RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof, and methods of use

文档序号：1803135 发布日期：2021-11-05 浏览：19次中文

阅读说明：本技术 用于抑制HIF-2α(EPAS1)的表达的RNAi试剂、其组合物和使用方法 (RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof, and methods of use ) 是由李珍舒东旭 A·尼古拉斯朱锐 J·卡尔森 S·黃李晓恺 E·阿尔滕霍费尔 M· 于 2020-01-08 设计创作，主要内容包括：本公开内容涉及能够抑制HIF-2α(EPAS1)基因表达的RNAi试剂,例如,双链RNAi试剂。也公开了包括HIF-2αRNAi试剂的药物组合物及其使用方法。本文公开的HIF-2αRNAi试剂可以连接或缀合至靶向配体(诸如对包括α-v-β-3和α-v-β-5整联蛋白在内的整联蛋白具有亲和力的化合物)和药代动力学(PK)增强剂,以促进递送至细胞和组织,包括透明细胞肾细胞癌(ccRCC)细胞和肿瘤。包含HIF-2αRNAi试剂的组合物在体内的递送会提供HIF-2α基因表达的抑制。所述HIF-2αRNAi试剂可以用在治疗各种疾病和障碍(包括ccRCC)的方法中。(The present disclosure relates to methods capable of inhibiting HIF-2 α: ( EPAS1 ) RNAi agents for gene expression, e.g., double stranded RNAi agents. Also disclosed are pharmaceutical compositions comprising HIF-2 α RNAi agents and methods of use thereof. The HIF-2. alpha. RNAi agents disclosed herein can be linked orConjugated to targeting ligands (such as compounds with affinity for integrins including alpha-v-beta-3 and alpha-v-beta-5 integrins) and Pharmacokinetic (PK) enhancers to facilitate delivery to cells and tissues, including clear cell renal cell carcinoma (ccRCC) cells and tumors. Delivery of a composition comprising a HIF-2 α RNAi agent in vivo provides inhibition of HIF-2 α gene expression. The HIF-2 α RNAi agents can be used in methods of treating various diseases and disorders, including ccRCC.)

1. A composition for inhibiting HIF-2 alpha (a)EPAS1) An RNAi agent of expression of a gene comprising:

(i) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3;

(ii) a sense strand comprising a nucleotide sequence at least partially complementary to said antisense strand; and

(iii) one or more targeting ligands.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in table 3.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sense strand sequences provided in tables 4, 4.1, 4.2 or 4.3, and wherein the sense strand contains a region of at least 85% complementarity to the antisense strand over the 17 contiguous nucleotides.

4. The RNAi agent of any one of claims 1-3, wherein all or substantially all of the nucleotides of the sense strand of the RNAi agent, the antisense strand of the RNAi agent, or both the sense and antisense strands of the RNAi agent are modified nucleotides.

5. The RNAi agent of claim 4, wherein at least one modified nucleotide is selected from the group consisting of: 2' -O-methyl nucleotides, 2' -fluoro nucleotides, 2' -deoxy nucleotides, 2', 3 ' -open loop nucleotide mimics, locked nucleotides, 2' -F-arabinonucleotides, 2' -methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2' -O-methyl nucleotides, inverted 2' -deoxynucleotides, 2' -amino-modified nucleotides, 2' -alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate modified ribonucleotides, cyclopropylphosphonate modified nucleotides, 2' -O-propargyl-modified nucleotides, 2' -O-triazole-modified nucleotides, and 3 ' -O-methyl nucleotides.

6. The RNAi agent of claim 5, wherein each modified nucleotide is independently selected from the group consisting of: 2 ' -O-methyl nucleotides, 2 ' -fluoro nucleotides and 2 ' -O-triazole-modified nucleotides.

7. The RNAi agent of any one of claims 1-6, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in table 3.

8. The RNAi agent of any one of claims 1-7, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in table 4.

9. The RNAi agent of any one of claims 1-8, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in table 4, table 4.1, table 4.2, or table 4.3.

10. The RNAi agent of any one of claims 1-9, wherein the antisense strand comprises nucleotides 2-18 of usufuscfafafafafafafafafaffcgfuafufcgfufsg (SEQ ID NO: 30), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and s represents a phosphorothioate bond.

11. The RNAi agent of claim 10, wherein the antisense strand comprises the sequence usufuscfafafafafafafafafafafafafufufcfcfcfcgfufcfufsg (SEQ ID NO: 30), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and s represents a phosphorothioate bond.

12. The RNAi agent of claim 1, wherein the sense strand comprises nucleotides 2-18 of the sequence of CAACGUAACGAUUUCAUGAAA (SEQ ID NO: 428).

13. The RNAi agent of claim 1, wherein the sense strand comprises Y- (NH-C6) scsacaguaa cfgfafafuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO: 761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, each X, Y and Z being independently a pharmacological moiety; u. of^Z、a^Z、g^ZAnd c^ZRepresents uridine, adenosine, guanosine and cytidine, respectively, wherein the pharmacological moiety Z is attached to the 2' position of the nucleotide and Y- (NH-C6) represents:(invAb) represents:and (6-S) represents:and s represents a phosphorothioate bond.

14. The RNAi agent of any one of claims 12 or 13, wherein the antisense strand is at least substantially complementary to the sense strand.

15. The RNAi agent of any one of claims 1-14, wherein the nucleotide of the sense strand consists of Y- (NH-C6) scsacagua cfgfaffuuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO: 761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and each X, Y and Z is independently a pharmacological moiety; u. of^Z、a^Z、g^ZAnd c^ZRespectively, uridine, adenosine, guanosine and cytidine, wherein the pharmacological moiety is attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), Y- (NH-C6) s represents:(invAb) represents:and (6-S) represents:and s represents a phosphorothioate bond.

16. The RNAi agent of claim 15, wherein the nucleotides of the antisense strand consist of the sequence of usufuscfaffaafgaafafufgfuufuafuafcgfuufsg (SEQ ID NO: 30), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and s represents a phosphorothioate bond.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand of the RNAi agent is linked to at least one targeting ligand.

18. The RNAi agent of claim 17, wherein the targeting ligand comprises a compound with affinity for integrin.

19. The RNAi agent of claim 18, wherein the targeting ligand comprises a compound with affinity for integrin α -v- β -3, α -v- β -5, or both α -v- β -3 and α -v- β -5.

20. The RNAi agent of claim 19, wherein the targeting ligand is a compound of the formula:

(formula I) is shown in the specification,

wherein the content of the first and second substances,

x is-C (R)³)₂-、-NR³-、、Or；

Y is an optionally substituted alkylene group having 1 to 8 carbon atoms in the alkylene chain;

z is O, NR³Or S;

R¹is optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted cycloalkyl, or R¹Comprising an RNAi agent;

R²is H, optionally substituted alkyl, or R²Comprising an RNAi agent;

R³each instance of (A) is independently selected from H and optionally substituted alkyl, or R³Comprising an RNAi agent;

R⁴is H or optionally substituted alkyl; and is

Y, R therein¹、R²At least one of R³Any examples of (2) and R⁴Comprising an RNAi agent.

21. The RNAi agent of claim 20, wherein the targeting ligand is selected from the group consisting of:

(Structure 1 a);

(Structure 2 a);

(Structure 2.1 a);

(Structure 2.2 a);

(Structure 2.3 a);

(Structure 2.4 a);

(Structure 2.5 a);

(Structure 2.6 a);

(Structure 2.7 a);

(Structure 2.8 a);

(Structure 2.9 a);

(Structure 2.10 a);

(Structure 2.11 a);

(structure 28 a);

(structure 29 a);

(Structure 30 a);

(structure 31 a);

(structure 32 a);

(structure 33 a);

(structure 34 a);

(structure 36 a);

(structure 37 a);

(structure 38 a);

(Structure 39 a);

(structure 40 a); and

(Structure 41a)

WhereinIndicating the point of attachment to the HIF-2 α RNAi agent.

22. The RNAi agent of any one of claims 1-21, wherein the targeting ligand has the structure:

(Structure 2 a).

23. The RNAi agent of any one of claims 1-22, further comprising a Pharmacokinetic (PK) enhancer.

24. The RNAi agent of claim 23, wherein the PK enhancer comprises the formula:

wherein Y is an optionally substituted saturated or unsaturated aliphatic chain and n is an integer from 5 to 25.

25. The RNAi agent of claim 24, wherein the PK enhancer comprises。

26. The RNAi agent of claim 23, wherein the PK enhancer is selected from the group consisting of:

whereinIndicating the point of attachment to the RNAi agent.

27. The RNAi agent of any one of claims 1-26, wherein the targeting ligand is linked to the sense strand.

28. The RNAi agent of any one of claims 23-27, wherein the PK enhancer is linked to the sense strand.

29. The RNAi agent of any one of claims 1-28, wherein the RNAi agent is linked to 2-10 targeting ligands.

30. The RNAi agent of any one of claims 1-29, wherein the RNAi agent is linked at the 5' terminal end of the sense strand to a targeting group comprising 2 or more targeting ligands.

