introduction of the transgene into the plant line by cross-pollination of the donor plant line with the starter line. Non-limiting examples of such steps are described in U.S. patent No. 7,151,204.

Plants may be generated by backcross transformation methods. For example, a plant comprises a genotype, germline, inbred, or hybrid plant referred to as backcross transformation.

Genetic markers may be used to assist in the introgression of one or more transgenes of the invention from one genetic background into another. Marker-assisted selection offers an advantage over conventional breeding in that it can be used to avoid errors caused by phenotypic variation. In addition, genetic markers can provide data on the relative degree of elite germplasm in individual progeny of a particular cross. For example, when a plant having a desired trait and additionally having a non-agronomically desired genetic background is crossed with an elite parent, the genetic marker may be used to select for progeny that not only have the trait of interest, but also a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits into a particular genetic background is minimized.

The invention also relates to a method of producing a variant of the invention, comprising: (a) cultivating a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant; and (b) recovering the variant.

The invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

Examples of the invention

Bacterial strains

Aspergillus oryzae strain MT3568 was used as a host for expression of the Trichoderma reesei gene encoding cellobiohydrolase I and variants thereof. Aspergillus oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002/40694), wherein the pyrG auxotroph is repaired by disruption of the Aspergillus oryzae acetamidase (amdS) gene.

Culture media and solutions

The COVE sucrose plate or slant is composed of 342g of sucrose, 20g of agar powder and 20ml of agar powderCOVE salt solution, and deionized water to make up to 1 liter. The medium was sterilized by autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8 th edition, revision A, 1998). The medium was cooled to 60 ℃ and then 10mM acetamide, 15mM CsCl andX-100(50μl/500ml)。

COVE salt solution from 26g MgSO₄·7H₂O, 26g of KCl and 26g of KH₂PO₄50ml of COVE trace metal solution, and deionized water to make up to 1 liter.

COVE trace metals solution was composed of 0.04g of Na₂B₄O₇·10H₂O, 0.4g of CuSO₄·5H₂O, 1.2g of FeSO₄·7H₂O, 0.7g of MnSO₄·H₂O, 0.8g of Na₂MoO₄·2H₂O, 10g of ZnSO₄·7H₂O, and deionized water to make up to 1 liter.

DAP-4C Medium consisted of 20g of dextrose, 10g of maltose, 11g of MgSO₄·7H₂O, 1g KH₂PO₄2g of citric acid, 5.2g of K₃PO₄·H₂O, 0.5g yeast extract (Difco), 1ml antifoam, 0.5ml KU6 trace metals solution, 2.5g CaCO₃And deionized water to make up to 1 liter. The medium was sterilized by autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8 th edition, revision A, 1998). Before use, 3.5ml of sterile 50% (NH) were added per 150ml of medium₄)₂HPO₄And 5ml of sterile 20% lactic acid.

The G2-Gly medium consisted of 18G of yeast extract, 24G of glycerol (86% -88%), 1ml of antifoam, and deionized water to make up to 1 liter.

The KU6 trace metal solution was prepared from 0.13g of NiCl₂2.5g of CuSO₄·5H₂O, 13.9g of FeSO₄·7H₂O, 8.45g of MnSO₄·H₂O, 6.8g ZnCl₂3g of citric acid, and deionized water to make up to 1 liter.

The LB medium consists of 10g of Bacto-Tryptone (Bacto-Tryptone), 5g of yeast extract, 10g of sodium chloride, and deionized water to make up to 1 liter.

The LB plate consisted of 10g of bacto tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of bacto agar, and deionized water to make up to 1 liter.

PDA plates were constructed from potato extract (potato extract was made by boiling 300g of sliced (washed but unpeeled) potatoes in water for 30 minutes and then decanting or filtering the broth through a cheesecloth). Then, distilled water was added until the total volume of the suspension was 1 liter. Then, 20g of dextrose and 20g of agar powder were added. The medium was sterilized by autoclaving at 15psi for 15 minutes (bacteriological analytical Manual, 8 th edition, revision A, 1998).

The TAE buffer consisted of 40mM Tris base, 20mM sodium acetate, and 1mM disodium EDTA.

YP + 2% glucose medium consisted of 1% yeast extract, 2% peptone, and 2% glucose in deionized water.

YP + 2% maltose medium consisted of 10g of yeast extract, 20g of peptone, 20g of maltose, and deionized water to make up to 1 liter.

Example 1: sources of DNA sequence information for Trichoderma reesei cellobiohydrolase I

The genomic DNA sequence and deduced amino acid sequence of the Trichoderma reesei GH7 cellobiohydrolase I gene are shown in SEQ ID NO 1 and SEQ ID NO 2, respectively. Genomic sequence information was generated by the United states department of energy, Union genome institute (JGI) and published by Martinus et al, 2008, Nature Biotechnology 26(5): 553-. The amino acid sequence of full-length cellobiohydrolase I is publicly available from the National Center for Biotechnology Information (NCBI) and is annotated as GenBank: EGR44817.1(SEQ ID NO: 2). The cDNA sequence and deduced amino acid sequence of the Trichoderma reesei cellobiohydrolase I gene are shown in SEQ ID NO. 3 and SEQ ID NO. 2, respectively.

Codon-optimized synthetic genes encoding full-length cellobiohydrolase I were generated for Aspergillus oryzae expression based on publicly available amino acid sequences based on the algorithm developed by Gustafsson et al, 2004, Trends Biotechnology 22(7): 346-. By passingThe gene synthesis service (Life Technologies Corp., san Diego, Calif.) synthesized a codon-optimized coding sequence (SEQ ID NO:4) with a 5 'Bam HI restriction site, a 3' Hind III restriction site, and a Kozac consensus sequence (CACC) located between the start codon and the Bam HI restriction site.

Example 2: site-directed mutagenesis of Trichoderma reesei cellobiohydrolase I

Codon-optimized synthetic genes encoding Trichoderma reesei cellobiohydrolase I were provided in non-designated kanamycin resistant E.coli cloning vectors. To generate a Trichoderma reesei cellobiohydrolase I M6 variant (SEQ ID NO:5 for mutant DNA sequences and SEQ ID NO:6 for variants), the AAC codon (N197) was replaced with a GCC codon (197A) and the AAC codon (N200) was replaced with a GCC codon (200A). Use ofPrimer design (Agilent Technologies, Inc.), wilmington, talawa, usa) the on-line tool designed two synthetic primers for site-directed mutagenesis to introduce site-directed mutations changing AAC codon (N197) to GCC codon (197A) and AAC codon (N200) to GCC codon (200A) as shown below.

Using the following primers and procedures, byKanamycin provided by gene synthesisTwo PCR amplifications of the resistant e.coli cloning vector facilitated site-directed mutagenesis of the synthetic gene encoding the wild-type trichoderma reesei cellobiohydrolase:

primer F-N197A:

5’-GGGAACCCTCGTCGGCCAACGCCAACACCG-3’(SEQ ID NO:23)

primer R-N197A:

5’-CGGTGTTGGCGTTGGCCGACGAGGGTTCCC-3’(SEQ ID NO:24)

primer F-N200A:

5'-TCGTCGGCCAACGCCGCCACCGGCATTGGAGG-3' (SEQ ID NO:25) primer R-N200A:

5’-CCTCCAATGCCGGTGGCGGCGTTGGCCGACGA-3’(SEQ ID NO:26)

use ofThe high fidelity PCR kit (Finnzymes Oy, Esburg, Finland) introduced two mutations consecutively by PCR. The PCR solution was composed of 10. mu.l of 5 XHF buffer (FINNZYMES Oy, Esburg, Finland), 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l) (FINNZYMES Oy, Esburg, Finland), 2.5. mu.l of primer F-N197A (10. mu.M), 2.5. mu.l of primer R-N197A (10. mu.M), and 1. mu.l of template DNA (1. mu.l: (DNA polymerase-DNA polymeraseVehicle, 10 ng/. mu.l) and 32.5. mu.l of deionized water in a total volume of 50. mu.l. PCR was performed using a PTC-200DNA engine (MJ Research Inc., waltham, ma, usa) programmed for 1 cycle at 98 ℃ for 30 seconds; and 16 cycles, each cycle lasting 30 seconds at 98 ℃,1 minute at 55 ℃, and 4 minutes at 72 ℃. The PCR solution was then maintained at 15 ℃ until removed from the PCR machine.

After PCR, 10 units of Dpn I were added directly to the PCR solution and incubated at 37 ℃ for 1 hour. Then, 1. mu.l of Dpn I was treated according to the manufacturer's protocolTransformation of the PCR solution into ONETOP 10F' chemically competent E.coli cells (Invitrogen, Calsbad, Calif.) and dispersed on LB plates supplemented with 0.05mg kanamycin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB kanamycin plates. Both transformants were cultured in LB medium supplemented with 0.05mg kanamycin/ml and usedThe Spin Miniprep kit (QIAGEN Inc., valencia, ca, usa) isolates plasmids.

The isolated plasmids were sequenced using an Applied Biosystems 3730xl DNA Analyzer (Applied Biosystems 3730xl DNA Analyzer) (Applied Biosystems, Foster City, Calif., USA) using vector primers and Trichoderma reesei cellobiohydrolase I gene-specific primers (R-Central) as shown below to determine representative plasmids that were free of PCR errors and contained AAC to GCC mutations.

Primer F-vector:

5’-CGTTGTAAAACGACGGCC-3’(SEQ ID NO:27)

primer R-vector:

5’-TGTTAATGCAGCTGGCAC-3’(SEQ ID NO:28)

primer R-Central:

5’-CTTGTCGGAGAACGACGA-3’(SEQ ID NO:29)

one plasmid clone that contained no PCR errors and contained the AAC (N197) to GCC (197A) mutations was selected and designated as plasmid pN 197A.

Performing a second round of PCR to useThe high fidelity PCR kit introduced the N200A mutation by PCR. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 2.5. mu.l of primer F-N200A (10. mu.M), 2.5. mu.l of primer R-N200A (10. mu.M), 1. mu.l of template DNA (pN197A, 10 ng/. mu.l) and 32.5. mu.l of deionized water in a total volume of 50. mu.l. PCR was performed using a PTC-200DNA engine, programmed for 1 cycle at 98 ℃ for 30 seconds; and 16 cycles, each cycle lasting 30 seconds at 98 ℃,1 minute at 55 ℃, and 4 minutes at 72 ℃. The PCR solution was then maintained at 15 ℃ until removed from the PCR machine.

After PCR, 10 units of Dpn I were added directly to the PCR solution and incubated at 37 ℃ for 1 hour. Then, 1. mu.l of Dpn I treated PCR solution was transformed into ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.05mg kanamycin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB kanamycin plates. Both transformants were cultured in LB medium supplemented with 0.05mg kanamycin/ml and usedThe Spin Miniprep kit isolates the plasmid.

The isolated plasmids were sequenced with the primers F-vector, R-vector and R-Central shown above using an applied biosystems 3730xl DNA Analyzer in order to determine representative plasmids that were free of PCR errors and contained AAC to GCC mutations.

One plasmid clone that contained no PCR errors and contained AAC (N197) to GCC (197A) and ACC (N200) to GCC (200A) mutations was selected and designated as plasmid pM 6. This variant is designated herein as the "M6 variant".

Example 3: construction of an Aspergillus oryzae expression vector comprising a Trichoderma reesei cDNA sequence encoding cellobiohydrolase I

According to the manufacturer's instructions, Fast Digest Bam HI and Hind III (Fermentas, Inc.)Inc.), from grenboni, maryland, usa) by digestionThe kanamycin-resistant E.coli cloning vector encoding Trichoderma reesei cellobiohydrolase I (SEQ ID NO:4) provided by gene synthesis. Reaction products were separated by 1.0% agarose gel electrophoresis using TAE buffer, where a 1552bp product band was excised from the gel and ILLUSTRA was used^TM GFX^TMThe DNA purification kit (GE Healthcare Life Sciences, Blume ratio, Denmark) was used for purification.

The 1552bp fragment was then cloned into Bam HI and Hind III digested pDau109(WO2005/042735) using T4DNA ligase (New England Biolabs, ispunwatch, ma, usa). Bam HI-Hind III digested pDau109 and Bam HI/Hind III fragment containing trichoderma reesei cellobiohydrolase I coding sequences were mixed in a molar ratio of 1:3 (i.e., mass ratio of about 2.5:1 or 20ng:50ng) and ligated with 50 units of T4DNA ligase overnight at 16 ℃ in 1X T4DNA ligase buffer with 1mM ATP according to the manufacturer's instructions (new england biosciences, ipprestic, ma, usa). The Trichoderma reesei cellobiohydrolase I gene was cloned into Bam HI-Hind III digested pDau109 resulting in transcription of the Trichoderma reesei cellobiohydrolase I gene under the control of the NA2-tpi dual promoter. The NA2-tpi promoter is a modified promoter from the gene encoding Aspergillus niger neutral alpha-amylase, in which the untranslated leader sequence has been replaced with the untranslated leader sequence from the gene encoding Aspergillus nidulans triose phosphate isomerase.

The insertion of the trichoderma reesei cellobiohydrolase I gene into pDau109 was verified by PCR on colonies using the following primers, as described below.

Primer F-pDau109

5’-CCCTTGTCGATGCGATGTATC-3’(SEQ ID NO:30)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

1.1XThe premix (Thermo Fisher Scientific, rosskole, denmark) was used for PCR. PCR solution was prepared from 10. mu.l of 1.1XThe premix, 0.5. mu.l of primer F-pDau109 (10. mu.M), and 0.5. mu.l of primer R-pDau109 (10. mu.M). A small amount of cells was transferred to the PCR solution using a toothpick. PCR was performed using a PTC-200DNA engine, programmed for 1 cycle, at 94 ℃ for 3 minutes; 30 cycles, each cycle lasting 30 seconds at 94 ℃,1 minute at 50 ℃, and 2 minutes at 72 ℃; and 1 cycle at 72 ℃ for 1 minute. The PCR solution was then maintained at 15 ℃ until removed from the PCR machine.

The PCR products were analyzed by 1.0% agarose gel electrophoresis using TAE buffer, where a 1860bp PCR product band was observed, confirming the insertion of the trichoderma reesei cellobiohydrolase I coding sequence into pDau 109.

Coli transformants containing the Trichoderma reesei cellobiohydrolase I plasmid construct were cultured in LB medium supplemented with 0.1mg ampicillin/ml and usedPlasmid DNA was isolated using Spin Miniprep kit. This plasmid was designated as pKHJN 0036.

Example 4: construction of an Aspergillus oryzae expression vector comprising a Trichoderma reesei cDNA sequence encoding a cellobiohydrolase I M6 variant

Plasmid pM6 encoding the Trichoderma reesei cellobiohydrolase I M6 variant was digested with Fast Digest Bam HI and Hind III according to the manufacturer's instructions. Reaction products were separated by 1.0% agarose gel electrophoresis using TAE buffer, where a 1552bp product band was excised from the gel and ILLUSTRA was used^TM GFX^TMAnd purifying by using a DNA purification kit.

The 1552bp fragment was then cloned into pDau109 digested with BamHI and Hind III using T4DNA ligase. The BamHI-HindIII digested pDau109 and BamHI/HindIII fragment containing the Trichoderma reesei cellobiohydrolase I M6 variant coding sequence were mixed in a molar ratio of 1:3 (i.e.mass ratio of about 2.5:1 or 20ng:50ng) and ligated overnight with 50 units of T4DNA ligase in 1X T4DNA ligase buffer with 1mM ATP at 16 ℃. Cloning of the Trichoderma reesei cellobiohydrolase I M6 variant gene into Bam HI-Hind III digested pDau109 resulted in transcription of the Trichoderma reesei cellobiohydrolase I M6 variant gene under the control of the NA2-tpi dual promoter described above.

The insertion of the Trichoderma reesei cellobiohydrolase I M6 variant gene into pDau109 was verified by PCR on colonies as described below using primers F-pDau109 and R-pDau109 (example 3) shown below.

Primer F-pDau109

5’-CCCTTGTCGATGCGATGTATC-3’(SEQ ID NO:30)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

1.1XThe premix was used for PCR. PCR solution was prepared from 10. mu.l of 1.1XThe premix, 0.5. mu.l of primer F-pDau109 (10. mu.M), and 0.5. mu.l of primer R-pDau109 (10. mu.M). A small amount of cells was transferred to the PCR solution using a toothpick. PCR was performed using a PTC-200DNA engine, programmed for 1 cycle, at 94 ℃ for 3 minutes; 30 cycles, each cycle lasting 30 seconds at 94 ℃,1 minute at 50 ℃, and 2 minutes at 72 ℃; and 1 cycle at 72 ℃ for 1 minute. The PCR solution was then maintained at 15 ℃ until removed from the PCR machine.

The PCR reaction products were analyzed by 1.0% agarose gel electrophoresis using TAE buffer, where a 1860bp PCR product band was observed, confirming the insertion of the trichoderma reesei cellobiohydrolase I M6 variant coding sequence into pDau 109.

Coli transformants containing the Trichoderma reesei cellobiohydrolase I M6 variant plasmid construct were cultured in LB medium supplemented with 0.1mg ampicillin/ml and usedThe Spin Miniprep kit isolates the plasmid. This plasmid was designated as pKHJN 0059.

Example 5: expression of wild-type Trichoderma reesei cellobiohydrolase I

The expression plasmid pKKHJN 0036 was transformed into Aspergillus oryzae MT3568 protoplasts according to Klitenssen (Christensen) et al, 1988, Biotechnology 6, 1419-1422 and WO 2004/032648. Aspergillus oryzae MT3568 protoplasts were prepared according to the method of EP0238023B1, pages 14-15.

Transformants were purified by a single conidium on COVE sucrose plates before sporulation on PDA plates. Spores of the transformants were inoculated into 96-deep-well plates containing 0.75ml of YP + 2% glucose medium and incubated at rest for 4 days at 30 ℃. Transformants were analyzed for production of Trichoderma reesei cellobiohydrolase I from culture supernatants of 96 deep-well cultures. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE 48-well gels (Invitrogen, Calsbad, Calif.) and Coomassie Brilliant blue staining. Based on the expression level given by SDS-PAGE, one transformant was selected and designated as Aspergillus oryzae CBH I.

For larger scale production, Aspergillus oryzae CBH I spores were spread onto COVE sucrose slants and incubated at 37 ℃ for five days. Using 5ml of 0.01%The fused spore slants were washed twice 20 to maximize the number of spores collected. Then, seven 500ml flasks containing 150ml of DAP-4C medium were inoculated with the spore suspension. The culture was incubated at 30 ℃ while constantly shaking at 100 rpm. On the fourth day after inoculation, the culture medium was filtered through a bottle cap MF75 SuperMachV 0.2 μm PES filter (bottle top MF 75)MachV 0.2 μm PES filter) (Seimer Feishell science Inc., Rosschel, Denmark) the culture broth was collected by filtration. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. The broth from Aspergillus oryzae CBH I produced a band of approximately 80kDa of Trichoderma reesei cellobiohydrolase I.

Example 6: expression of Trichoderma reesei cellobiohydrolase I M6 variants

The expression plasmid pKKJN 0059 was transformed into Aspergillus oryzae MT3568 protoplasts according to Klitenssen et al (Christensen), 1988, supra and WO 2004/032648. Aspergillus oryzae MT3568 protoplasts were prepared according to the method of European patent EP0238023, pages 14-15.

Transformants were purified by a single conidium on COVE sucrose plates before sporulation on PDA plates. Spores of the transformants were inoculated into 96-deep-well plates containing 0.75ml of YP + 2% glucose medium and incubated at rest for 4 days at 30 ℃. Transformants were analyzed for the production of the Trichoderma reesei cellobiohydrolase IM6 variant from culture supernatants of 96 deep-well cultures. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. Based on the expression levels given by SDS-PAGE, one transformant was selected for further work and designated Aspergillus oryzae M6.

For larger scale production, Aspergillus oryzae M6 spores were dispersed onto COVE sucrose slants and incubated at 37 ℃ for five days. Using 5ml of 0.01%The fused spore slants were washed twice 20 to maximize the number of spores collected. Then, seven 500ml flasks containing 150ml of DAP-4C medium were inoculated with the spore suspension. The culture was incubated at 30 ℃ while constantly shaking at 100 rpm. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75 SuperMachV 0.2 μm PES filter. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. The broth from aspergillus oryzae M6 produced a band of approximately 80kDa of the trichoderma reesei cellobiohydrolase I M6 variant.

Example 7: purification of Trichoderma reesei wild type cellobiohydrolase I and cellobiohydrolase I M6 variants

The filtered broth of aspergillus oryzae CBH I (example 5) and aspergillus oryzae M6 (example 6) was adjusted to pH7.0 and filtered using a 0.22 μ M PES filter (Nalge Nunc international group, rochester, new york, usa). Then, ammonium sulfate was added to each filtrate to a concentration of 1.8M.

Each filtrate was purified according to the following procedure. The filtrate was loaded in Phenyl equilibrated with 1.8M ammonium sulfate, 25mM HEPES (pH7.0)6Fast Flow column (high resolution), GE Healthcare, uk. After washing with 0.54M ammonium sulfate, the bound proteins were eluted in portions with 25mM HEPES (pH 7.0). Fractions were collected and 12-well used4% -12% Bis-Tris gels (general electro-medical group, Pesteviol, N.J., USA) were analyzed by SDS-PAGE. Based on SDS-PAGE as described above, these fractions were pooled and applied to SEPHADEX equilibrated with 25mM MES (pH 6.0)^TMG-25 (middle) column (general electric medical group, UK). Fractions were collected, analyzed by SDS-PAGE as described above, and pooled. The combined fractions were applied to 6ml RESOURCE equilibrated with 25mM MES (pH 6.0)^TM15Q column (general electric medical group, uk) and elution of bound protein with a linear 0-300mM sodium chloride gradient (12 column volumes) for wild type cellobiohydrolase or with a linear 0-350mM sodium chloride gradient (14 column volumes) for variants. Fractions were collected and passed through SDS-PAGE, A-PAGE using 4-nitrophenyl-beta-D-glucopyranoside (Sigma Chemical Co., St. Missouri, USA) and 4-nitrophenyl-beta-D-lactosyl-oside (lactopyranoside) (Sigma Chemical Co., St. Missouri, Mo., USA) as substrates₂₈₀And activity measurements. The assay was performed in 96-well Nunc microtiter plates (Seimer Scientific, Senyvale, Calif., USA). The assay buffer was 50mM birutan-Robinson (Britton-Robinson) buffer (50mM H)₃PO₄、50mM CH₃COOH、50mM H₃BO₃) With 50mM KCl and 1mM CaCl₂、0.01％X-100, and adjusting the pH to 6.0 by using NaOH. Mu.l samples of protein solution were pipetted into each well and 120. mu.l of 1mM substrate in assay buffer was added. The substrate 4-nitrophenyl-beta-D-glucopyranoside was used to determine the beta-glucosidase activity and 4-nitrophenyl-beta-D-lactopyranoside was used to determine the cellobiohydrolase I and cellobiohydrolase variant activities. A standard curve was generated by replacing the protein solution with 20. mu.l of 4-nitrophenolate standard (0, 0.05, 0.075, 0.1, 0.2, 0.3, 0.4, 0.5 mM). If necessary, the sample is dilutedIn assay buffer to produce absorption within the standard curve. The plates were sealed and incubated for 15 minutes at 37 ℃ in a homomixer (thermomixer) with shaking at 750 rpm. Immediately after incubation, the reaction was stopped by adding 100. mu.l of 0.5M glycine-2 mM EDTA (pH 10) and absorbance was measured at 405 nm. The uptake of the "blank" (where protein was added after termination of the solution) for each sample was recorded and subtracted from the results to obtain the uptake of the released 4-nitrophenolate.

Based on SDS-PAGE, A₂₈₀And activity measurements, fractions were combined to the final product.

Trichoderma reesei wild-type cellobiohydrolase I and cellobiohydrolase I M6 variants were purified to concentrations of 57 μ M and 38 μ M, respectively, e.g., using calculated molar extinction coefficients 84810M, respectively^-1·cm^-1And 84810M^-1·cm^-1By A₂₈₀Measured.

Example 8: measurement of the Activity of Trichoderma reesei cellobiohydrolase M6 variants on microcrystalline cellulose

Using microcrystalline cellulose: (PH 101; Sigma-Aldrich (Sigma-Aldrich), st louis, missouri, usa) as substrate, the activity of the purified cellobiohydrolase I M6 variant (example 7) was compared to the purified trichoderma reesei wild-type cellobiohydrolase I (example 7). Microcrystalline cellulose was assayed at 60 g/l 2mM CaCl as assay buffer₂50mM sodium acetate (pH 5).

The activity of the trichoderma reesei wild-type cellobiohydrolase I and cellobiohydrolase I M6 variants was measured in a water jacketed glass cell connected to a juebo F12 water bath (Buch & Holm a/S, hailey wu, denmark). Each reaction chamber was filled with 5ml of microcrystalline cellulose suspension and magnetically stirred at 600 rpm. The enzyme was injected into the cuvette using a 250. mu.l glass syringe (Hamilton Co., Boston, Mass.) with a Fusion 100 syringe pump (Chemyx, Stanford, U.S.) with an injection time of 1 second (wild type: 8.8. mu.l, 528. mu.l/min; M6 variant: 13.16. mu.l, 789. mu.l/min) to a final concentration of 100nM (5. mu.g/ml). The reaction was allowed to proceed at 25 ℃ for 5 hours before quenching with 80. mu.l of 1M NaOH.