31. The RNAi agent of any one of claims 1-30, wherein at least one targeting ligand is attached to the 5' terminal end of the sense strand and at least one targeting ligand is attached to the non-terminal nucleotide of the sense strand.

32. The RNAi agent of any one of claims 1-31, linked to two or more targeting ligands, wherein the 2 or more targeting ligands are linked at a branching point to form a targeting group.

33. The RNAi agent of claim 32, wherein the targeting group comprises three targeting ligands and the targeting group has the formula:

wherein the content of the first and second substances,

L¹、L²and L³Each independently is a linker comprising an optionally substituted alkylene;

L⁴is a linker comprising an optionally substituted alkylene, an optionally substituted aryl, or an optionally substituted cycloalkyl;

R⁵Is H or optionally substituted alkyl;

TL is a targeting ligand; and is

Y is O or S.

34. The RNAi agent of claim 33, wherein the targeting group has the formula:。

35. the RNAi agent of any one of claims 1-34, wherein a tridentate targeting group is attached to the 5' terminal end of the sense strand, and wherein at least two additional targeting ligands are attached to one or more nucleotides of the sense strand.

36. The RNAi agent of claim 31 or 35, wherein at least 10 nucleotides are positioned between a targeting group located on the 5' terminus of the sense strand and a targeting ligand located on the sense strand.

37. The RNAi agent of any one of claims 1-36, wherein at least one targeting ligand is attached to the 2' position of the nucleotide of the sense strand of the RNAi agent.

38. The RNAi agent of any one of claims 23-37, wherein the PK-enhancer is linked to the 3' terminal end of the sense strand.

39. The RNAi agent of any one of claims 1-38, wherein 5-8 targeting ligands are linked to the sense strand.

40. The RNAi agent of claim 39, wherein the sense strand of the RNAi agent is linked to at least one tridentate targeting group, and at least two targeting ligands are linked to one or more nucleotides of the sense strand.

41. The RNAi agent of claim 40, wherein the sense strand of the RNAi agent is linked to (i) a tridentate targeting group at the 5 'terminal end of the sense strand, and (ii) 2-4 targeting ligands linked to nucleotides of the sense strand other than the 5' terminal nucleotide.

42. The RNAi agent of any one of claims 29-41, wherein the targeting ligand is linked to the sense strand as follows: (i) a tridentate targeting group comprising 3 individual targeting ligands is located at the 5' terminal end of the sense strand; and (ii) the additional targeting ligand is a single targeting ligand attached to a single nucleotide of the sense strand that is at least 10 nucleotides from the 5' terminal end of the sense strand.

43. The RNAi agent of claim 42, wherein the targeting ligand is linked to the sense strand nucleotides at positions 2, 4, 6 and 8 (3 '→ 5') from the 3 'nucleotide of the sense strand which forms a base pair with the 5' terminal nucleotide of the antisense strand.

44. The RNAi agent of claim 43, wherein at least one targeting ligand is linked to a single nucleotide at the 2 ' position of the ribose ring, the 3 ' position of the ribose ring, the 1 ' position of the ribose ring, or the nucleobase of the nucleotide, the 4 ' position of the ribose ring, or the 5 ' position of the nucleotide.

45. The RNAi agent of claim 44, wherein at least one targeting ligand is linked to the 2' position of the ribose ring of a single nucleotide.

46. The RNAi agent of any one of claims 1-45, wherein the sense strand is between 18-49 nucleotides in length and the antisense strand is between 18-49 nucleotides in length.

47. The RNAi agent of claim 46, wherein the sense strand and the antisense strand each have a length of between 18-27 nucleotides.

48. The RNAi agent of claim 47, wherein the sense strand and the antisense strand each have a length of between 18-24 nucleotides.

49. The RNAi agent of claim 48, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

50. The RNAi agent of any one of claims 46-49, wherein the RNAi agent has two blunt ends.

51. The RNAi agent of any one of claims 1-50, wherein the sense strand comprises 1 or 2 terminal caps.

52. The RNAi agent of any one of claims 1-51, wherein the sense strand comprises 1 or 2 inverted abasic residues.

53. The RNAi agent of any one of claims 1-52, wherein the RNAi agent comprises a sense strand and an antisense strand forming a duplex having the structure of any one of the duplexes in table 5.

54. The RNAi agent of any one of claims 51-53, wherein the sense strand further comprises an inverted abasic residue at the 3 'terminus of the nucleotide sequence, at the 5' terminus of the nucleotide sequence, or at both the 3 'terminus and the 5' terminus of the nucleotide sequence.

55. A HIF-2 α RNAi agent comprising:

(i) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3; and

(ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to said antisense strand.

56. A composition for inhibiting HIF-2 alpha (a)EPAS1) An RNAi agent of expression of a gene comprising:

(i) an antisense strand having a length of between 18-49 nucleotides, which is homologous to HIF-2 α: (EPAS1) The genes (SEQ ID NO:1) are at least partially complementary;

(ii) a sense strand at least partially complementary to the antisense strand;

(iii) a targeting ligand attached to the sense strand; and

(iv) a PK enhancer attached to the sense strand.

57. The RNAi agent of claim 56, wherein the targeting ligand is linked to the 5' terminal end of the sense strand.

58. The RNAi agent of claim 56 or 57, wherein the PK enhancer is linked to the 3' terminal end of the sense strand.

59. The RNAi agent of any one of claims 56-58, wherein one or more targeting ligands are linked to one or more nucleotides of the sense strand.

60. The RNAi agent of claim 59, wherein 2-12 targeting ligands are linked to the nucleotide of the sense strand.

61. The RNAi agent of any one of claims 56-60, wherein a tridentate targeting group comprising three targeting ligands is linked to the 5' terminal end of the sense strand; a PK enhancer is attached to the 3' terminal end of the sense strand; and 2-12 targeting ligands are attached to a single nucleotide of the sense strand.

62. The RNAi agent of claim 61, wherein a targeting ligand attached to the single nucleotide of the sense strand is attached at the 2' position of each respective nucleotide.

63. The RNAi agent of any one of claims 56-62, wherein the targeting ligand is linked to the nucleotide of the sense strand located at positions 2, 6, 15 and 19 (3 '→ 5') from the first nucleotide that forms a base pair with the antisense strand.

64. The RNAi agent of any one of claims 56-62, wherein the targeting ligand is linked to the nucleotide of the sense strand located at positions 2, 4, 6 and 8 (3 '→ 5') from the first nucleotide that forms a base pair with the antisense strand.

65. The RNAi agent of any one of claims 56-62, wherein the targeting ligand is linked to the nucleotide of the sense strand opposite nucleotides 2, 4, 6 and 8 (5 '→ 3') of the antisense strand.

66. The RNAi agent of any one of claims 56-65, wherein a tridentate targeting group comprising three targeting ligands is located at the 5 'terminal end of the sense strand, the sense strand further comprising 2-4 targeting ligands linked to the nucleotides of the sense strand, and there being at least 10 nucleotides separating the tridentate targeting group at the 5' terminal end of the sense strand from the next nearest targeting ligand attached to the nucleotides.

67. The RNAi agent of claim 66, wherein four targeting ligands are attached to a single nucleotide of the sense strand.

68. The RNAi agent of any one of claims 56-67, wherein the targeting ligand is an integrin targeting ligand comprising a compound having affinity for integrin α -v- β -3.

69. The RNAi agent of any one of claims 56-68, wherein the PK enhancer has the formula:

wherein Y is an optionally substituted saturated or unsaturated aliphatic chain and n is an integer from 5 to 25.

70. An RNAi agent comprising an antisense strand comprising the sequence usufusCfaUfgAfaAfuCfgUfCfcGfAfufsg (SEQ ID NO: 30) and an antisense strand comprising the sequence Y- (NH-C6) scsaacguaaCfGfAfAfuuu ^Zca^Zug^Zaa^ZThe sense strand of sa (invAb) (6-S) -X (SEQ ID NO: 761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; s represents a phosphorothioate bond, u^Z、a^Z、g^ZAnd c^ZRespectively uridine, adenosine, guanosine and cytidine, wherein the pharmacological moiety comprising Z is attached at the 2' position of the nucleotide and Y- (NH-C6) s represents:(ii) a (invAb) represents:(ii) a (6-S) represents:and each of X, Y and Z independently represents:

(iv) a targeting group comprising one or more targeting ligands, wherein said targeting ligand is selected from the group consisting of: structure 2a, structure 2.11a, structure 29a and structure 32 a;

(v) a targeting ligand having a structure selected from the group consisting of: structure 2a, structure 2.11a, structure 29a and structure 32 a; or

(vi) A PK enhancer having a structure selected from: c-18 diacid, C-18 triacid, Mal-C₁₇-vinyl-PO₃And C20 acid.