Remove 2ml samples from each reaction and use 0.2. mu.M hydrophilicNML syringe filters (Sartorius stepim Biotech s.a.), gothin root, germany). The filtrate was diluted 1:10 with milliQ water (control was measured undiluted) and used a filter equipped with 4mm x 25cmCARBOPAC^TMA Dionex ICS-5000DC High Performance Liquid Chromatography (HPLC) system (semer technologies, senniwells, ca., usa) of PA10 column (semer technologies, senniwells, ca., usa), Dionex GP40 gradient pump (semer technologies, senniwells, ca., usa) and Dionex ED40 electrochemical detector with gold working electrodes (standard carbohydrate environment) (semer technologies, senniwells, ca., usa) analyzed for glucose, cellobiose, and cellotriose content. Oligosaccharides were loaded onto CARBOPAC at a flow rate of 1 ml/min using the following gradient program^TMSeparation on a PA10 column: isocratically eluting with 50mM sodium hydroxide for 0-4 min; 4-28 min, linear gradient to 100mM sodium acetate in 90mM sodium hydroxide; 28-29 min, linear gradient to 450mM sodium acetate in 200mM sodium hydroxide; 29-30 min, linear gradient to 100mM sodium hydroxide; 30-31 min, linear gradient to 50mM sodium hydroxide; and 31-35 minutes, re-equilibrating under the initial conditions. The pooled external standard was ([ glucose ]]/[ Cellobiose ]]/[ cellotriose]):1 μ M/2 μ M/0.5 μ M, 2 μ M/4 μ M/1 μ M, 3 μ M/6 μ M/1.5 μ M, 4 μ M/8 μ M/2 μ M, and 5 μ M/10 μ M/2.5 μ M. Use ofThe chromatographic data system (seimer feishell technologies, ross, denmark) performs chromatogram peak integration, standard curves and concentration determinations.

As demonstrated by the results shown in figure 1 and table 1, the cellobiohydrolase I M6 variant had approximately a 65% increase in activity against microcrystalline cellulose compared to the wild-type cellobiohydrolase.

Table 1: sugars produced from microcrystalline cellulose by Trichoderma reesei wild-type cellobiohydrolase I and its cellobiohydrolase I M6 variant after 5 hours at pH 5 and 25 ℃.

	[ glucose ]](μM)	[ Cellobiose ]](μM)	[ cellotriose](μM)
				Control	15.9	1.6	2.5
Wild type	22.9±0.3	121.4±4.3	5.4±4x 10^-3
				M6 variants	29.1±10^-3	201.7±0.5	8.1±0.04

Example 9: hydrolysis assay of pretreated corn stalks

Corn stover was pretreated with 1.4 wt% sulfuric acid at 165 ℃ and 107psi for 8 minutes in the National Renewable Energy Laboratory (NREL) of the U.S. department of energy. The water insoluble solids in the Pretreated Corn Stover (PCS) contained 56.5% cellulose, 4.6% hemicellulose, and 28.4% lignin. Cellulose and hemicellulose were determined by two-stage sulfuric acid hydrolysis, and subsequent analysis by high performance liquid chromatography using NREL standard analytical procedure # 002. After hydrolysis of the cellulose and hemicellulose fractions with sulfuric acid, lignin was determined gravimetrically using NREL standard analytical procedure # 003.

The unmilled, unwashed PCS (full slurry PCS) was prepared by adjusting the pH of the PCS to 5.0 by addition of 10M NaOH with vigorous mixing, and then autoclaved at 120 ℃ for 20 minutes. The dry weight of the full slurry PCS was 29%. Milled unwashed PCS (32.35% dry weight) was prepared by milling whole slurry PCS in a Cosmos ICMG 40 multi-effect wet mill (essmemm, tamierlandau, india).

Hydrolysis of PCS was performed in a total reaction volume of 1.0ml using 2.2ml deep well plates (Axygen, Union City, ca, usa). Hydrolysis was performed with 50mg insoluble PCS solids/ml 50mM sodium acetate (pH 5.0) buffer containing 1mM manganese sulfate and different protein loadings expressed as mg protein per gram cellulose for different enzyme compositions. An enzyme composition was prepared and then added to all wells simultaneously in a volume ranging from 50 to 200 μ Ι, with a final volume in each reaction of 1 ml. Then using ALPS-300^TMPlate type heat sealing machine (ALPS-300)^TMplate heat sealer) (abbe gene, epsom, uk) the plates were sealed, mixed well and incubated for 72 hours at the specified temperature. All reported experiments were repeated in triplicate.

After hydrolysis, 0.45 μm was usedThe samples were filtered through 96-well filter plates (Millipore, Bedford, Mass., USA) and the filtrates were analyzed as described belowSugar content. When not immediately used, filtered aliquots were frozen at-20 ℃. Dilution at 0.005M H was measured in the following manner₂SO₄Sugar concentration of the sample (1): using 4.6X 250mmHPX-87H column (Berle laboratory Co., Ltd., Heracles, Calif., USA) by using 0.05% w/w benzoic acid-0.005M H₂SO₄Elution at 65 ℃ and flow rate of 0.6 ml/min, and detection of refractive index by integration calibrated from pure sugar samples: (1100HPLC, Agilent Technologies, Santa Clara, Calif., USA, glucose, cellobiose, and xylose signals were quantified. The resulting glucose and cellobiose equivalent amounts were used to calculate the percent cellulose conversion for each reaction.

Glucose and cellobiose were measured separately. The measured sugar concentration is adjusted for the appropriate dilution factor. The net concentration of sugars enzymatically produced by unwashed PCS was determined by adjusting the measured sugar concentration against the corresponding background sugar concentration in unwashed PCS at time zero. Using MICROSOFT EXCEL^TMSoftware (microsoft, richland, washington, usa) was used to perform all HPLC data processing.

The degree of conversion of cellulose to glucose was calculated using the following equation: % cellulose conversion ═ glucose concentration + (1.053X cellobiose concentration) ]/[ limiting (glucose concentration + (1.053X cellobiose concentration) ] X100 in the digest to calculate% cellulose conversion, 100% conversion points were set based on cellulase control (100mg of trichoderma reesei cellulase per gram of cellulose).

Example 10: preparation of enzyme compositions not having cellobiohydrolase I

Recombinant preparation of Aspergillus fumigatus GH6A cellobiohydrolase II (SEQ ID NO:32[ DNA sequence ] in Aspergillus oryzae as described in WO 2011/057140]And SEQ ID NO 33[ deduced amino acid sequence]). 400ml of SEPHADEX was used for the filtered culture solution of Aspergillus fumigatus cellobiohydrolase II^TMThe G-25 column buffer was exchanged into 50mM sodium acetate (pH 5.0). The fractions were combined.

Trichoderma reesei GH5 endoglucanase II (SEQ ID NO:34[ DNA sequence ] and SEQ ID NO:35[ deduced amino acid sequence ]) was recombinantly prepared according to WO 2011/057140 using Aspergillus oryzae as a host. The filtered broth of Trichoderma reesei endoglucanase II was desalted and buffer exchanged into 20mM Tris (pH8.0) using tangential flow (10K membrane, Pall Corporation).

Using Trichoderma reesei as a host, the Penicillium (Emersoniu) GH61A polypeptide (SEQ ID NO:36[ DNA sequence ] was recombinantly produced according to WO 2011/041397]And SEQ ID NO 37[ deduced amino acid sequence]). To purify the emerson penicillium GH61A polypeptide, the fermentation medium was desalted into 20mM Tris-HCl (pH 8.5) using a tangential flow concentrator (Pall Filtron, norsburh, ma, usa) equipped with a 5kDa polyethersulfone membrane (Pall filter, norsburh, ma, usa). The buffer-exchanged samples were loaded in Q pre-equilibrated with 20mM Tris-HCl, (pH8.0)Fast Flow column (general electric medical group, Pescattyvale, N.J., USA) eluted with 20mM Tris-HCl (pH8.0) and 1M NaCl. The selected fractions were combined, added 0.85M ammonium sulfate, and loaded on phenyl pre-equilibrated with 20mM Tris-HCl (pH 7.5) and 0.85M ammonium sulfateFast Flow column, eluted with 20mM Tris-HCl (pH 7.5). The fractions were combined and desalted into 50mM sodium acetate (pH 5.0) using a tangential flow concentrator (Poll Filter, Norsbury, Mass., USA) equipped with a 5kDa polyethersulfone membrane.

Aspergillus fumigatus GH10 xylanase (xyn3) (SEQ ID NO:38[ DNA sequence) was recombinantly produced according to WO 2006/078256 using Aspergillus oryzae BECh2(WO 2000/39322) as host]And SEQ ID NO 39[ deduced amino acid sequence]). Use of26/10 desalting column (general electric medical group, Pesteviol, N.J., USA) A filtered culture of Aspergillus fumigatus xylanase was desalted and buffer-exchanged into 50mM sodium acetate pH 5.0.

Aspergillus fumigatus Cel3A beta-glucosidase 4M mutants (SEQ ID NO:40[ DNA sequence ] and SEQ ID NO:41[ deduced amino acid sequence ]) were recombinantly prepared according to WO 2012/044915. The filtered broth of aspergillus fumigatus Cel3A beta-glucosidase 4M was concentrated and buffer exchanged with 50mM sodium acetate (pH 5.0) containing 100mM sodium chloride using a tangential flow concentrator (pall filter, norsburler, ma, usa) equipped with a10 kDa polyethersulfone membrane (pall filter, norsburh).

Aspergillus oryzae JaL355 was used as host (WO 2003/070956) and Talaromyces emersonii CBS 393.64 β -xylosidase (SEQ ID NO:42[ DNA sequence ] and SEQ ID NO:43[ deduced amino acid sequence ]) was recombinantly prepared according to Lamusssen (Rasmussen) et al, 2006, Biotechnology and Bioengineering 94: 869-. The filtered broth was concentrated and desalted into 50mM sodium acetate (pH 5.0) using a tangential flow concentrator equipped with a10 kDa polyethersulfone membrane.

Use of microplate BCA^TMProtein assay kit (Microplate BCA)^TMProtein Assay Kit) (seimer femaly science, waltham, ma, usa) determined the Protein concentration of each of the above single components, and bovine serum albumin was used as a Protein standard in the Kit. An enzyme composition was prepared which consisted of the following individual components: 39.7% Aspergillus fumigatus Cel6A cellobiohydrolase II, 15.9% Trichoderma reesei GH5 endoglucanase II, 23.8% Penicillium (Penicillium emersonii) GH61A polypeptide, 7.9% Aspergillus fumigatus GH10 xylanase, 7.9% Aspergillus fumigatus beta-glucosidase and 4.8% Aspergillus sojae beta-xylosidase. The enzyme composition is herein designated as "cellulolytic enzyme composition without cellobiohydrolase I".

Example 11: comparison of the Effect of Trichoderma reesei cellobiohydrolase I M6 variants and Trichoderma reesei wild-type cellobiohydrolase I in the hydrolysis of milled unwashed PCS by cellulase compositions

To a cellulolytic enzyme composition without cellobiohydrolase I (example 10) was added a trichoderma reesei cellobiohydrolase I M6 variant and trichoderma reesei wild-type cellobiohydrolase I at 40 ℃ using milled unwashed PCS as substrate. Each cellobiohydrolase I was added separately at 0.8633, 1.295 and 1.9425mg of enzyme protein per gram of cellulose to 2.205mg of enzyme protein per gram of cellulose of a cellulase composition without cellobiohydrolase I.

The assay was performed as described in example 9. 1ml of the reaction with milled unwashed PCS (5% insoluble solids) was carried out in 50mM sodium acetate (pH 5.0) buffer containing 1mM manganese sulfate for 24, 48 and 72 hours. All reactions were performed in triplicate and involved a single mix at the start of hydrolysis.

The results shown in figures 2,3 and 4 demonstrate that at 24, 48 and 72 hours, the cellulase compositions comprising the trichoderma reesei cellobiohydrolase I M6 variant have significantly higher cellulose conversion than the cellulase compositions comprising trichoderma reesei wild-type cellobiohydrolase I.

Example 12: td determination by differential scanning calorimetry of Trichoderma reesei cellobiohydrolase I M6 variants and Trichoderma reesei wild-type cellobiohydrolase I

The thermostability of the trichoderma reesei wild-type cellobiohydrolase I and cellobiohydrolase I M6 variants was determined by Differential Scanning Calorimetry (DSC) using a VP-capillary differential scanning calorimeter (MicroCal Inc., picosavid, nj, usa). In the thermogram (Cp vs T) obtained after heating an enzyme solution (about 1mg/ml) in 50mM sodium acetate (pH 5.0) at a constant programmed heating rate of 200K/hr, the thermal denaturation temperature Td (. degree. C.) was taken as the top of the denaturation peak (major endothermic peak).

The sample and reference solutions (approximately 0.2ml) were loaded into the calorimeter from storage conditions at 10 ℃ (reference: buffer without enzyme) and heat pre-equilibrated at 20 ℃ for 20 minutes, followed by DSC scans from 20 ℃ to 100 ℃. The denaturation temperature was determined with an accuracy of about +/-1 ℃.

The results demonstrate that Td for Trichoderma reesei wild-type cellobiohydrolase I is 69 ℃ compared to 68 ℃ for its cellobiohydrolase I M6 variant.

Example 13: site-directed mutagenesis of wild-type Trichoderma reesei cellobiohydrolase I

A codon-optimized synthetic gene encoding wild-type Trichoderma reesei cellobiohydrolase I (example 1) was used to generate a Trichoderma reesei cellobiohydrolase I TC1-111 variant (SEQ ID NO:44 for mutant DNA sequences; and SEQ ID NO:45 for variants), replacing the AAC codon (N198) with a GCA codon (198A).

To generate the Trichoderma reesei cellobiohydrolase I TC1-116 variant (SEQ ID NO:46 for mutant DNA sequence; and SEQ ID NO:47 for variant), the GCC codon (A199) was deleted (A199).

To generate the Trichoderma reesei cellobiohydrolase I TC1-61 variant (SEQ ID NO:48 for mutant DNA sequence; and SEQ ID NO:49 for variant), the AAC codon (N200) was replaced with TGG codon (200W).

To generate the Trichoderma reesei cellobiohydrolase I TC1-103 variant (SEQ ID NO:50 for mutant DNA sequences; and SEQ ID NO:51 for variants), the AAC codon (N200) was replaced with the GGA codon (200G).

Using the SOE primer design tool, two synthetic primers were designed for each site-directed mutagenesis as shown below. The introduced site-directed mutations changed AAC codons (N198) to GCA codons (198A), AAC codons (N200) to TGG codons (200W), and AAC codons (N200) to GGA codons (200G), and GCC codons (a199) were deleted.

Primer F-N198A:

5’-GCTGGGAACCCTCGTCGAACGCAGCCAACACCGGCATTGGA-3’(SEQ ID NO:52)

primer R-N198A:

5’-GTTCGACGAGGGTTCCCAGCCTTCGACGTTTG-3’(SEQ ID NO:53)

primer F- Δ A199:

5’-TGGGAACCCTCGTCGAACAACAACACCGGCATTGGAGGCCAT-3’(SEQ ID NO:54)

primer R- Δ a 199:

5’-GTTGTTCGACGAGGGTTCCCAGCCTTCGACG-3’(SEQ ID NO:55)

primer F-N200W:

5’-GAACCCTCGTCGAACAACGCCTGGACCGGCATTGGAGGCCATGG-3’(SEQ ID NO:56)

primer R-N200W:

5’-GGCGTTGTTCGACGAGGGTTCCCAGCCTTCG-3’(SEQ ID NO:57)

primer F-N200G:

5’-GAACCCTCGTCGAACAACGCCGGAACCGGCATTGGAGGCCAT-3’(SEQ ID NO:58)

primer R-N200G:

5’-GGCGTTGTTCGACGAGGGTTCCCAGCCTTCG-3’(SEQ ID NO:59)

site-directed mutagenesis of a synthetic gene encoding a wild-type trichoderma reesei cellobiohydrolase is facilitated by PCR amplification of the pDau109 vector comprising the trichoderma reesei cellobiohydrolase I gene: the Trichoderma reesei cellobiohydrolase I gene was previously cloned into Bam HI-Hind III digested pDau109 resulting in transcription of the Trichoderma reesei cellobiohydrolase I gene under the control of the NA2-tpi dual promoter.

Use ofThe high fidelity PCR kit introduces mutations by PCR. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 2.5. mu.l of primer F-N198A (10. mu.M), 2.5. mu.l of primer R-N198A (10. mu.M), 10. mu.l of template DNA (pDAU 222-Trichoderma reesei cellobiohydrolase I, 1 ng/. mu.l) and 23.5. mu.l of deionized water in a total volume of 50. mu.l. For the GCC deletion (A199 × variant), 2.5. mu.l of primer F-. DELTA.A 199 (10. mu.M), 2.5. mu.l of primer R-. DELTA.A 199 (10. mu.M) were used. For ACC to TGG mutation (N200W variant), 2.5. mu.l primer-F-N200W (10. mu.l) was usedM) and 2.5. mu.l of primer R-N200W (10. mu.M). For ACC to GGA mutation (N200G variant), 2.5. mu.l of primer-F-N200G (10. mu.M) and 2.5. mu.l of primer R-N200G (10. mu.M) were used.

Use ofPCR System 9700 (applied biosystems, Foster City, Calif., USA) was programmed for 1 cycle at 98 ℃ for 30 seconds; and 19 cycles, each cycle lasting 30 seconds at 98 ℃,1 minute at 55 ℃, and 4 minutes at 72 ℃. The PCR solution was then maintained at 15 ℃ until removed from the PCR machine.

After PCR, 10 units of Dpn I were added directly to the PCR solution and incubated at 37 ℃ for 1 hour. Then, 1. mu.l of Dpn I treated PCR solution was transformed into ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.15mg ampicillin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB ampicillin plates. Both transformants were cultured in LB medium supplemented with 0.15mg ampicillin/ml and usedThe Spin Miniprep kit isolates the plasmid.

Isolated plasmids were sequenced using an applied biosystems 3730xl DNA analyzer with the vector primers shown below and trichoderma reesei cellobiohydrolase I gene specific primers to determine representative plasmids that contained no PCR errors and contained the desired mutations.

Primer F-pDau109

5’-CCCTTGTCGATGCGATGTATC-3’(SEQ ID NO:30)

Primer F-Central1

5’-CATGTATCGTAAGCTCGCAGTCATCTCC-3’(SEQ ID NO:60)

Primer F-Central2

5’-CTTCGTGTCGATGGACGCGG-3’(SEQ ID NO:61)

Primer R-Central3

5’-GAACACGAGCCCCTCACTGC-3’(SEQ ID NO:62)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

One plasmid clone that contained no PCR errors and contained AAC (N198) to GCA (198A) mutations was selected and designated as plasmid pN 198A.

One plasmid clone containing no PCR errors and containing deletion mutations of GCC codons (a199) to (a199 x) was selected and designated as plasmid p Δ a 199.

One plasmid clone that contained no PCR errors and contained AAC (N200) to TGG (200W) mutations was selected and designated as plasmid pN 200W.

One plasmid clone that contained no PCR errors and contained AAC (N200) to GGA (200G) mutations was selected and designated as plasmid pN 200G.

pN198A was sequenced using primers F-Central1, F-Central2, R-Central3 and R-pDau 109. P.DELTA.A 199 was sequenced using primers F-pDau109, F-Central1, F-Central2, R-Central3 and R-pDau 109. pN200W was sequenced using primers F-Central1, F-Central2 and R-pDau 109. pN200G was sequenced using primers F-Central1, F-Central2 and R-pDau 109.

Example 14: expression of Trichoderma reesei cellobiohydrolase I TC1-111, TC1-116, TC1-61, and TC1-103 variants

Plasmids pN198A, p Δ a199, pN200W and pN200G were expressed in aspergillus oryzae MT3568 according to the protocol described in example 6.

Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. Based on the expression levels given by SDS-PAGE, one transformant was selected for each of plasmids pN198A, p Δ a199, pN200W, and pN200G and designated aspergillus oryzae Δ a199, N200G, N197A, and N200W, respectively.

For larger scale production, spores of each A.oryzae strain were spread on COVE sucrose slants and incubated at 37 ℃ for five days. 5ml of 0 are used.01％20 each fused spore bevel was washed twice to maximize the number of spores collected. Then, seven 500ml flasks containing 150ml of DAP-4C medium were inoculated with each spore suspension. The culture was incubated at 30 ℃ while constantly shaking at 100 rpm. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75Supor MachV 0.2 μm PES filter. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. The culture broth from each aspergillus oryzae strain produced approximately 80kDa bands of the trichoderma reesei a199 × N200G, N197A and N200W cellobiohydrolase variants.

Example 16: purification of Trichoderma reesei cellobiohydrolase I TC1-111, TC1-116, TC1-61 and TC1-103 variants

The fermentation broth was filtered through a PES bottle top filter (seimer feishell science, ross, denmark) with a 0.22 μm cut-off. Ammonium sulfate was added to the filtered fermentation broth to make a 1.8M solution.

The fermentation broth was purified by HIC/affinity chromatography followed by IEX/affinity chromatography.

In the HIC/affinity chromatography step, the fermentation broth was applied to 200ml of phenyl equilibrated with 1.8M ammonium sulfate, 25mM HEPES (pH7.0)6Fast Flow column (high resolution). After sample application, the column was washed with 2 column volumes of 1.8M ammonium sulfate followed by 1 column volume of 0.54M ammonium sulfate. The bound protein was eluted in portions with 25mM HEPES (pH 7.0).

The elution of the protein was monitored at 280 nm. Using 12 holes4% -12% Bis-Tris gels fractions with high absorbance at 280nm were analyzed by SDS-PAGE for cellobiohydrolase content. Fractions with high content of the protein were pooled and collectedFor further purification. The combined fractions were subjected to SEPHADEX equilibrated with 25mM MES (pH 6.0)^TMDesalting on G-25 (middle) column. The elution of the protein was monitored at 280nm and the fraction with high absorbance at 280nm was selected for the second chromatography step.

The combined fractions were applied to 60ml RESOURCE equilibrated with 25mM MES (pH 6.0)^TM15Q column and elution of bound protein with a linear 50-300mM sodium chloride gradient for 3 column volumes. The elution of the protein was monitored at 280nm and fractions with high absorbance at 280nm were analyzed on SDS-PAGE.

The fractions with a high content of cellobiohydrolase I are combined.

Example 17: measurement of the Activity of Trichoderma reesei cellobiohydrolase I TC1-111, TC1-116, TC1-61, and TC1-103 variants on microcrystalline cellulose

Using washed microcrystalline cellulose: (PH 101; sigma-aldrich, st louis, missouri, usa) as substrate, the activity of the purified trichoderma reesei cellobiohydrolase I TC1-111, TC1-116, TC1-61 and TC1-103 variants was compared to the purified trichoderma reesei wild-type cellobiohydrolase I.

Washed microcrystalline cellulose was prepared by applying 180g of microcrystalline cellulose and approximately 400ml of 0.22 μm filtered water to a centrifuge bottle (1L) and mixing (by hand). The centrifuge bottles were centrifuged at 4000rpm for 5 minutes at 18 ℃ (SorvallHereaus Thermoscientific Sorvall Evolution RC ultracentrifuge). The supernatant was removed and 400ml of MQ water was added again. This was repeated 4 times. At the 4 th iteration, the pellet was mixed with 0.22 μm filtered water on a "packer" o/n (IKA KS 130basic) prior to centrifugation. The supernatant was removed and the pellet was treated with 50mM sodium acetate, 2mM CaCl₂The pH 5 buffer was resuspended to a final concentration of 90 g/L.

Purified cellobiohydrolase variants were tested in 50mM sodium acetate, 2mM CaCl₂(pH 5) to a concentration of 9. mu.M. Then, 100. mu.l of the diluted cellobiohydrolase I variant was addedTo each well of the microtiter plate, 200. mu.l of the washed microcrystalline cellulose was subsequently added to each well at 90 g/liter. The microtiter plates were quickly transferred to a homomixer and incubated at 1100rpm and 25 ℃ for 1 hour. By usingThe reaction was stopped by centrifugation at 3500rpm for 3 minutes at 5 ℃ in a 3s-r centrifuge (Saimer Feishell science Co., Rossley, Denmark). Fifty. mu.l of the supernatant was transferred to a PCR sample tube (0.2ml skirt-free 96-well PCR plate; Seimer Feishell science, Rosschel, Denmark). PAHBAH (4-hydroxy-benzoylhydrazine) was dissolved in a buffer (0.18M potassium sodium tartrate and 0.5M NaOH) to prepare a 15mg/ml solution. Seventy-five μ Ι of PAHBAH solution was added to the supernatant in the PCR sample tube.

The PCR sample tubes were placed in a Peltier (Peltier) thermal cycler and incubated at 95 ℃ for 10 minutes and at 20 ℃ for 5 minutes. After incubation, 100 μ l was transferred to a 96-well microtiter plate and absorbance was measured at 410 nm. One standard was included for each run. The standard used was 50mM sodium acetate, 2mM CaCl₂(pH 5) to cellobiose concentrations of 0.008, 0.016, 0.0312, 0.0625, 0.125, 0.25, 0.5 and 1 mM. In addition to the standards, each run included a blank (without cellobiohydrolase). For all measurements, blank measurements were subtracted. The absorbance data were normalized to cellobiose concentration using these standards.

As demonstrated by the results shown in figure 5, the cellobiohydrolase a199 × variant had an approximately 56% increase in activity against microcrystalline cellulose compared to wild-type cellobiohydrolase I. The activity of the N200G variant was increased by 40%, N198A by 23% and N200W by 3% compared to wild-type cellobiohydrolase I.

Example 18: hydrolysis assay of pretreated corn stalks

Corn stover was pretreated in the National Renewable Energy Laboratory (NREL) of the U.S. department of energy, as described in example 9.