71. The RNAi agent of claim 70, wherein each Z is a targeting ligand having the structure of structure 2 a:whereinIndicating the connection point.

72. The RNAi agent of claim 70, wherein each Z is a targeting ligand having the structure of structure 2.11 a:whereinIndicating the connection point.

73. The RNAi agent of claim 70, wherein each Z is a group with A targeting ligand having the structure of structure 29 a:whereinIndicating the connection point.

74. The RNAi agent of claim 70, wherein each Z is a targeting ligand having the structure of structure 32 a:whereinIndicating the connection point.

75. The RNAi agent of any one of claims 70-74, wherein X is a PK enhancer having the structure of C-18 diacid:whereinIndicating the connection point.

76. The RNAi agent of any one of claims 70-74, wherein X is a PK enhancer having the structure of Mal-C-18 triacid:whereinIndicating the connection point.

77. The RNAi agent of any one of claims 70-74, wherein X is a PK increment having the structure of Mal-C17-vinyl PO3A strengthening agent:whereinIndicating the connection point.

78. The RNAi agent of any one of claims 70-74, wherein X is a PK enhancer having the structure of Mal-C20 acid:whereinIndicating the connection point.

79. The RNAi agent of any one of claims 70-78, wherein the RNAi agent comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 targeting ligands.

80. The RNAi agent of claim 79, wherein the RNAi agent comprises 7 targeting ligands.

81. The RNAi agent of claim 80, wherein Y is a targeting group having the structure: TriAlk 14: Or TriAlk 14s:wherein TL comprises a targeting ligand selected from: structure 2a, structure 2.11a, structure 29a and structure 32 a.

82. The RNAi agent of claim 81, wherein each TL comprises the structure 2a:whereinIndicating the connection point.

83. The RNAi agent of claim 81, wherein each TL comprises the structure 2.11a:whereinIndicating the connection point.

84. The RNAi agent of claim 81, wherein each TL comprises structure 29a:whereinIndicating the connection point.

85. The RNAi agent of claim 81, wherein each TL comprises the structure 32a:whereinIndicating the connection point.

86. The RNAi agent of any one of claims 70-85, wherein the nucleotides of the antisense strand consist of the nucleotides of SEQ ID No. 30.

87. The RNAi agent of any one of claims 70-86, wherein the nucleotide of the sense strand consists of the nucleotide of SEQ ID NO: 761.

88. A composition comprising the RNAi agent of any one of claims 1-87, wherein the composition comprises a pharmaceutically acceptable excipient.

89. The composition of claim 88, further comprising a second RNAi agent for inhibiting expression of HIF-2 α.

90. The composition of claim 88 or 89, further comprising one or more additional therapeutic agents.

91. A method for inhibiting HIF-2 alpha (alpha) in a cellEPAS1) A method of gene expression, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1-88 or a composition of any one of claims 88-90.

92. The method of claim 91, wherein the cell is in a subject.

93. The method of claim 92, wherein the subject is a human subject.

94. The method of any of claims 91-93, wherein HIF 2-a gene expression is inhibited in vivo by at least about 30%.

95. A method for treating a HIF 2-a associated disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 88-90.

96. The method of claim 95, wherein the disease or disorder is cancer, kidney cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, neovascular disease, or rheumatoid arthritis.

97. The method of claim 95 or 96, wherein the disease is clear cell renal cell carcinoma (ccRCC).

98. The method of any one of claims 91-97, wherein the RNAi agent is administered at a dose of about 3 mg/kg to about 80 mg/kg of the body weight of the human subject.

99. The method of claim 98, wherein the RNAi agent is administered at a dose of about 5 mg/kg to about 20 mg/kg of the body weight of the human subject.

100. The method of claim 98 or 99, wherein the RNAi agent is administered in a fractionated dose, wherein about half of the desired daily amount is administered in the initial administration and the remaining about half of the desired daily amount is administered about 4 hours after the initial administration.

101. The method of any one of claims 98-100, wherein one or more doses of the RNAi agent are administered 1 time per week.

102. The method of any one of claims 99-101, wherein a dose or divided dose of the RNAi agent is administered 1 time every 2 weeks (once every other week).

103. The RNAi agent of any one of claims 1-88 or the composition of any one of claims 88-90 for use in treatment of at least in part by HIF-2 α (f: (r))EPAS1) Use of a disease, disorder or condition mediated by gene expression.

104. The use of claim 103, wherein the disease is ccRCC.

105. Use of the RNAi agent of any one of claims 1-88 or the composition of any one of claims 88-90 for the preparation of a pharmaceutical composition for the treatment of a disease state mediated at least in part by HIF-2 α (hi-fi-2 α)EPAS1) A disease, disorder or condition mediated by gene expression.

106. The use of claim 105, wherein the disease is ccRCC.

Technical Field

The present disclosure relates to RNA interference (RNAi) agents, e.g., double stranded RNAi agents, compositions comprising HIF-2 α RNAi agents, and methods of use thereof, for inhibiting expression of the HIF-2 α (EPAS1) gene.

Background

Hypoxia inducible factor-2 α (referred to as HIF-2 α, HIF2- α, HIF2 α, or HIF2 α), also referred to as endothelial PAS domain containing protein 1(EPAS1), is a hypoxia inducible transcription factor that responds to a decrease in available oxygen (hypoxia). HIF-2 α is encoded by the EPAS1 gene (alternatively referred to herein as the "HIF-2 α gene"), and its expression is known to be upregulated under hypoxic conditions.

In certain populations of people living at high altitudes, such as the western Tibetan, it has been found that a large portion of the population has evolved to carry certain allelic variants of the HIF-2 α gene that contribute to improved oxygen transport in the body in a hypoxic environment. However, in a more typical altitude setting, overexpression of wild-type EPAS1 has been associated with increased hypertension and stroke, and has symptoms similar to alpine disease due to overproduction of red blood cells. Mutations in this gene have also been associated with familial polycythemia type 4 and pulmonary hypertension.

Notably, despite the widespread expression of HIF-2 α in various tissues in humans, HIF-2 α protein has been identified as essential for or enhancing the expression of various genes involved in the classification of diseases, including tumor progression. For example, HIF-2 α is believed to play a role in the progression of uveal melanoma as follows: by promoting autocrine loop VEGF-pVEGFR2/KDR, and by enhancing expression of LDHA, growth advantages are conferred.

EPAS1 has also been shown to correlate with or up-regulate the expression of other factors, including: cMyc (which contributes to cell proliferation, transformation, neoplasia and tumorigenesis, and which is highly expressed in most cancers); interleukin 8 (a proinflammatory mediator, e.g., in gingivitis and psoriasis); SP-1 (co-activator of transcription factor and cMyc involved in IL-8 regulation); LDH5 (associated with tumor necrosis and increased tumor size); and lan a (latency associated nuclear antigen, which is associated with kaposi's sarcoma-associated herpesvirus). Furthermore, HIF (hypoxia inducible factor) activity can often play a role in angiogenesis required for cancer tumor growth. For example, HIF-2 α is believed to be involved in several other diseases, including renal cancer, clear cell renal cell carcinoma (and metastases of this and other cancers), melanoma, inflammation, chronic inflammation, neovascular disease, rheumatoid arthritis, uveal melanoma, chondrosarcoma, and multiple myeloma. Mutations in the EPAS1 gene have also been associated with early onset neuroendocrine tumors such as paragangliomas, somatostatinoma and/or pheochromocytoma. Mutations are typically somatic missense mutations located at the primary hydroxylation site of HIF-2 α. These mutations are thought to disrupt protein hydroxylation/degradation mechanisms and lead to protein stabilization and pseudo-hypoxic signaling. In addition, neuroendocrine tumors release Erythropoietin (EPO) into the circulating blood and cause erythrocytosis.

More specifically, HIF-2 α has been associated with tumor progression and metastasis in clear cell renal cell carcinoma (ccRCC). It is believed that most ccRCC tumors express a mutant form of the Von Hippel-Landau protein that is unable to degrade HIF-2 α, which results in the accumulation of HIF-2 α and activation of HIF-2 α regulated genes (which promote tumor growth and metastasis).

There remains a need for viable therapeutic treatments to treat a variety of diseases, including cancers such as ccRCC. Similarly, there remains a need for therapeutic drug products that are capable of inhibiting expression of and/or reducing production of HIF-2 α. As just one example, a significant decrease in HIF-2 α expression in ccRCC cells may be able to inhibit undesired growth or otherwise slow the progression of these cancer cells.