A 96-well plate was created by machining the upper surface of a teflon plate with 96 tapered holes at a depth of 1/4 inches to a diameter of 1/4 inches and the lower surface to a diameter of 1/8 inches. The center of each well is at the equivalent of the center of the corresponding well of a standard 96 well microtiter plate, approximately 23/64 inches on the center. The resulting volume of each well was approximately 135 μ l. Hereinafter, this 96-hole aluminum plate is referred to as a "fill plate". A pH adjusted milled unwashed PCS was used to fill the holes in the filled plates by applying an appropriate volume of PCS to the upper surface of the plate and then spreading the material on the surface and into the holes using a spatula. When the PCS was pressed through the hole in the bottom surface, the hole was considered to be full enough to form a noodle-like tube. Using means held perpendicular to the surface of the filling plateRow loading scraper (Column Loader (millibo, belerica, ma, usa) scraped excess PCS from the top and bottom surfaces of the fill plate so that the surface of the PCS in each well was flush with the surface of the fill plate. The fill plate was then placed on top of a 2.2ml deep well plate (ajin, union, ca, usa) with the top surface adjacent the open end of the well plate (e.g., the top of the well plate) and the wells aligned with the PCS fill holes in the fill plate. The filling plate was fixed in this position and the assembly was centrifuged for 5 minutes at 2500rpm (1350x g) in Sorvall Legend RT + (Sermer technology, Waltham, Mass.). After centrifugation, the PCS had been transferred to the deep well plate. 3mm glass beads (Fisher Scientific, Waltherm, Mass., USA) were placed in each well for mixing.

In a total reaction volume of 0.2mlHydrolysis of PCS was performed. Hydrolysis was performed with 50mg insoluble PCS solids, containing 50mM sodium acetate (pH 5.0) buffer containing 1mM manganese sulfate and different protein loadings expressed as mg protein per gram cellulose for different enzyme compositions. An enzyme composition was prepared and then added to all wells simultaneously in a volume ranging from 20 to 50 μ Ι, with a final volume in each reaction of 0.2-0.50 ml. Then using ALPS-300^TMThe plates were sealed with a plate heat sealer, mixed well, and incubated at the specified temperature for 72 hours. All reported experiments were repeated in triplicate.

After hydrolysis, 0.45 μm was usedThe samples were filtered through 96-well filter plates and the filtrates were analyzed for sugar content as described in example 9.

Glucose was measured. The measured glucose concentration is adjusted for the appropriate dilution factor. The net concentration of glucose enzymatically produced from the unwashed PCS was determined by adjusting the measured glucose concentration against the corresponding background glucose concentration in the unmilled unwashed PCS at time zero. Using MICROSOFT EXCEL^TMSoftware to perform all HPLC data processing.

The degree of conversion of glucose to glucose was calculated using the following equation: % glucose conversion is (glucose concentration)/(glucose concentration in the limiting digest) X100. To calculate% glucose conversion, a 100% conversion point was set based on the cellulase control (100mg of trichoderma reesei cellulase per gram of cellulose). The triplicate data points were averaged and the standard deviation calculated.

Example 19: preparation of enzyme composition #2 without cellobiohydrolase I

The Aspergillus fumigatus GH6A cellobiohydrolase II variant (GENESEFP: AZN71803) was recombinantly produced in Aspergillus oryzae as described in WO 2011/123450. The filtered broth of aspergillus oryzae cellobiohydrolase II was desalted and exchanged into 50mM sodium acetate (pH 5.0) containing 100mM sodium chloride using a tangential flow (10K membrane, pall).

Aspergillus oryzae as hostThermoascus aurantiacus GH5 endoglucanase II (GENESEBP: AZI04862) was recombinantly prepared according to WO 2011/057140. The filtered broth of Thermoascus aurantiacus endoglucanase II was concentrated using tangential flow (5K membrane, Boral). 400ml of SEPHADEX was used^TMThe G-25 column desalted the concentrated protein into 20mM Tris (pH 8.0).

A penicillium (penicillium emersonii) GH61A polypeptide was prepared as disclosed in example 10.

An aspergillus fumigatus GH10 xylanase (xyn3) was prepared as disclosed in example 10.

An aspergillus fumigatus Cel3A beta-glucosidase 4M mutant was prepared as described in example 10. Use of microplate BCA^TMProtein assay kits (seemer femier science, waltham, massachusetts, usa) in which bovine serum albumin was used as a protein standard, determined protein concentrations.

Talaromyces emersonii CBS 393.64 beta-xylosidase was prepared as described in example 10.

Use of microplate BCA^TMProtein assay kit the protein concentration of each of the above single components was determined using bovine serum albumin as the protein standard, except for the Penicillium (Penicillium emersonii) GH61A polypeptide, using a theoretical molar extinction coefficient of 41730M^-1·cm^-1The following measurement was carried out. An enzyme composition was prepared which consisted of the following individual components: 39.7% Aspergillus fumigatus Cel6A variant cellobiohydrolase II, 15.9% Trichoderma reesei GH5 endoglucanase II, 23.8% Penicillium (Penicillium emersonii) GH61A polypeptide, 7.9% Aspergillus fumigatus GH10 xylanase, 7.9% Aspergillus fumigatus beta-glucosidase, and 4.8% Aspergillus sojae beta-xylosidase. This enzyme composition is designated herein as "cellulolytic enzyme composition #2 without cellobiohydrolase I".

Example 20: source of DNA sequence information for Rasamsonia emersonii cellobiohydrolase I

The genomic DNA sequence and deduced amino acid sequence of the wild type Rasamsonia emersonii GH7 cellobiohydrolase I gene are shown in SEQ ID NO 11 and SEQ ID NO 12, respectively. The gene sequence has 99% identity with Genbank entry AF 439935.4. The cDNA sequence and deduced amino acid sequence of the Rasamsonia emersonii cellobiohydrolase I gene are shown in SEQ ID NO 63 and SEQ ID NO 12, respectively.

Codon-optimized synthetic genes encoding full-length cellobiohydrolase I were generated for Aspergillus oryzae expression based on the cDNA sequence of Rasamsonia emersonii cellobiohydrolase I, based on the algorithm developed by Gustafsson et al, 2004, Trends Biotechnology 22(7):346- > 353. By passingThe gene synthesis service (Life technologies, Inc., san Diego, Calif., USA) synthesized a codon-optimized coding sequence (SEQ ID NO:64) with a 5 'Bam HI restriction site, a 3' Hind III restriction site, and a Kozac consensus sequence (CACC) located between the start codon and the Bam HI restriction site.

Example 21: site-directed mutagenesis of wild-type Rasamsonia emersonii cellobiohydrolase I

Codon optimized synthetic genes encoding wild type Rasamsonia emersonii cellobiohydrolase I were provided in non-designated kanamycin resistant e.

To generate the r.emersonii cellobiohydrolase I PC1-146 variant (SEQ ID NO:65 for mutant DNA sequences; and SEQ ID NO:66 for variants), the AAC codon (N194) was replaced with a GCA codon (194A) and the AAC codon (N197) was replaced with a GCA codon (197A).

Using the SOE primer design tool, two synthetic primers were designed for site-directed mutagenesis as shown below. The introduced site-directed mutations changed AAC codon (N194) to GCA codon (194A) and AAC codon (N197) to GCA codon (197A).

Primer F-N194A N197A:

5’-AAGGATGGCAGCCCTCGTCCGCAAACGCGGCAACTGGCATCGGTGATCAC-3’(SEQ ID NO:67)

primer R-N194A N197A:

5’-GGACGAGGGCTGCCATCCTTCCACGTTCGC-3’(SEQ ID NO:68)

site-directed mutagenesis of the synthetic gene encoding the wild-type r.emersonii cellobiohydrolase I was facilitated by PCR amplification of the pDau109 vector containing the r.emersonii cellobiohydrolase I gene designated as pDau222-r.emersonii cellobiohydrolase I. The r.emersonii cellobiohydrolase I gene was previously cloned into Bam HI-Hind III digested pDau109, resulting in transcription of the r.emersonii cellobiohydrolase I gene under the control of the NA2-tpi dual promoter.

Use ofThe high fidelity PCR kit introduces mutations by PCR. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 0.25. mu.l of primer F-N194A N197A (100. mu.M), 0.25. mu.l of primer R-N194A N197A (100. mu.M), 10. mu.l of template DNA (pDau222-R.emersonii cellobiohydrolase I, 1 ng/. mu.l) and 28. mu.l of deionized water in a total volume of 50. mu.l. Use ofPCR System 9700 (applied biosystems, Foster City, Calif., USA) was programmed for 1 cycle at 98 ℃ for 30 seconds; and 19 cycles, each cycle lasting 30 seconds at 98 ℃,1 minute at 55 ℃, and 4 minutes at 72 ℃. The PCR solution was then maintained at 8 ℃ until removed from the PCR machine.

After PCR, 10 units of Dpn I were added directly to the PCR solution and incubated at 37 ℃ for 1 hour. Then, 1. mu.l of Dpn I treated PCR solution was transformed into ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.15mg ampicillin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB ampicillin plates. Four were transformedThe bodies were cultured in LB medium supplemented with 0.15mg ampicillin/ml and usedThe Spin Miniprep kit isolates the plasmid.

Isolated plasmids were sequenced using an applied biosystems 3730xl DNA analyzer with the vector primers and r.emersonii cellobiohydrolase I gene specific primers shown below in order to determine representative plasmids that contained no PCR errors and contained the desired mutation.

Primer F-pDau109

5’-CCACACTTCTCTTCCTTCCTCAATCCTC-3’(SEQ ID NO:69)

Primer F-Central1

5’-GTGAGGCGAACGTGGAAGGATG-3’(SEQ ID NO:70)

Primer R-Central2

5’-gtacctgtgtccgtgccgtcatctg-3’(SEQ ID NO:71)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

One plasmid clone that contained no PCR errors and contained the AAC (N194) to GCA (194A) mutation and the AAC (N197) to GCA (197A) mutation was selected and designated as plasmid pE 146. This variant is designated herein as PC 1-146.

Example 22: construction of an Aspergillus oryzae expression vector comprising a Rasamsonia emersoniic DNA sequence encoding cellobiohydrolase I

Digestion with Fast Digest Bam HI and Hind III (Feimerster, Greenbony, Maryland, USA) according to the manufacturer's instructionsKanamycin-resistant escherichia coli cloning vectors encoding Rasamsonia emersonii cellobiohydrolase I provided by gene synthesis. Reaction products were separated by 1.0% agarose gel electrophoresis using TAE buffer, where 1375bp product band was cut from the gel and ILLUSTRA was used^TM GFX^TMAnd purifying by using a DNA purification kit.

The 1375bp fragment was then cloned into pDau109 digested with Bam HI and Hind III using T4DNA ligase. BamHI-HindIII digested pDau109 and BamHI/HindIII fragments containing Trichoderma reesei cellobiohydrolase I coding sequences were mixed in a molar ratio of 1:3 (i.e.mass ratio of about 2.5:1 or 20ng:50ng) and ligated with 50 units of T4DNA ligase overnight at 16 ℃ in 1X T4DNA ligase buffer with 1mM ATP according to the manufacturer's instructions. Cloning of the Rasamsonia emersonii cellobiohydrolase I gene into Bam HI-Hind III digested pDau109 resulted in transcription of the Rasamsonia emersonii cellobiohydrolase I gene under the control of the NA2-tpi dual promoter.

The ligation mixture was transformed into the ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.1mg ampicillin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB ampicillin plates. The insertion of the Rasamsonia emersonii cellobiohydrolase I gene into pDau109 was verified by PCR on transformants using primers F-pDau109 and R-pDau109, as described below.

1.1XThe premix (Thermo Fisher Scientific, rosskole, denmark) was used for PCR. PCR solution was prepared from 10. mu.l of 1.1XThe premix, 0.5. mu.l of primer F-pDau109 (10. mu.M), and 0.5. mu.l of primer R-pDau109 (10. mu.M). A small amount of cells was transferred to the PCR solution using a toothpick. PCR was performed using a PTC-200DNA engine, programmed for 1 cycle, at 94 ℃ for 3 minutes; 30 cycles, each cycle lasting 30 seconds at 94 ℃,1 minute at 50 ℃, and 2 minutes at 72 ℃; and 1 cycle at 72 ℃ for 1 minute. The PCR solution was then incubatedHeld at 15 ℃ until removed from the PCR machine.

The PCR products were analyzed by 1.0% agarose gel electrophoresis using TAE buffer, where one 1600bp PCR product band was observed, confirming the insertion of the Rasamsonia emersonii cellobiohydrolase I coding sequence into pDau 109.

Coli transformants containing the Rasamsonia emersonii cellobiohydrolase I plasmid construct were cultured in LB medium supplemented with 0.1mg ampicillin/ml and usedPlasmid DNA was isolated using Spin Miniprep kit. This plasmid was designated as pKHJN 0135.

Example 23: expression of wild-type Rasamsonia emersonii cellobiohydrolase I

The expression plasmid pKKJN 0135 was transformed into Aspergillus oryzae MT3568 protoplasts according to Klitenssen et al (Christensen), 1988, supra and WO 2004/032648. Aspergillus oryzae MT3568 protoplasts were prepared according to the method of EP0238023B1, pages 14-15.

Transformants were purified by a single conidium on COVE sucrose plates before sporulation on PDA plates. Spores of the transformants were inoculated into 96-deep-well plates containing 0.75ml of YP + 2% glucose medium and incubated at rest for 4 days at 30 ℃. Transformants were analyzed for production of Rasamsonia emersonii cellobiohydrolase I from culture supernatants of 96 deep-well cultures. Expression was verified by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. Based on the expression levels given by SDS-PAGE, one transformant was selected for further work and designated aspergillus oryzae rebbh I.

For larger scale production, Aspergillus oryzae RecBH I spores were dispersed onto COVE sucrose slants and incubated at 37 ℃ for five days. Using 5ml of 0.01%The fused spore slants were washed twice 20 to maximize the number of spores collected. Then, spores were usedThe suspension was inoculated into seven 500ml flasks containing 150ml of DAP-4C medium. The culture was incubated at 30 ℃ while constantly shaking at 100 rpm. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75 super MachV 0.2 μm PES filter. Expression was confirmed by SDS-PAGE analysis using E-Page 8% SDS-PAGE48 well gels and Coomassie blue staining. The broth from aspergillus oryzae rebbh I produced a band of approximately 60kDa of Rasamsonia emersonii cellobiohydrolase I.

For larger scale production, Aspergillus oryzae RecBH I spores were dispersed onto COVE sucrose slants and incubated at 37 ℃ for five days. The fused spore slants were washed twice with 5ml G2-Gly medium. Then, a 500ml flask containing 150ml of G2-Gly medium was inoculated with the spore suspension. The preculture was incubated at 30 ℃ with constant shaking at 150 rpm. One day later, four 500ml flasks containing 150ml of DAP4C-1 medium were inoculated with each preculture. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75Supor MachV 0.2 μm PES filter.

Example 24: expression of Rasamsonia emersonii cellobiohydrolase I PC1-146 variants

The expression plasmid pE146 was transformed into Aspergillus oryzae MT3568 protoplasts according to Klitenssen et al (Christensen), 1988, supra and WO 2004/032648. Aspergillus oryzae MT3568 protoplasts were prepared according to the method of EP0238023B1, pages 14-15.

Transformants were purified by a single conidium on COVE sucrose plates without CsCl. Spores of the transformants were inoculated into 96-deep-well plates containing 0.50ml of YP + 2% maltose medium and incubated at rest for 6 days at 34 ℃. Transformants were analyzed for production of the r.emersonii cellobiohydrolase I PC1-146 variant from culture supernatants of 96 deep-well cultures. Expression was verified by measuring the reducing sugars released by hydrolysis of microcrystalline cellulose. Hydrolysis was carried out in 96-well microtiter plates (NUNC seemer feishell scientific, ross, denmark) at 25 ℃ and 1100 rpm. Each hydrolysis reaction mixture contained 90g/l 167. mu.l microcrystalline cellulose in 50mM sodium acetate (pH 5.0), 0.01%X-100, 20. mu.l of culture supernatant and 63. mu.l of 50mM sodium acetate (pH 5.0), 0.01%X-100. The plates were sealed with tape. The hydrolysis reaction was terminated by rotating the plate at 3500rpm for 3 minutes. Then, 50. mu.l of reaction supernatant was added to 75. mu.l of the stop solution in a 96-well PCR plate (Seimer Feishell science, Rossler, Denmark). The stop solution consisted of 15mg/ml 4-hydroxybenzoyl hydrazine (Sigma chemical Co., St. Louis, Mo., USA) in 2% (w/v) NaOH, 50mg/ml potassium sodium tartrate (Sigma chemical Co., St. Louis, Mo., USA). The plate was sealed with a lid and the mixture was incubated at 95 ℃ for 10 minutes and at 20 ℃ for 5 minutes. Then, 100. mu.l were transferred to a microtiter plate and usedPlus 384 (Molecular Devices, senivir, ca., usa) measures absorbance at 410 nm. The concentration of reducing sugar is proportional to the absorbance of oxidized 4-hydroxybenzoyl hydrazine at 410 nm. The reducing sugar content in the culture supernatant was measured by adding 4. mu.l of the culture supernatant to a mixture of 75. mu.l of the stop solution and 46. mu.l of milliQ water in a 96-well PCR plate. The plate was sealed with a lid and the mixture was incubated at 95 ℃ for 10 minutes and at 20 ℃ for 5 minutes. Then, 100. mu.l were transferred to a microtiter plate and absorbance was measured at 410 nm. The absorbance at 410nm from the cell culture supernatant was subtracted from the absorbance of the hydrolysis reaction at 410nm to measure the amount of reducing sugars released by these enzymes.

One transformant was selected and designated Aspergillus oryzae PC1-146 based on the degree of hydrolysis of microcrystalline cellulose.

For larger scale production, Aspergillus oryzae PC1-146 spores were dispersed onto COVE sucrose slants and incubated at 37 ℃ for five days. The fused spore slants were washed twice with 5ml of G2-Gly medium. Then, a 500ml flask containing 150ml of G2-Gly medium was inoculated with the spore suspension. The preculture was incubated at 30 ℃ with constant shaking at 150 rpm. One day later, four 500ml flasks containing 150ml of DAP-4C medium were inoculated with each preculture. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75Supor MachV 0.2 μm PES filter.

Example 25: purification of Rasamsonia emersonii wild-type cellobiohydrolase I and r

The fermentation broth was filtered through a PES bottle top filter with a 0.22 μm cut-off. Ammonium sulfate was added to the filtered broth to a concentration of 1.8M. The fermentation broth was purified by HIC/affinity chromatography followed by IEX/affinity chromatography.

The elution of the protein was monitored at 280 nm. Using 12 holes4% -12% Bis-Tris gels fractions with high absorbance at 280nm were analyzed by SDS-PAGE for cellobiohydrolase content. Fractions with high content of protein were combined and collected for further purification. The combined fractions were subjected to SEPHADEX equilibrated with 25mM MES (pH 6.0)^TMDesalting on G-25 (middle) column. The elution of the protein was monitored at 280nm and the fraction with high absorbance at 280nm was selected for the second chromatography step.

The combined fractions were applied to 60ml RESOURCE equilibrated with 25mM MES (pH 6.0)^TM15Q column and a linear 100-Bound protein eluted with 1.5 column volumes of 300mM sodium chloride followed by 1.5 column volumes of 1M sodium chloride. The elution of the protein was monitored at 280nm and fractions with high absorbance at 280nm were analyzed on SDS-PAGE. The fractions with a high content of cellobiohydrolase I are combined.

Example 26: measurement of Rasamsonia emersonii cellobiohydrolase I PC1-146 activity on microcrystalline cellulose

Using washed microcrystalline cellulose: (PH 101; sigma-aldrich, st louis, missouri, usa) as substrate, the activity of the purified r.emersonii cellobiohydrolase I PC1-146 variant was compared to the purified trichoderma reesei wild-type cellobiohydrolase I.

Purified cellobiohydrolase variants were tested in 50mM sodium acetate, 2mM CaCl₂(pH 5) to a concentration of 0.4. mu.M. Then, 50 μ l of the diluted cellobiohydrolase I variant was added to each well of the microtiter plate, followed by addition of 200 μ l of the washed microcrystalline cellulose to each well at 90 g/liter. The microtiter plates were quickly transferred to a homomixer and incubated at 1100rpm and 50 ℃ for 1 hour. By usingThe reaction was terminated by centrifugation at 3500rpm for 3 minutes at 5 ℃ in a 3s-r centrifuge. Fifty. mu.l of the supernatant was transferred to a PCR sample tube (0.2ml skirtless 96-well PCR plate). PAHBAH (4-hydroxy-benzoylhydrazine) was dissolved in a buffer (0.18M potassium sodium tartrate and 0.5M NaOH) to prepare a 15mg/ml solution. Seventy-five μ Ι of PAHBAH solution was added to the supernatant in the PCR sample tube.

The PCR sample tubes were placed in a Peltier thermocycler and incubated at 95 ℃ for 10 minutes and at 20 ℃ for 5 minutes. After incubation, 100 μ l was transferred to a 96-well microtiter plate and absorbance was measured at 410 nm. One standard was included for each run. The standard used was 50mM sodium acetate, 2mM CaCl₂(pH 5) medium dilutionCellobiose was released to concentrations of 0.008, 0.016, 0.0312, 0.0625, 0.125, 0.25, 0.5 and 1 mM. In addition to the standards, each run included a blank (without cellobiohydrolase). For all measurements, blank measurements were subtracted. The absorbance data were normalized to cellobiose concentration using these standards.

As demonstrated by the results shown in fig. 6, the activity of the r.emersonii cellobiohydrolase I PC1-146 variant on microcrystalline cellulose was increased by about 17% compared to r.emersonii wild-type cellobiohydrolase I.

Example 27: td of the Rasamsonia emersonii cellobiohydrolase I PC1-146 variant was determined by differential scanning calorimetry.

The thermostability of the r.emersonii cellobiohydrolase ipc 1-146 variants was determined by Differential Scanning Calorimetry (DSC) using a VP-capillary differential scanning calorimeter as described in example 12.

The results demonstrate that Td of r.emersonii wild-type cellobiohydrolase I is 78 ℃ compared to 78 ℃ for its r.emersonii cellobiohydrolase I PC1-146 variant.

Example 28: comparison of the effect of Rasamsonia emersonii cellobiohydrolase I PC1-146 variants and Rasamsonia emersonii wild-type cellobiohydrolase I on the hydrolysis of unwashed PCS by cellulase enzyme compositions

R.emersonii cellobiohydrolase I PC1-146 variant and r.emersonii wild-type cellobiohydrolase I were added to cellulolytic enzyme composition #2 (example 19) without cellobiohydrolase I using unmilled unwashed PCS as substrate at 25 ℃. For hydrolysis at 8% total solids, each cellobiohydrolase I was added separately at 2.22mg enzyme protein/g cellulose to 3.78mg enzyme protein/g cellulose of cellulase composition #2 without cellobiohydrolase I. For hydrolysis at 20% total solids, each cellobiohydrolase I was added individually at 4.44mg enzyme protein/g cellulose to 7.56mg enzyme protein/g cellulose of cellulase composition #2 without cellobiohydrolase I.

The assay was performed as described in example 18. Reactions with unmilled unwashed PCS (8% and 20% total solids) were carried out in 50mM sodium acetate (pH 5.0) buffer containing 1mM manganese sulfate for 24, 48 and 72 hours. All reactions were performed in quadruplicate and shaken at 200rpm throughout the hydrolysis.

The results shown in fig. 7 (8% total solids) and fig. 8 (20% total solids) demonstrate that at 24, 48 and 72 hours, the cellulase compositions comprising the r.emersonii cellobiohydrolase I PC1-146 variant have significantly higher cellulose conversion than the cellulase composition comprising r.emersonii wild-type cellobiohydrolase I.

Example 29: comparison of Rasamsonia emersonii Cellobiohydrolase I PC1-146 variants with Rasamsonia emersonii wild-type Cellobiohydrolase I during hydrolysis

R.emersonii cellobiohydrolase I PC1-146 variants and r.emersonii wild-type cellobiohydrolase I were evaluated on unmilled unwashed PCS at 20% TS. The enzyme matrix design is shown in table 1 below.HTec3 was obtained from novicent, ag sward, denmark. Enzymatic hydrolysis was carried out at 32 ℃ for 3 days and 5 days. The released sugars were analyzed by HPLC (1200 series LC System, Agilent Technologies Inc., Palo alto, Calif., USA) equipped with a Rezex ROA-organic acid H⁺Column (8%) (7.8x 300mm) (Phenomenex Inc., tollens, ca., usa), 0.2mm inline filter, an autosampler, a gradient pump, and a refractive index detector. The mobile phase used was 5mM sulfuric acid at a flow rate of 0.9 ml/min. Glucose at various concentrations was used as standard.

As demonstrated by the results shown in figure 9, the r.emersonii cellobiohydrolase I PC1-146 variant performed better than the wild-type r.emersonii cellobiohydrolase I.

TABLE 1

Example 30: comparison of Rasamsonia emersonii Cellobiohydrolase I PC1-146 variants with Rasamsonia emersonii wild-type Cellobiohydrolase I during Simultaneous Saccharification and Fermentation (SSF)

The experimental design was the same as that shown in example 29, except that 1 g/liter of Red Star (RED) was added with the enzyme at the beginning of hydrolysis) Yeast and 2 g/l urea. Ethanol release was analyzed by HPLC using the system described in example 29. Ethanol at various concentrations was used as a standard.

As demonstrated by the results shown in figure 10, the r.emersonii cellobiohydrolase I PC1-146 variant performed better than the wild-type r.emersonii cellobiohydrolase I during SSF.

Example 31: construction of Rasamsonia emersonii fusion cellobiohydrolase I Using linker and carbohydrate binding Module from Trichoderma reesei cellobiohydrolase I

Codon-optimized synthetic genes encoding Trichoderma reesei (hypocrea jecorina) cellobiohydrolase I are described in example 1.

A codon optimized synthetic gene encoding r.emersonii cellobiohydrolase I is described in example 20.

To generate the gene encoding r.emersonii fusion cellobiohydrolase I (SEQ ID NO:72 for fusion protein DNA sequence; and SEQ ID NO:73 for fusion protein) using linker and Carbohydrate Binding Module (CBM) from trichoderma reesei cellobiohydrolase I, a DNA fragment encoding the trichoderma reesei cellobiohydrolase I linker and CBM was assembled to the 3' -end of the gene encoding r.emersonii cellobiohydrolase I using Splicing Overlap Extension (SOE) PCR.