One known method of inhibiting gene expression is RNA interference (RNAi) by administering oligonucleotide-based pharmaceutical products (e.g., RNAi agents) capable of inhibiting or silencing gene expression. However, in vivo identification is possibleSignificant challenges remain in the efficient and stable oligonucleotide sequences for internally silencing gene expression and in determining therapeutically feasible methods for safely and selectively delivering therapeutic agents to desired cells or tissues. Oligonucleotide-based drug products, when administered in vivo, tend to degrade or filter easily and rapidly in vivo, especially due to their relatively small size and inherent organic properties, which often prevent them from reaching the intended target cells and/or tissues. Various attempts have been made to try to overcome this limitation, including, for example, by encapsulation in liposomes, by iontophoresis, by incorporation of other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, proteinaceous carriers or Dynamic Polyconjugates ^TM(DPC)) (see, e.g., WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, each of which is incorporated herein by reference). Alternatively, conjugation of oligonucleotides to targeting ligands (such as compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, or antibody mimetics with affinity for cell surface molecules) has had some recent success in delivering oligonucleotide-based therapeutic agents to hepatocytes in the liver. However, efforts to target oligonucleotide-based drug products to extrahepatic cells have to date largely failed due to lack of efficacy, toxicity, or a combination of both.

Despite certain advances in this area, there remains a need for improved delivery mechanisms to facilitate in vivo delivery of therapeutic agents, including oligonucleotides and oligonucleotide-based drug products. Furthermore, there remains a need for potent and selective inhibitors of HIF-2 α.

Disclosure of Invention

Disclosed herein are RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) capable of selectively and effectively inhibiting expression of the HIF-2 α (EPAS1) gene, e.g., double stranded RNAi agents. Further disclosed herein are compositions comprising an RNAi agent for inhibiting expression of HIF-2 α, wherein the HIF-2 α RNAi agent is linked to at least one targeting ligand having affinity for a cellular receptor present on a target cell, and, optionally, at least one Pharmacokinetic (PK) enhancer. The HIF-2 α RNAi agents disclosed herein can selectively and effectively reduce or inhibit expression of the HIF-2 α (EPAS1) gene in a subject (e.g., a human or animal subject).

In general, the disclosure features HIF-2 α gene-specific RNAi agents, compositions including HIF-2 α RNAi agents, and methods of inhibiting expression of a HIF-2 α (EPAS1) gene in vivo and/or in vitro using the HIF-2 α RNAi agents and compositions including HIF-2 α RNAi agents described herein.

The described HIF-2 α RNAi agents can be used in methods of therapeutic treatment (including prophylactic and prophylactic treatment) of disorders and diseases that can be mediated, at least in part, by a reduction in HIF-2 α expression, including, for example, cancers such as clear cell renal cell carcinoma (ccRCC). HIF-2 α RNAi agents disclosed herein can selectively reduce HIF-2 α gene expression in a cell of a subject. The methods disclosed herein comprise administering to a subject (e.g., a human or animal subject) one or more HIF-2 α RNAi agents using any suitable method known in the art, such as intravenous infusion, intravenous injection, or subcutaneous injection.

In one aspect, the disclosure features RNAi agents for inhibiting expression of a human HIF-2 α (EPAS1) gene, wherein the RNAi agents comprise a sense strand and an antisense strand. The HIF-2 α RNAi agents may be further linked or conjugated to one or more targeting ligands and/or one or more PK enhancers.

Also described herein are pharmaceutical compositions comprising an RNAi agent capable of inhibiting HIF-2 α (EPAS1) gene expression, wherein the composition further comprises at least one pharmaceutically acceptable excipient. Pharmaceutical compositions described herein that include one or more of the disclosed HIF-2 α RNAi agents are capable of selectively and effectively reducing or inhibiting expression of the HIF-2 α gene in vivo. Compositions comprising one or more HIF-2 α RNAi agents can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of conditions and diseases that can be mediated, at least in part, by a reduction in HIF-2 α expression, including, for example, cancers such as ccRCC.

One aspect described herein is an RNAi agent for inhibiting expression of the HIF-2 α (EPAS1) gene, comprising:

(i) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3;

(ii) a sense strand comprising a nucleotide sequence at least partially complementary to said antisense strand; and

(iii) one or more targeting ligands.

In another aspect, RNAi agents capable of inhibiting expression of the HIF-2 α (EPAS1) gene are described, comprising:

(i) An antisense strand having a length of between 18-49 nucleotides that is at least partially complementary to the HIF-2 α (EPAS1) gene (SEQ ID NO: 1);

(ii) a sense strand at least partially complementary to the antisense strand;

(iii) a targeting ligand attached to the sense strand; and

(iv) a PK enhancer attached to the sense strand.

In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by 0 or 1 nucleobases. In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5 '→ 3') UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by NO more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by 0 or 1 nucleobase, wherein SEQ ID NO:827 is located at positions 1-21(5 '→ 3') of the antisense strand.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5 ' → 3 ') usufuscfafgaafafafucfcffufcgfucfcgfufffufsg (SEQ ID NO:30) by NO more than 1 nucleotide, wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. As clearly understood by one of ordinary skill in the art, the inclusion of phosphorothioate linkages as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides (see, e.g., fig. 7A to 7G showing all internucleoside linkages). In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence (5 ' → 3 ') usufuscfafafafafafafafafafafafafafafaffcfufsg (SEQ ID NO:30), wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5 ' → 3 ') ascfasufafgaafcafafcacafafgaafufufufuffsg (SEQ ID NO:90) by NO more than 1 nucleotide, wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence (5 ' → 3 ') ascffsasufagfuafafafcafafafafafafafafafafafufgfufsg (SEQ ID NO:90), wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from the nucleotide sequence (5 ' → 3 ') usgfusufafafgaafgafcafufugfugfusgfusgfusgfusgfusgfusf, wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand. In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence (5 ' → 3 ') usgfusufagfuafafafafcabgfugfugfusgfusgfusu (SEQ ID NO:113), wherein a, c, g, and u represent 2 ' -O-methyladenosine, cytidine, guanosine, and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by 0 or 1 nucleobase. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5 '→ 3') ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by NO more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by 0 or 1 nucleobase, wherein SEQ ID NO:883 is located at positions 1-21(5 '→ 3') of the antisense strand.