The DNA fragment encoding the Trichoderma reesei cellobiohydrolase I linker and CBM was amplified using the primers F-SOE and R-pDau109 shown below.

Primer F-SOE

5’-

GGTCCCATCAACTCGACATTCACAGCCTCGGGTGGAAACCCTCCTGGCGGAAACCCTC-3’SE(Q ID NO:74)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

Primer F-pDau109

5’-CCACACTTCTCTTCCTTCCTCAATCCTC-3’(SEQ ID NO:69)

Use ofThe high fidelity PCR kit amplifies DNA fragments encoding the Trichoderma reesei cellobiohydrolase 1 linker and the CBM. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 0.25. mu.l of primer F-SOE (100. mu.M), 0.25. mu.l of primer R-pDau109 (100. mu.M), 10. mu.l of template DNA (pDAU 222-Trichoderma reesei cellobiohydrolase I, 1 ng/. mu.l) and 28. mu.l of deionized water in a total volume of 50. mu.l. Use ofPCR system 9700 performs PCR, programmed for 1 cycle, at 98 ℃ for 30 seconds; and 30 cycles, each cycle lasting 10 seconds at 98 ℃, 30 seconds at 55 ℃, and 1 minute at 72 ℃. The PCR solution was then maintained at 8 ℃ until removed from the PCR machine.

The PCR solution was subjected to 1% agarose gel electrophoresis using TAE buffer, where a 405bp PCR fragment encoding the trichoderma reesei linker and CBM was excised from the gel and purified using a MinElute gel extraction kit (qiagen, valencia, ca, usa).

A DNA fragment encoding R.emersonii cellobiohydrolase I was amplified using the above primer F-pDau109 and primer R-pDau 109.

Use ofA high fidelity PCR kit amplifies a DNA fragment encoding r. PCR solutionThe mixture was washed with 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 0.25. mu.l of primer F-pDAU109 (100. mu.M), 0.25. mu.l of primer R-pDAU109 (100. mu.M), 10. mu.l of template DNA (pDAU222-R.emersonii cellobiohydrolase I, 1 ng/. mu.l) and 28. mu.l of deionized water in a total volume of 50. mu.l. Use ofPCR system 9700 performs PCR, programmed for 1 cycle, at 98 ℃ for 30 seconds; and 30 cycles, each cycle lasting 10 seconds at 98 ℃, 30 seconds at 55 ℃, and 1 minute at 72 ℃. The PCR solution was then maintained at 8 ℃ until removed from the PCR machine.

The PCR solution was subjected to 1% agarose gel electrophoresis using TAE buffer, where a 1600bp fragment encoding r.

PCR using SOE andthe high fidelity PCR kit assembles two purified DNA fragments. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 0.25. mu.l of primer F-pDAU109 (100. mu.M), 10. mu.l of gel-purified fragment encoding the Trichoderma reesei cellobiohydrolase 1 linker and CBM, 2. mu.l of DNA fragment encoding R.emersonii cellobiohydrolase I and 26. mu.l of deionized water in a total volume of 50. mu.l. Use ofPCR system 9700 performs PCR, programmed for 1 cycle, at 98 ℃ for 30 seconds; and 30 cycles, each cycle lasting 20 seconds at 98 ℃, 30 seconds at 55 ℃, and 72 ℃ forFor 1 minute. The PCR solution was then maintained at 8 ℃ until removed from the PCR machine.

Then, the PCR-generated DNA fragment was digested with BamHI (New England Biolabs, Ipswich, Mass., USA) and Hind III (New England Biolabs, Ipswich, Mass., USA) as follows. Forty μ l of the PCR product was mixed with 5 μ l of buffer 2 (New England Biolabs, Ipusley, Mass., USA), 1 μ l of Bam HI and 1 μ l of Hind III and incubated at 37 ℃ for 4 hours. The resulting PCR product was subjected to 1% agarose gel electrophoresis using TAE buffer. Approximately 1567bp bands were excised from the gel and purified using the MinElute gel extraction kit.

The purified 1567bp fragment encoding r.emersonii cellobiohydrolase I with a linker and Carbohydrate Binding Module (CBM) from trichoderma reesei cellobiohydrolase I was cloned into Bam HI and Hind III digested pDAu109 using T4DNA ligase. Bam HI-Hind III digested pDau109 and Bam HI/Hind III fragment comprising r.emersonii cellobiohydrolase I with linker and Carbohydrate Binding Module (CBM) from trichoderma reesei cellobiohydrolase I coding sequence were mixed in a molar ratio of 1:3 (i.e. equal volume of gel purified product) and ligated with 50 units of T4DNA ligase in 1X T4DNA ligase buffer with 1mM ATP and incubated at 22 ℃ for 10 min.

The ligation mixture was transformed into the ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.1mg ampicillin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB ampicillin plates. Both transformants were cultured in LB medium supplemented with 0.15mg ampicillin/ml and usedThe Spin Miniprep kit isolates the plasmid.

Insertion of a DNA fragment encoding r.emersonii cellobiohydrolase I with a linker and Carbohydrate Binding Module (CBM) from trichoderma reesei cellobiohydrolase I into pDAu109 was verified by sequencing. The isolated plasmids were sequenced with the vector primers F-pDau109 and R-pDau109 using an applied biosystems 3730xl DNA Analyzer, in order to determine representative plasmids that contained no PCR errors and contained the correct insertions.

A plasmid clone was selected which contained no PCR errors and contained a DNA fragment encoding r.emersonii cellobiohydrolase I with a linker and Carbohydrate Binding Module (CBM) from trichoderma reesei cellobiohydrolase I and was designated as plasmid pE 147. The fusion cellobiohydrolase I is designated herein as PC 1-147.

Example 32: site-directed mutagenesis of Rasamsonia emersonii PC1-147 fusion cellobiohydrolase I

The fusion protein gene encoding r.emersonii PC1-147 fusion cellobiohydrolase I was provided in pE 147.

To generate variants of r.emersonii PC1-147 fusion cellobiohydrolase I (SEQ ID NO:75 for mutant DNA sequences; and SEQ ID NO:76 for variants), the AAC codon (N194) in the gene encoding r.emersonii PC1-147 fusion cellobiohydrolase I was replaced with a GCA codon (194A) and the AAC codon (N197) was replaced with a GCA codon (197A).

Primer F-N194A N197A:

5’-AAGGATGGCAGCCCTCGTCCGCAAACGCGGCAACTGGCATCGGTGATCAC-3’(SEQ ID NO:67)

primer R-N194A N197A:

5’-GGACGAGGGCTGCCATCCTTCCACGTTCGC-3’(SEQ ID NO:68)

site-directed mutagenesis of the r.emersonii PC1-147 fusion cellobiohydrolase I gene was facilitated by PCR amplification of the pDau109 vector containing the r.emersonii PC1-147 fusion cellobiohydrolase I gene. The R.emersonii PC1-147 fusion cellobiohydrolase I gene was previously cloned into Bam HI-Hind III digested pDau109 resulting in transcription of the R.emersonii PC1-147 fusion cellobiohydrolase I gene under the control of the NA2-tpi dual promoter.

Use ofThe high fidelity PCR kit introduces mutations by PCR. The PCR solution was composed of 10. mu.l of 5 XHF buffer, 1. mu.l of dNTP (10mM), and 0.5. mu.l ofDNA polymerase (0.2 units/. mu.l), 0.25. mu.l of primer F-N194A N197A (100. mu.M), 0.25. mu.l of primer R-N194A N197A (100. mu.M), 10. mu.l of plasmid pE147DNA (1 ng/. mu.l) and 28. mu.l of deionized water in a total volume of 50. mu.l. Use ofPCR system 9700 performs PCR, programmed for 1 cycle, at 98 ℃ for 30 seconds; and 19 cycles, each cycle lasting 30 seconds at 98 ℃,1 minute at 55 ℃, and 4 minutes at 72 ℃. The PCR solution was then maintained at 8 ℃ until removed from the PCR machine.

After PCR, 10 units of Dpn I were added directly to the PCR solution and incubated at 37 ℃ for 1 hour. Then, 1. mu.l of Dpn I treated PCR solution was transformed into ONE according to the manufacturer's protocolTOP 10F' chemically competent E.coli cells and dispersed on LB plates supplemented with 0.15mg ampicillin/ml. After incubation at 37 ℃ overnight, transformants were observed to grow under selection on LB ampicillin plates. Four transformants were cultured in LB medium supplemented with 0.15mg ampicillin/ml and usedThe Spin Miniprep kit isolates the plasmid.

The isolated plasmids were sequenced with primers F-pDau109, F-Central1, R-Central2, and R-pDau109 using an applied biosystems 3730xl DNA Analyzer, in order to determine representative plasmids that contained no PCR errors and contained the desired mutations.

Primer F-pDau109

5’-CCACACTTCTCTTCCTTCCTCAATCCTC-3’(SEQ ID NO:69)

Primer F-Central1

5’-GTGAGGCGAACGTGGAAGGATG-3’(SEQ ID NO:70)

Primer R-Central2

5’-gtacctgtgtccgtgccgtcatctg-3’(SEQ ID NO:71)

Primer R-pDau109

5’-ATCCTCAATTCCGTCGGTCGA-3’(SEQ ID NO:31)

One plasmid clone that contained no PCR errors and contained the AAC (N194) to GCA (194A) mutations and the AAC (N197) to GCA (197A) mutations was selected and designated as plasmid pE 378. This variant is designated herein as PC 1-378.

Example 33: expression of Rasamsonia emersonii PC1-147 fusion cellobiohydrolase I and R.emersonii cellobiohydrolase I PC1-378 variants

The expression plasmids pE147 and pE378 were transformed into Aspergillus oryzae MT3568 protoplasts according to Klitenssen et al (Christensen), 1988, supra and WO 2004/032648. Aspergillus oryzae MT3568 protoplasts were prepared according to the method of EP0238023B1, pages 14-15.

Transformants were purified by a single conidium on COVE sucrose plates without CsCl. Spores of the transformants were inoculated into 96-deep-well plates containing 0.50ml YP + 2% maltose + 0.5% glucose medium and incubated at rest at 34 ℃ for 6 days. Transformants were analyzed for the production of r.emersonii PC1-147 fusion cellobiohydrolase I and r.emersonii cellobiohydrolase I PC1-378 variants from culture supernatants of 96 deep-well cultures. Expression was verified by measuring the reducing sugars released by hydrolysis of microcrystalline cellulose according to the procedure described in example 24.

One transformant was selected for r.emersonii PC1-147 fusion cellobiohydrolase I and r.emersonii cellobiohydrolase I PC1-378 variants based on the degree of hydrolysis of microcrystalline cellulose and designated aspergillus oryzae PC1-147 and aspergillus oryzae PC1-378, respectively.

For larger scale production, Aspergillus oryzae PC1-147 or Aspergillus oryzae PC1-378 spores were dispersed on COVE sucrose slants and incubated at 37 ℃ for five days. The fused spore slants were washed twice with 5ml of G2-Gly medium. Then, a 500ml flask containing 150ml of G2-Gly medium was inoculated with the spore suspension. The preculture was incubated at 30 ℃ with constant shaking at 150 rpm. One day later, four 500ml flasks containing 150ml of DAP-4C medium were inoculated with each preculture. On the fourth day after inoculation, the culture broth was collected by filtration through a bottle cap MF75Supor MachV 0.2 μm PES filter.

Example 34: purification of Rasamsonia emersonii PC1-147 fusion cellobiohydrolase I and R.emersonii cellobiohydrolase I PC1-378 variants

The fermentation broth was filtered through a PES bottle top filter with a 0.22 μm cut-off. Ammonium sulfate was added to the filtered broth to a concentration of 1.8M.

The fermentation broth was purified by HIC/affinity chromatography followed by IEX/affinity chromatography.

In the HIC/affinity chromatography step, the fermentation broth was applied to 200ml of phenyl which had been pre-equilibrated with 1.8M ammonium sulfate, 25mM HEPES (pH7.0)6Fast Flow column (high resolution). After sample application, the column was washed with 2 column volumes of 1.8M ammonium sulfate followed by 1 column volume of 0.54M ammonium sulfate. Bound protein was eluted in portions with 25mM HEPES (pH 7.0).

The elution of the protein was monitored at 280 nm. Using 12 holes4% -12% Bis-Tris gels fractions with high absorbance at 280nm were analyzed on SDS-PAGE for cellobiohydrolase I content. Fractions with high content of this protein were combined and collected for further purification. Combining the fractionsSephadex in equilibration with 25mM MES (pH 6.0)^TMDesalting on G-25 (middle) column. The elution of the protein was monitored at 280nm and the fraction with high absorbance at 280nm was selected for the second chromatography step.

The combined fractions were applied to 60ml RESOURCE equilibrated with 25mM MES (pH 6.0)^TM15Q column, and the bound protein was eluted with a linear 100-. The elution of the protein was monitored at 280nm and fractions with high absorbance at 280nm were analyzed on SDS-PAGE.

The fractions with a high content of cellobiohydrolase I are combined.

Example 35: measurement of the Activity of Rasamsonia emersonii PC1-147 fusion cellobiohydrolase I and R.emersonii cellobiohydrolase I PC1-378 variants on microcrystalline cellulose

According to example 26, using washed microcrystalline cellulose as substrate, the activity of purified r.emersonii PC1-147 fusion cellobiohydrolase I and r.emersonii cellobiohydrolase I PC1-378 variant (example 34) was compared to purified wild-type r.emersonii cellobiohydrolase I (example 25). Values are shown as relative activity, with 100% set as the activity of r. The assay conditions were incubation at pH 5, 50 ℃ and 1100rpm for 24 hours.

As demonstrated by the results shown in fig. 11, r.emersonii PC1-147 fusion cellobiohydrolase I and r.emersonii cellobiohydrolase I PC1-378 variants increased the activity on microcrystalline cellulose by approximately 22% and 44%, respectively, compared to r.emersonii wild-type cellobiohydrolase I.

The invention is further described by the following numbered paragraphs:

[1] a variant cellobiohydrolase which has a variant cellobiohydrolase activity at a nucleotide sequence corresponding to SEQ ID NO:2 at one or more of positions 197, 198, 199, and 200, wherein the change at one or more of positions 197, 198 and 200 is a substitution and the change at the position corresponding to position 199 is a deletion, wherein the variant has cellobiohydrolase activity and wherein the variant has at least 60% of the mature polypeptide of the parent cellobiohydrolase, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity.

[2] The variant of paragraph 1, wherein the parent cellobiohydrolase is selected from the group consisting of: (a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO 2, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20 or SEQ ID NO 22; (b) a polypeptide encoded by a polynucleotide that hybridizes under low stringency conditions with the mature polypeptide coding sequence of SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19 or SEQ ID NO 21, or the full complement thereof; (c) a polypeptide encoded by a polynucleotide having at least 60% identity to the mature polypeptide coding sequence of SEQ ID NO 1,3, 4, 7, 9, 11, 13, 15, 17, 19 or 21; and (d) a fragment of the mature polypeptide of SEQ ID NO 2, 8, 10, 12, 14, 16, 18, 20 or 22 having cellobiohydrolase activity.

[3] The variant of paragraph 2, wherein the parent cellobiohydrolase has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide of SEQ ID NO 2, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, or SEQ ID NO 22.

[4] The variant of paragraph 2 or 3, wherein the parent cellobiohydrolase is encoded by a polynucleotide that hybridizes under low stringency conditions, medium-high stringency conditions, or very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, SEQ ID NO 13, SEQ ID NO 15, SEQ ID NO 17, SEQ ID NO 19, or SEQ ID NO 21; or its full-length complement.

[5] The variant of any of paragraphs 2-4, wherein the parent cellobiohydrolase is encoded by a polynucleotide, the polynucleotide is similar to the polynucleotide shown in SEQ ID NO: 1. SEQ ID NO: 3. SEQ ID NO: 4. SEQ ID NO: 7. SEQ ID NO: 9. SEQ ID NO: 11. SEQ ID NO: 13. SEQ ID NO: 15. SEQ ID NO: 17. SEQ ID NO: 19. or SEQ ID NO:21 has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[6] The variant of any of paragraphs 2-5, wherein the parent cellobiohydrolase comprises or consists of the mature polypeptide of SEQ ID NO 2, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, or SEQ ID NO 22.

[7] The variant of any of paragraphs 2-6, wherein the parent cellobiohydrolase is a fragment of the mature polypeptide of SEQ ID NO 2, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 18, SEQ ID NO 20, or SEQ ID NO 22, wherein the fragment has cellobiohydrolase activity.

[8] The variant of any of paragraphs 1-7, which has at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95% identity, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the amino acid sequence of the parent cellobiohydrolase or mature polypeptide thereof.

[9] The variant of any of paragraphs 1-8, wherein the number of such alterations is 1-4, e.g., 1,2, 3, and 4 alterations.

[10] The variant of any of paragraphs 1-9, which comprises a substitution at a position corresponding to position 197.

[11] The variant of paragraph 10, wherein the substitution is with Ala.

[12] The variant of any of paragraphs 1-11, which comprises a substitution at a position corresponding to position 198.

[13] The variant of paragraph 12, wherein the substitution is with Ala.

[14] The variant of any of paragraphs 1-13, comprising a substitution at a position corresponding to position 200.

[15] The variant of paragraph 14, wherein the substitution is with Ala, Gly, or Trp.

[16] The variant of any of paragraphs 1-15, which comprises a deletion at a position corresponding to position 197.

[17] The variant of any of paragraphs 1-16, comprising a change at two positions corresponding to any of positions 197, 198, 199, and 200.

[18] The variant of any of paragraphs 1-16, comprising a change at three positions corresponding to any of positions 197, 198, 199, and 200.

[19] The variation of any of paragraphs 1-16, comprising a change at each of the positions corresponding to positions 197, 198, 199 and 200.

[20] The variant of any of paragraphs 1-19, comprising one or more alterations at a position corresponding to the mature polypeptide of SEQ ID NO:2 selected from the group consisting of: N197A, N198A, a199, and N200A, G, W.

[21] The variant of any of paragraphs 1-19, comprising the alterations N197A + N198A at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[22] The variant of any of paragraphs 1-19, which variant comprises the alteration N197A + a199 at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[23] The variant of any of paragraphs 1-19, comprising the alterations N197A + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[24] The variant of any of paragraphs 1-19, comprising the alteration N198A + a199 at the position corresponding to the mature polypeptide of SEQ ID No. 2.

[25] The variant of any of paragraphs 1-19, comprising the alterations N198A + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[26] The variant of any of paragraphs 1-19, comprising the alterations a199 x + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID No. 2.

[27] The variant of any of paragraphs 1-19, which variant comprises the alteration N197A + N198A + a199 at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[28] The variant of any of paragraphs 1-19, comprising the alterations N197A + N198A + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID NO: 2.

[29] The variant of any of paragraphs 1-19, which variant comprises the alterations N197A + a199 + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID No. 2.

[30] The variant of any of paragraphs 1-19, comprising the alterations N198A + a199 + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID No. 2.

[31] The variant of any of paragraphs 1-19, comprising the alterations N197A + N198A + a199 + N200A, G, W at the position corresponding to the mature polypeptide of SEQ ID No. 2.

[32] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 6 or a mature polypeptide thereof.

[33] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 45 or a mature polypeptide thereof.

[34] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 47 or a mature polypeptide thereof.

[35] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 49 or a mature polypeptide thereof.

[36] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 51 or a mature polypeptide thereof.

[37] The variant of any of paragraphs 1-31, which comprises or consists of SEQ ID NO 66 or a mature polypeptide thereof.

[38] The variant of any of paragraphs 1-31, wherein the parent is a hybrid or chimeric polypeptide in which the carbohydrate binding domain of the parent is replaced with a different carbohydrate binding domain.

[39] The variant of any of paragraphs 1-31, which is a hybrid or chimeric polypeptide, wherein the carbohydrate-binding domain of the variant is replaced with a different carbohydrate-binding domain.

[40] The variant of any of paragraphs 1-31, wherein the parent is a fusion protein in which a heterologous carbohydrate binding domain is fused to the parent.

[41] The variant of paragraph 40, wherein the carbohydrate binding domain is fused to the N-terminus or C-terminus of the parent.

[42] The variant of paragraph 40 or 41, wherein the fusion protein comprises or consists of SEQ ID NO 73 or a mature polypeptide thereof.

[43] The variant of any of paragraphs 1-31, which is a fusion protein, wherein a heterologous carbohydrate binding domain is fused to the variant.

[44] The variant of paragraph 43, wherein the carbohydrate binding domain is fused to the N-terminus or C-terminus of the variant.

[45] The variant of paragraphs 43 or 44, which comprises or consists of SEQ ID NO 76 or a mature polypeptide thereof.

[46] The variant of any of paragraphs 1-45, which has increased specific performance relative to the parent.

[47] An isolated polynucleotide encoding the variant of any of paragraphs 1-46.

[48] A nucleic acid construct or expression vector comprising the polynucleotide of paragraph 47.

[49] A host cell comprising the polynucleotide of paragraph 47.

[50] A method of producing a cellobiohydrolase variant, the method comprising: culturing a host cell as described in paragraph 49 under conditions suitable for expression of the variant.

[51] The method of paragraph 50, further comprising recovering the variant.

[52] A transgenic plant, plant part or plant cell transformed with the polynucleotide of paragraph 47.

[53] A method of producing the variant of any of paragraphs 1-46, comprising: culturing a transgenic plant or plant cell comprising a polynucleotide encoding the variant under conditions conducive for production of the variant.

[54] The method of paragraph 53, further comprising recovering the variant.

[55] A method for obtaining a cellobiohydrolase variant, the method comprising introducing an alteration in a parent cellobiohydrolase at one or more positions corresponding to positions 197, 198, 199 and 200 of the mature polypeptide of SEQ ID No. 2, wherein the alteration at one or more positions corresponding to positions 197, 198 and 200 is a substitution and the alteration at position corresponding to position 199 is a deletion, and wherein the variant has cellobiohydrolase activity.

[56] The method of paragraph 55, further comprising recovering the variant.

[57] A composition comprising the variant of any of paragraphs 1-46.

[58] A whole broth formulation or cell culture composition comprising the variant of any of paragraphs 1-46.

[59] A method for degrading a cellulosic material, the method comprising: treating the cellulosic material with an enzyme composition in the presence of the variant of any of paragraphs 1-46.

[60] The method of paragraph 59, wherein the cellulosic material is pretreated.

[61] The method of paragraph 59 or 60, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of: cellulases, GH61 polypeptides having cellulolytic enhancing activity, hemicellulases, catalase, esterase, patulin, laccase, ligninolytic enzymes, pectinases, peroxidases, proteases, and swollenin.

[62] The method of paragraph 61, wherein the cellulase is one or more enzymes selected from the group consisting of: endoglucanases, cellobiohydrolases, and beta-glucosidases.

[63] The method of paragraph 61, wherein the hemicellulase is one or more enzymes selected from the group consisting of: xylanases, acetylxylan esterases, feruloyl esterases, arabinofuranosidases, xylosidases, and glucuronidases.

[64] The method of any of paragraphs 59-63, further comprising recovering the degraded cellulosic material.

[65] The method of paragraph 64, wherein the degraded cellulosic material is a sugar.

[66] The method of paragraph 65, wherein the sugar is selected from the group consisting of: glucose, xylose, mannose, galactose, and arabinose.

[67] A method for producing a fermentation product, the method comprising: (a) saccharifying a cellulosic material with an enzyme composition in the presence of the variant of any of paragraphs 1-46; (b) fermenting the saccharified cellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

[68] The method of paragraph 67 wherein the cellulosic material is pretreated.

[69] The method of paragraphs 67 or 68, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of: cellulases, GH61 polypeptides having cellulolytic enhancing activity, hemicellulases, catalase, esterase, patulin, laccase, ligninolytic enzymes, pectinases, peroxidases, proteases, and swollenin.

[70] The method of paragraph 69, wherein the cellulase is one or more enzymes selected from the group consisting of: endoglucanases, cellobiohydrolases, and beta-glucosidases.

[71] The method of paragraph 69, wherein the hemicellulase is one or more enzymes selected from the group consisting of: xylanases, acetylxylan esterases, feruloyl esterases, arabinofuranosidases, xylosidases, and glucuronidases.

[72] The method of any one of paragraphs 67-71, wherein steps (a) and (b) are performed simultaneously in simultaneous saccharification and fermentation.

[73] The method of any of paragraphs 67-72, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or a polyketide.

[74] A method of fermenting a cellulosic material, the method comprising: fermenting the cellulosic material with one or more fermenting microorganisms, wherein the cellulosic material is saccharified with an enzyme composition in the presence of the variant of any of paragraphs 1-46.

[75] The method of paragraph 74, wherein fermenting the cellulosic material produces a fermentation product.

[76] The method of paragraph 75, further comprising recovering the fermentation product from the fermentation.

[77] The method of paragraph 75 or 76, wherein the fermentation product is an alcohol, alkane, cycloalkane, alkene, amino acid, gas, isoprene, ketone, organic acid, or polyketide.

[78] The method of any of paragraphs 74-77, wherein the cellulosic material is pretreated prior to saccharification.

[79] The method of any of paragraphs 74-78, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of: cellulases, GH61 polypeptides having cellulolytic enhancing activity, hemicellulases, catalase, esterase, patulin, laccase, ligninolytic enzymes, pectinases, peroxidases, proteases, and swollenin.

[80] The method of paragraph 79, wherein the cellulase is one or more enzymes selected from the group consisting of: endoglucanases, cellobiohydrolases, and beta-glucosidases.

[81] The method of paragraph 80, wherein the hemicellulase is one or more enzymes selected from the group consisting of: xylanases, acetylxylan esterases, feruloyl esterases, arabinofuranosidases, xylosidases, and glucuronidases.

The inventions described and claimed herein are not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the inventions. Any equivalent aspects are contemplated to be within the scope of these inventions. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the present disclosure, including definitions, will control.

99页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：一种β-1,3-1,4-葡聚糖葡萄糖水解酶及其应用

Cellobiohydrolase variants and polynucleotides encoding same

相关技术

网友询问留言