In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by 0 or 1 nucleobase. In certain embodiments, a HIF-2 α RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5 '→ 3') UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by NO more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5 '→ 3') UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by 0 or 1 nucleobase, wherein SEQ ID NO:902 is located at positions 1-21(5 '→ 3') of the antisense strand.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafafafafafafafafafafaffcfufsg (SEQ ID NO:30), and a sense strand consisting of, or consisting of a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafufugfufffufffufffufff (SEQ ID NO:30), the sense strand consisting of the modified nucleotide sequence (5 '→ 3') ynh-C6) scaagafafafafafafafafafafafafafafafufuufffuufufufuffuufusaffuufusaffuuff ^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), consisting essentially of a modified nucleotide sequence (5 '→ 3') Y- (NH-C6) scsaacgua Cf GfAfuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761) or comprises a modified nucleotide sequence (5 '→ 3') Y- (NH-C6) scaaacgua Cf GfAfuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRepresent uridine, adenosine, guanosine and cytidine, respectively, with the pharmacological moiety (e.g., targeting ligand, targeting group and/or PK enhancer) attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (NH2-C6) as defined in table 7, and s represents a phosphorothioate linkage. In certain embodiments, the HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafafafafafafafaffcfufsg (SEQ ID NO:30), a sense strand, and a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafaffcgffufsg (SEQ ID NO:30), Or comprises a modified nucleotide sequence (5 '→ 3') usufusCfaUfGaafafafuCfUfGfCGfufsg (SEQ ID NO:30), the sense strand consisting of the modified nucleotide sequence (5 '→ 3') Y- (NH-C6) scsaacgua CfGfAfuuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), consisting essentially of a modified nucleotide sequence (5 '→ 3') Y- (NH-C6) scsaacgua Cf GfAfuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761) or comprises a modified nucleotide sequence (5 '→ 3') Y- (NH-C6) scaaacgua Cf GfAfuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') ascfasufagfaafafcacafgaafgaafguuffsg (SEQ ID NO:90) and a sense strand consisting of a modified nucleotide sequence (5 '→ 3') ascfasufagfaafafafafafafafafafafafafafafagfsg (SEQ ID NO:90), the sense strand consisting of, or comprising a modified nucleotide sequence (5 '→ 3') ascfascfascfasfaafafafafafafafafafafafafafafafafafafafafafafafafafafafafagfsg (SEQ ID NO:90), the sense strand consisting of a modified nucleotide sequence (5 '→ 3') (Z) ₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806), consisting essentially of a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806) or comprises a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806), wherein a, C, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf respectively represent 2' -fluoroadenosine and CytosineGlycosides, guanosides and uridines; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRepresent uridine, adenosine, guanosine and cytidine, respectively, with pharmacological moieties (e.g., targeting ligands, targeting groups and/or PK enhancers) attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (TriAlk14), (C6-S) and (invAb) as defined in table 7, and S represents a phosphorothioate linkage. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') ascfasufagfaafafcacafgaafgaafguuffsg (SEQ ID NO:90) and a sense strand consisting of a modified nucleotide sequence (5 '→ 3') ascfasufagfaafafafafafafafafafafafafafafagfsg (SEQ ID NO:90), the sense strand consisting of, or comprising a modified nucleotide sequence (5 '→ 3') ascfascfascfasfaafafafafafafafafafafafafafafafafafafafafafafafafafafafafagfsg (SEQ ID NO:90), the sense strand consisting of a modified nucleotide sequence (5 '→ 3') (Z) ₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806), consisting essentially of a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806) or comprises a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus (invAb) (C6-S) -X (SEQ ID NO:806), and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of a modified nucleotide sequence (5 '→ 3') usgfusufagfuafgafcafcabgfufugfugfusgfusu (SEQ ID NO:113) and a sense strandConsisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') usGfsusUfaGfuGfuGfAfcAfUfuGfFfuGfsu (SEQ ID NO:113), the sense strand consisting of a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas (invAb) (C6-S) -X (SEQ ID NO:810), consisting essentially of a modified nucleotide sequence (5 '→ 3') (Z) ₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas (invAb) (C6-S) -X (SEQ ID NO:810) or comprises a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas (invAb) (C6-S) -X (SEQ ID NO:810), wherein a, C, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRepresent uridine, adenosine, guanosine and cytidine, respectively, with pharmacological moieties (e.g., targeting ligands, targeting groups and/or PK enhancers) attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (TriAlk14), (C6-S) and (invAb) as defined in table 7, and S represents a phosphorothioate linkage. In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') usgfusufaffagaafgafcafgagfugfugfusgfusgfusgfusgfusgfusgfusdfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusgfusdfusgfusgfusgfusgfusgfusgfusgfusgfusdfusgfusgfusgfusgfusgfusdfusgfusgfusdfusgfusgfusdfusdfusgfusf (SEQ ID NO (SEQ ID NO:113) in (SEQ ID NO:113) and a of modified nucleotide sequence (5 '→) of modified nucleotide sequence (5' → 3 ') and a) a modified nucleotide sequence (5' →) of a modified nucleotide sequence (5 '→ 3') and a sense strand, the sense strand consisting of modified nucleotide sequence (Z) ₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas(invAb)(C6-S)-X(SEQ ID NO:810), consisting essentially of a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas (invAb) (C6-S) -X (SEQ ID NO:810) or comprises a modified nucleotide sequence (5 '→ 3') (Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas (invAb) (C6-S) -X (SEQ ID NO:810), and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein include an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafafafafafufafufafgafcfufsg (SEQ ID NO:30), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') uscfafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafufgfafgffufsg (SEQ ID NO:30), the sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence, the modified nucleotide sequence (5 '→ 3') being selected from: y- (NH-C6) scsaa ^Zcgua^ZaCfGfAfuuuca^Zugaa^Zsa(invAb)(6-S)-X(SEQ ID NO:740)、Y-(NH-C6)scsaac^Zguaa^ZCfGfAfuuu^Zcaug^Zaasa(invAb)(6-S)-X(SEQ ID NO:756)、Y-(NH-C6)scsaacg^Zuaa^ZCfGfAfu^Zuuc^ZAugaasa (invAb) (6-S) -X (SEQ ID NO:757) and Y- (NH-C6) scsaacgua CfGfAfuuucau^Zg^Za^Za^Zsa (invAb) (6-S) -X (SEQ ID NO:762), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRespectively, represent uridine, adenosine, guanosine, and cytidine, wherein the pharmacological moiety (e.g., targeting ligand, targeting group, and/or PK enhancer) is attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (NH2-C6), (invAb), and (6-S) are as defined in table 7, and S represents a phosphorothioate linkage. In certain embodiments, HIF-2 α RNAi agents disclosed herein include an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') usufuscfafafafafafafafafafafafafafafafafafafufafufafgafcfufsg (SEQ ID NO:30), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5 '→ 3') uscfafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafafufgfafgffufsg (SEQ ID NO:30), the sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence, the modified nucleotide sequence (5 '→ 3') being selected from: y- (NH-C6) scsaa ^Zcgua^ZaCfGfAfuuuca^Zugaa^Zsa(invAb)(6-S)-X(SEQ ID NO:740)、Y-(NH-C6)scsaac^Zguaa^ZCfGfAfuuu^Zcaug^Zaasa(invAb)(6-S)-X(SEQ ID NO:756)、Y-(NH-C6)scsaacg^Zuaa^ZCfGfAfu^Zuuc^ZAugaasa (invAb) (6-S) -X (SEQ ID NO:757) and Y- (NH-C6) scsaacgua CfGfAfuuucau^Zg^Za^Za^Zsa (invAb) (6-S) -X (SEQ ID NO:762), and wherein said sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and said sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein said targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the following nucleotide sequences (5 '→ 3') by 0 or 1 nucleotide:

UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827)；

ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883); or

UGUUAGUAUGGACAGUUGUGU(SEQ ID NO:902)；

Wherein the HIF-2. alpha. RNAi agent further comprises a sense strand at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the nucleotide sequences (5 '→ 3') set forth below by 0 or 1 nucleotide

UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827)；

ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883); or

UGUUAGUAUGGACAGUUGUGU(SEQ ID NO:902)；

Wherein the HIF-2. alpha. RNAi agent further comprises a sense strand at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from one of the nucleotide sequences (5 '→ 3') set forth below by 0 or 1 nucleotide

UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827)；

ACAUAGUACAUAGAGAAUGUG (SEQ ID NO: 883); or

UGUUAGUAUGGACAGUUGUGU(SEQ ID NO:902)；

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise a nucleotide sequence that differs from one of the following pairs of nucleotide sequences (5 '→ 3') by 0 or 1 nucleotide:

UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) and

CAACGUAACGAUUUCAUGAAA(SEQ ID NO:428)；

ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) and

CACAUUCUCUAUGUACUAUGU (SEQ ID NO: 485); or

UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) and

ACACAACUGUCCAUACUAACA(SEQ ID NO:507)；

wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides.

UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) and

CAACGUAACGAUUUCAUGAAA(SEQ ID NO:428)；

ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) and

CACAUUCUCUAUGUACUAUGU (SEQ ID NO: 485); or

UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) and

ACACAACUGUCCAUACUAACA(SEQ ID NO:507)；

Wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30)；

asCfsasUfaGfuAfcAfuAfgAfgAfaUfUfsg (SEQ ID NO: 90); or

usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu(SEQ ID NO:113)；

Wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; s represents a phosphorothioate bond; and wherein the HIF-2. alpha. RNAi agent further comprises a sense strand at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides.

usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30)；

asCfsasUfaGfuAfcAfuAfgAfgAfaUfUfsg (SEQ ID NO: 90); or

usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu(SEQ ID NO:113)；

Wherein the HIF-2. alpha. RNAi agent further comprises a sense strand at least partially complementary to the antisense strand; wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides; wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted abasic residues at the 3 ' terminal end and at the 5 ' terminal end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently attached to the 5 ' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence that differs from one of the following nucleotide sequence pairs (5 '→ 3') by 0 or 1 nucleotide:

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacguaaCfGfAfuuu^Zca^Zug^Zaa^Zsa(invAb)(6-S)-X(SEQ ID NO:761)；

asCfsafuFagfuAfcAafafgAfgAfaUfUfsg (SEQ ID NO:90) and

(Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus(invAb)(C6-S)-X(SEQ ID NO:806)；

usGfsusUfaGfuAfgAfgAfcAfUfuGfuGffsu (SEQ ID NO:113) and

(Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas(invAb)(C6-S)-X(SEQ ID NO:328)；

usufusCfaUfGaAffGuUfGfFcGfCfUfsg (SEQ ID NO:810) and

Y-(NH-C6)scsaa^Zcgua^ZaCfGfAfuuuca^Zugaa^Zsa(invAb)(6-S)-X(SEQ ID NO:740)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaac^Zguaa^ZCfGfAfuuu^Zcaug^Zaasa(invAb)(6-S)-X(SEQ ID NO:756)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacg^Zuaa^ZCfGfAfu^Zuuc^Zaugaasa(invAb)(6-S)-X(SEQ ID NO:757)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacguaaCfGfAfuuucau^Zg^Za^Za^Zsa(invAb)(6-S)-X(SEQ ID NO:762)；

wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRepresent uridine, adenosine, guanosine and cytidine, respectively, wherein the pharmacological moiety (e.g., targeting ligand, targeting group and/or PK enhancer) is attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (TriAlk14), (NH2-C6), (C6-S), (6-S) and (invAb) are as defined in table 7, and S represents a phosphorothioate bond.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand and a sense strand consisting of, consisting essentially of, or comprising one of the following pairs of nucleotide sequences (5 '→ 3'):

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacguaaCfGfAfuuu^Zca^Zug^Zaa^Zsa(invAb)(6-S)-X(SEQ ID NO:761)；

asCfsafuFagfuAfcAafafgAfgAfaUfUfsg (SEQ ID NO:90) and

(Z)₃-(TriAlk14)s(invAb)scacauucuCfUfAfugu^Zac^Zua^Zug^Zus(invAb)(C6-S)-X(SEQ ID NO:806)；

usGfsusUfaGfuAfgAfgAfcAfUfuGfuGffsu (SEQ ID NO:113) and

(Z)₃-(TriAlk14)s(invAb)sacacaacuGfUfCfcau^Zac^Zua^Zac^Zas(invAb)(C6-S)-X(SEQ ID NO:810)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaa^Zcgua^ZaCfGfAfuuuca^Zugaa^Zsa(invAb)(6-S)-X(SEQ ID NO:740)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaac^Zguaa^ZCfGfAfuuu^Zcaug^Zaasa(invAb)(6-S)-X(SEQ ID NO:756)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacg^Zuaa^ZCfGfAfu^Zuuc^Zaugaasa(invAb)(6-S)-X(SEQ ID NO:757)；

usufusCfaUfGaAffGuAfcGuAfcGcGfuUfsg (SEQ ID NO:30) and

Y-(NH-C6)scsaacguaaCfGfAfuuucau^Zg^Za^Za^Zsa(invAb)(6-S)-X(SEQ ID NO:762)；

wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; and each X, Y and Z is independently a pharmacological moiety (e.g., a targeting ligand, targeting group, and/or PK enhancer); u. of^Z、a^Z、g^ZAnd c^ZRepresents uridine, adenosine, guanosine and cytidine, respectively, wherein the pharmacological moiety (e.g., targeting ligand, targeting group and/or PK enhancer) is attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein), (TriAlk14), (NH2-C6), (C6-S), (6-S) and (invAb) are as defined in table 7, and S represents a phosphorothioate bond; and the sense strand also includes a targeting ligand covalently attached to the 5' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5 '→ 3') selected from:

UUUCAUGAAAUCGUUACGU(SEQ ID NO:5)；

UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and

ACAUAGUACAUAGAGAAUG(SEQ ID NO:13)。

in certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence (5 '→ 3') selected from:

UUUCAUGAAAUCGUUACGU(SEQ ID NO:5)；

UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and

ACAUAGUACAUAGAGAAUG(SEQ ID NO:13)。

wherein all or substantially all of the nucleotides are modified nucleotides.

UUUCAUGAAAUCGUUACGU(SEQ ID NO:5)；

UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and

ACAUAGUACAUAGAGAAUG(SEQ ID NO:13)；

wherein all or substantially all of the nucleotides are modified nucleotides and wherein SEQ ID NO:5, SEQ ID NO:10 and SEQ ID NO:13 are located at nucleotide positions 1-19(5 '→ 3') of the antisense strand, respectively.

In certain embodiments, HIF-2 α RNAi agents disclosed herein comprise an antisense strand and a sense strand each comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a pair of nucleotide sequences (5 '→ 3') selected from:

UUUCAUGAAAUCGUUACGU (SEQ ID NO:5) and ACGUAACGAUUUCAUGAAA (SEQ ID NO: 17);

UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and ACAACUGUCCAUACUAACA (SEQ ID NO: 22); or

ACAUAGUACAUAGAGAAUG (SEQ ID NO:13) and CAUUCUCUAUGUACUAUGU (SEQ ID NO: 25).

UUUCAUGAAAUCGUUACGU (SEQ ID NO:5) and ACGUAACGAUUUCAUGAAA (SEQ ID NO: 17);

UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and ACAACUGUCCAUACUAACA (SEQ ID NO: 22); or

ACAUAGUACAUAGAGAAUG (SEQ ID NO:13) and CAUUCUCUAUGUACUAUGU (SEQ ID NO: 25); and

wherein all or substantially all of the nucleotides are modified nucleotides.

In certain embodiments, a composition described herein comprising one or more HIF-2 α RNAi agents is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In certain embodiments, the compositions described herein are administered parenterally, e.g., by intravenous injection, intravenous infusion, or subcutaneous injection.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other objects, features, aspects and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and from the claims.

Drawings

FIG. 1 schematic representation of HIF-2. alpha. RNAi agents (shown as a duplex) linked to a tridentate targeting group (which includes three structural 2-avb3 targeting ligands), a C18-diacid PK enhancer, and linked four internal structural 2-abv3 targeting ligands (shown as internal nucleotides linked to the HIF-2. alpha. RNAi agent). The chemical structures of the targeting ligand, targeting group and PK enhancer are shown.

Figure 2 shows a schematic of a HIF-2 α RNAi agent (shown as a double helix) attached at one end to a PK enhancer and at the other end to a tridentate scaffold suitable for forming a tridentate targeting group comprising three targeting ligands. The HIF-2 α RNA agent schematic further shows certain sites that may be used to attach targeting ligands (denoted as "TL" in fig. 2) to the HIF-2 α RNAi agent, including showing four targeting ligands attached to internal nucleotides.

Figures 3A to 3D chemical structure representation of HIF-2 α RNAi agent AD06299 in free acid form, showing a "TL" (beginning on figure 3D and continuing to figure 3C) at the 2 ' position of nucleotides 2, 4, 6, and 8(3 ' → 5 ') of the sense strand, starting with the first nucleotide that forms a base pair with the antisense strand. "TL" represents the conjugation site of the targeting ligand on these internal nucleotides.

Figures 4A to 4b images of tumor size from tumor-bearing mice are shown on day 36 according to the study described in example 16 herein. Fig. 4A shows tumor sizes from the vehicle control group (D5W), where the left kidney is the contralateral kidney and the right kidney (larger) is the tumor kidney. FIG. 4B shows tumor sizes from mice administered HIF-2 α RNAi agent, where the left kidney is the contralateral kidney and the right kidney is the tumor kidney.

Figures 5A-5 b images showing Immunohistochemical (IHC) staining of HIF-2 α protein from tumor-bearing mice administered according to example 16 herein. Fig. 5A shows the vehicle control group (D5W), where dark spots show the presence of HIF-2 α protein. FIG. 5B shows treatment groups of mice administered HIF-2. alpha. RNAi agents.

Figure 6 is a bar graph reflecting tumor size of animals administered according to example 19 herein. Animals were classified based on tumor size measurements at day 34.

Figures 7A to 7g. schematic diagrams showing the nucleotide, internucleoside linkages and sense strand modifications of AD05971, AD06153, AD06157, AD05930, AD05966, AD05967 and AD05972 synthesised on a solid support, wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; aAlk, cAlk, gAlk and uAlk represent 2' -O-propargyl adenosine, cytidine, guanosine and uridine, respectively, O represents a phosphate ester bond and s represents a phosphorothioate bond, and invAb, 6-SS-6, C6-SS-C6, NH2-C6 and TriAlk14 are as defined in Table 7. Further modifications to the RNAi agents of figure 7, such as the addition of targeting ligands and PK enhancers, can be achieved after cleavage from the solid support.

Detailed Description

Rnai agents

RNAi agents (referred to herein as HIF-2 α or HIF2 α RNAi agents, or HIF-2 α or HIF2 α RNAi triggers) for inhibiting expression of the HIF-2 α (EPAS1) gene are described herein. HIF-2 α RNAi agents described herein include a sense strand (also referred to as the passenger strand) and an antisense strand (also referred to as the guide strand). The sense strand and the antisense strand may be partially complementary, substantially complementary, or fully complementary to each other. The lengths of the sense and antisense strands of the RNAi agents described herein can each be 16-49 nucleotides in length. In certain embodiments, the sense strand and antisense strand are independently 17-26 nucleotides in length. The sense strand and antisense strand may be the same length or different lengths. In certain embodiments, the sense strand and antisense strand are independently 21-26 nucleotides in length. In certain embodiments, the sense strand and antisense strand are independently 21-24 nucleotides in length. In certain embodiments, the sense strand and the antisense strand are 21 nucleotides in length. In certain embodiments, the sense strand and/or antisense strand are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein inhibit the expression of one or more HIF-2 α (EPAS1) genes in vivo or in vitro, following delivery to HIF-2 α -expressing cells.

One aspect described herein is an RNAi agent for inhibiting expression of the HIF-2 α (EPAS1) gene, comprising:

(i) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3;

(ii) a sense strand comprising a nucleotide sequence at least partially complementary to said antisense strand; and

(iii) one or more targeting ligands.

In another aspect, RNAi agents capable of inhibiting expression of the HIF-2 α (EPAS1) gene are described, comprising:

(i) an antisense strand having a length of between 18-49 nucleotides that is at least partially complementary to the HIF-2 α (EPAS1) gene (SEQ ID NO: 1);

(ii) a sense strand at least partially complementary to the antisense strand;

(iii) a targeting ligand attached to the sense strand; and

(iv) a PK enhancer attached to the sense strand.

The antisense strand of a HIF-2 α RNAi agent described herein comprises at least 16 contiguous nucleotides that are at least 85% complementary to a core stretch sequence of the same number of nucleotides in a HIF-2 α mRNA (also referred to herein as a "core stretch" or "core sequence") and a core stretch of the same number of nucleotides in the corresponding sense strand. In certain embodiments, the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, the antisense strand core segment is 19 nucleotides in length. In certain embodiments, the antisense strand core segment is 17 nucleotides in length.

The sense strand of a HIF-2 α RNAi agent described herein comprises at least 16 contiguous nucleotides having at least 85% identity to a core stretch of the same number of nucleotides in a HIF-2 α mRNA. In certain embodiments, the sense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, the sense strand core segment is 17 nucleotides in length. In certain embodiments, the sense strand core segment is 19 nucleotides in length.

In certain embodiments, the HIF-2 α RNAi agents disclosed herein target portions of the HIF-2 α gene having the sequence of any of the sequences disclosed in Table 1.

Examples of HIF-2. alpha. RNAi agent antisense strands that can be included in the HIF-2. alpha. RNAi agents disclosed herein are provided in Table 3. Examples of HIF-2. alpha. RNAi agent antisense strands that can be included in the HIF-2. alpha. RNAi agents disclosed herein are provided in tables 4, 4.1, 4.2, and 4.3. Examples of HIF-2 α RNAi agent duplexes are provided in Table 5. Examples of 19-nucleotide core segment sequences consisting of or comprised within the sense and antisense strands of the HIF-2 α RNAi agents disclosed herein are provided in table 2.

In certain embodiments, described herein are compositions comprising one or more HIF-2 α RNAi agents having a duplex structure disclosed in table 5.

In another aspect, a HIF-2 α RNAi agent disclosed herein can be delivered to a target cell or tissue by covalently linking or conjugating the RNAi agent to one or more targeting ligands (e.g., ligands comprising compounds having affinity for one or more cellular receptors located on a cell that expresses HIF-2 α). In certain embodiments, suitable targeting ligands include or consist of compounds having affinity for one or more integrins (alternatively referred to as "integrin receptors").

HIF-2. alpha. RNAi agents can be delivered to cells, including, but not limited to, cancers, using any oligonucleotide delivery technique known in the artCells such as (ccRCC) cells. Nucleic acid delivery methods include, but are not limited to: by linking or conjugating to targeting ligands, by encapsulation in liposomes, by iontophoresis, or by incorporation of other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, proteinaceous carriers, or Dynamic Polyconjugates^TM(DPC)。

In certain embodiments, a HIF-2 α RNAi agent is linked to a targeting ligand comprising a compound having affinity for one or more integrins (hereinafter referred to as an "integrin targeting ligand"). In certain embodiments, suitable targeting ligands for use with the HIF-2 α RNAi agents disclosed herein have affinity for integrin α -v- β 3, integrin α -v- β 5, or both integrins. The targeting ligand may be present alone (only one targeting compound is present), or two or more targeting ligands may be linked via a branch point or scaffold, together forming a targeting group, and the branch point or scaffold of the targeting group is then separately linked to the RNAi agent. Targeting groups can include two targeting ligands (referred to as "bidentate"), three targeting ligands ("tridentate"), four targeting ligands ("tetradentate"), or more than four targeting ligands. In certain embodiments, a HIF-2 α RNAi agent is linked to two or more targeting ligands. In certain embodiments, a HIF-2 α RNAi agent is linked to 2-10 targeting ligands. In certain embodiments, a HIF-2 α RNAi agent is linked to 7 targeting ligands. In certain embodiments, a HIF-2 α RNAi agent is linked to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 targeting ligands.

In certain embodiments, when a HIF-2 α RNAi agent is conjugated to a targeting ligand comprising a compound having affinity for integrin α -v- β 3 and/or integrin α -v- β 5, the RNAi agent is selectively internalized by ccRCC cells via receptor-mediated endocytosis or by other means. Examples of targeting ligands and targeting groups having affinity for integrin α -v- β 3 and/or integrin α -v- β -5 that can be used to deliver HIF-2 α RNAi agents are disclosed in, for example, PCT patent publication No. WO2019/210200, which is incorporated herein by reference in its entirety.

A targeting ligand may be attached to the 3 'or 5' terminus of the sense strand, the 3 'or 5' terminus of the antisense strand, and/or internally to one or more individual nucleotides of the sense strand and/or antisense strand of the HIF-2 α RNAi agent. In certain embodiments, a targeting ligand or targeting group is attached to the 3 'or 5' terminus of the sense strand. In certain embodiments, a targeting ligand or targeting group is attached to the 5' terminus of the sense strand. In certain embodiments, the targeting ligand or targeting group is internally linked to the nucleotides of the sense and/or antisense strand of the RNAi agent. In certain embodiments, a targeting ligand or targeting group is attached to the 5' terminal end of the sense strand and one or more targeting ligands are attached to one or more internal nucleotides of the sense strand. In certain embodiments, the targeting ligand or targeting group is linked to the RNAi agent via a linker.

With or without a linker, a targeting ligand or targeting group may be attached to the 5 'or 3' terminus of any of the sense strands and/or antisense strands disclosed in tables 2, 3 or 4, 4.1, 4.2, or 4.3. The linker may be attached to the 5 'or 3' terminus of any of the sense strands and/or antisense strands disclosed in tables 2, 3 or 4, 4.1, 4.2 or 4.3, with or without a targeting ligand or targeting group.

In another aspect, the HIF-2 α RNAi agents disclosed herein can be linked or conjugated to one or more pharmacokinetic/Pharmacodynamic (PK) enhancers. PK enhancers (also referred to as "Pharmacokinetic (PK) modifiers") as used herein are compounds that: which when linked to an oligonucleotide-based drug product or other therapeutic agent, can increase the systemic circulation time (increased half-life or plasma residence time) of the therapeutic agent in vivo as compared to the free form of the therapeutic agent by limiting renal excretion without impeding delivery of the therapeutic agent to the target cell or tissue, or which otherwise provides an improvement in pharmacodynamics as compared to the therapeutic agent without the PK enhancer. Disclosed herein are exemplary PK enhancers suitable for use with HIF-2 α RNAi agents. One of ordinary skill in the art will readily contemplate that the selected therapeutic agent can be readily designed for relevant in vivo and/or in vitro studies to identify additional suitable PK enhancers. For example, studies comparing therapeutic agents with and without PK enhancing agents can be readily devised which quantify the amount of drug product remaining in the systemic circulation of a subject at different time intervals, or which evaluate the effect or potency or duration of effect of the therapeutic agent at a relevant time point. This is within the knowledge of one of ordinary skill in the art.

In another aspect, the disclosure features methods for inhibiting expression of a HIF-2 a (EPAS1) gene, wherein the methods comprise administering to a subject or to a cell of a subject a HIF-2 a RNAi agent in an amount capable of inhibiting expression of a HIF-2 a gene, wherein the HIF-2 a RNAi agent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises the sequence of any one of the antisense strand nucleotide sequences of table 2 or table 3. In certain embodiments, disclosed herein are methods of inhibiting expression of a HIF-2 a gene, wherein the methods comprise administering to a subject or to a cell a HIF-2 a RNAi agent in an amount capable of inhibiting expression of a HIF-2 a gene, wherein the HIF-2 a RNAi agent comprises a sense strand and an antisense strand, and wherein the sense strand comprises the sequence of the nucleotide sequence of the sense strand in any one of tables 2, 4, 4.1, 4.2, or 4.3. Compositions for use in such methods are also described herein.

Also disclosed herein are methods of delivering HIF-2 α RNAi agents in vivo to cells expressing integrins (also referred to herein as "integrin receptors") in a subject, such as a mammal. In certain embodiments, delivery of a HIF-2. alpha. RNAi agent to a desired cell is facilitated by linking the HIF-2RNAi agent to one or more targeting ligands and/or one or more PK enhancers. Compositions for use in such methods are also described.

In another aspect, the disclosure features methods of treating (including prophylactic or preventative treatment) a disease, disorder or condition that may be mediated, at least in part, by a reduction in HIF-2 α expression, including ccRCC, wherein the method includes administering to a subject in need thereof a HIF-2 α RNAi agent having an antisense strand comprising the sequence of any one of the sequences in tables 2 or 3. In certain embodiments, described herein are methods of treating (including prophylactically treating) a disease, symptom, or disorder that may be mediated at least in part by a reduction in HIF-2 α expression, including ccRCC, wherein the method comprises administering to a subject in need thereof a HIF-2 α RNAi agent having a sense strand comprising a sequence of any one of the sequences in tables 2, 4, 4.1, 4.2, or 4.3. Compositions for use in such methods are also described herein.

Also described are methods of treating a human subject having or at risk of developing a pathological condition (such as a disorder or disease) mediated at least in part by HIF-2 α gene expression, the method comprising the step of administering to the subject a therapeutically effective amount of a HIF-2 α RNAi agent and/or a composition comprising a HIF-2 α RNAi agent. Methods of treating a subject with a HIF-2. alpha. RNAi agent and/or a composition comprising a HIF-2. alpha. RNAi agent can optionally be combined with one or more steps of administering one or more additional (e.g., second, third, etc.) therapeutic agents or treatments. The additional therapeutic agent can be another HIF-2 α RNAi agent (e.g., a HIF-2 α RNAi agent that targets a different sequence within the HIF-2 α gene). The additional therapeutic agent may also be a small molecule drug, an antibody fragment, and/or an aptamer.

In another aspect, described herein are pharmaceutical compositions comprising one or more of the described HIF-2 α RNAi agents, optionally in combination with one or more additional (second, third, etc.) therapeutic agents. In certain embodiments, a pharmaceutical composition comprising one or more of the described HIF-2 α RNAi agents, optionally in combination with one or more additional (e.g., second, third, etc.) therapeutic agents, can be formulated in a pharmaceutically acceptable carrier or diluent. In certain embodiments, these compositions can be administered to a subject, such as a mammal. In certain embodiments, the mammal is a human. In certain embodiments, the optional one or more additional therapeutic agents is a pharmaceutical product indicated for the treatment of cancer (such as one or more cancers). The HIF-2. alpha. RNAi agent and additional therapeutic agent can be administered in a single composition, or they can be administered separately. In certain embodiments, the one or more additional therapeutic agents are administered separately in a separate dosage form from the RNAi agent (e.g., HIF-2 α RNAi agent is administered by intravenous infusion or injection, while the additional therapeutic agents involved in the treatment regimen dosing regimen are administered orally). In certain embodiments, the described HIF-2 α RNAi agents are administered to a subject in need thereof by intravenous infusion or injection, as well as one or more optional additional therapeutic agents by intravenous infusion, injection, or orally, and together the administration provides a treatment regimen for diseases and disorders (such as ccRCC) that can be mediated by HIF-2 α gene expression. In certain embodiments, the HIF-2 α RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated as a single composition for intravenous infusion or injection). The HIF-2 α RNAi agent can be combined with one or more excipients, with or without one or more additional therapeutic agents, to form a pharmaceutical composition.

In certain embodiments, disclosed herein are methods for inhibiting expression of a HIF-2 a gene in a cell or subject, wherein the methods comprise administering to the cell or subject a HIF-2 a RNAi agent having a sense strand comprising a sequence of any one of the sequences in table 4, 4.1, 4.2, or 4.3, and an antisense strand comprising a sequence of any one of the sequences in table 3.

In certain embodiments, compositions for delivering HIF-2 α RNAi agents to ccRCC cells in vivo are described, the compositions comprising: a HIF-2 α RNAi agent linked or conjugated to one or more targeting ligands. In certain embodiments, the targeting ligand comprises a compound having affinity for integrin α -v- β -3 and/or integrin α -v- β -5. In certain embodiments, a HIF-2 α RNAi agent linked or conjugated to one or more targeting ligands is further linked or conjugated to one or more PK enhancers.

In certain embodiments, disclosed herein are compositions for delivering HIF-2 a RNAi agents to ccRCC cells in vivo, comprising a HIF-2 a RNAi agent conjugated or linked to one or more targeting ligands and/or targeting groups. In certain embodiments, the targeting ligand and/or targeting group comprises a compound having affinity for one or more integrins. In certain embodiments, compositions for delivering HIF-2 α RNAi agents to ccRCC cells in vivo are described, the compositions comprising a HIF-2 α RNAi agent linked to an α -v- β -3 and/or α -v- β -5 integrin targeting ligand.

In certain embodiments, disclosed herein are methods for inhibiting expression of a HIF-2 α (EPAS1) gene in a cell, wherein the method comprises administering to the cell a HIF-2 α RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a HIF-2 α mRNA having a sequence in Table 1. In certain embodiments, disclosed herein are methods of inhibiting expression of a HIF-2 a gene in a cell, wherein the methods comprise administering to the cell a HIF-2 a RNAi agent comprising an antisense strand comprising a sequence of any one of tables 2 or 3 and a sense strand comprising a sequence of any one of tables 2 or 4, 4.1, 4.2, or 4.3 that is at least partially complementary to the antisense strand. In certain embodiments, disclosed herein are methods of inhibiting expression of a HIF-2 a gene in a cell, wherein the methods comprise administering a HIF-2 a RNAi agent comprising a sense strand comprising any one of the sequences of table 2 or table 4, 4.1, 4.2, or 4.3 and an antisense strand comprising a sequence of any one of the sequences of table 2 or 3 that is at least partially complementary to the sense strand.

In certain embodiments, disclosed herein are compositions for inhibiting expression of a HIF-2 α gene in a cell, wherein the methods comprise administering a composition comprising a HIF-2 α RNAi agent having a duplex structure of a duplex shown in Table 5.

The HIF-2. alpha. RNAi agents disclosed herein are designed to target specific positions on the HIF-2. alpha. (EPAS1) gene (SEQ ID NO: 1). As defined herein, an antisense strand sequence is designed to target the HIF-2 α gene at a given position on the gene when the 5 'terminal nucleobase of the antisense strand, if base-paired with the gene, is aligned with a position 19 nucleotides downstream (toward the 3' terminus) of the position of the gene. For example, as shown in tables 1 and 2 herein, the sequence of the antisense strand designed to target the HIF-2 α gene at position 5033 requires that, if base paired with the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 5051 of the HIF-2 α (EPAS1) gene.

As provided herein, a HIF-2 α RNAi agent does not require that the nucleobase at position 1(5 '→ 3') of the antisense strand be complementary to the gene, provided that the antisense strand and the gene are at least 85% complementary (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) over a core segment sequence of at least 16 contiguous nucleotides. For example, for a HIF-2 α RNAi agent disclosed herein that is designed to target position 5033 of the HIF-2 α gene, the 5' terminal nucleobase of the antisense strand of the HIF-2 α RNAi agent must be aligned with position 5051 of the gene; however, the 5' terminal nucleobase of the antisense strand may be complementary to position 5051 of the HIF-2 α gene, provided that the antisense strand and the gene are at least 85% complementary (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary) over a core stretch sequence of at least 16 contiguous nucleotides. As demonstrated by the examples disclosed herein, among other things, the specific binding site of the antisense strand of a HIF-2 α RNAi agent to the gene (e.g., whether the HIF-2 α RNAi agent is designed to target the HIF-2 α (EPAS1) gene at position 5033 or at some other position) is important to the level of inhibition achieved by the HIF-2 α RNAi agent.

The described HIF-2 α RNAi agents can mediate RNA interference to inhibit expression of one or more genes necessary for the production of HIF-2 α protein. HIF-2 α RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including ccRCC. In addition, compositions for delivering HIF-2 α RNAi agents to ccRCC cells in vivo are described.

Pharmaceutical compositions comprising one or more HIF-2 α RNAi agents can be administered in a number of ways, depending on whether local or systemic treatment is desired. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In certain embodiments, the pharmaceutical compositions described herein are administered by intravenous infusion or injection.

In certain embodiments, a composition described herein comprising one or more HIF-2 α RNAi agents is packaged in a kit, container, pack, dispenser, pre-filled syringe, infusion bag, or vial. In certain embodiments, the compositions described herein are administered parenterally.

Each HIF-2 α RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand may each be 16-30 nucleotides in length. The sense strand and the antisense strand may be the same length, or they may be different lengths. In certain embodiments, the sense strand and antisense strand are each independently 17-27 nucleotides in length. In certain embodiments, the sense strand and antisense strand are each independently 17-21 nucleotides in length. In certain embodiments, the sense strand and antisense strand are each 21-26 nucleotides in length. In certain embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In certain embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In certain embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In certain embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In certain embodiments, the sense strand and antisense strand are each 21 nucleotides in length. In certain embodiments, the RNAi agent sense strand and antisense strand are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In certain embodiments, the double stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

In certain embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is present at or near the 5 'terminus of the antisense strand (e.g., the region may be separated from the 5' terminus of the antisense strand by 0, 1, 2, 3, or 4 nucleotides, which are not perfectly, substantially, or partially complementary).

The sense strand and antisense strand each contain a core segment (also referred to herein as a "core sequence" or "core segment sequence") of 16-23 nucleotides in length. The core segment of the antisense strand has 100% (perfect) complementarity or at least about 85% (substantial) complementarity to a nucleotide sequence (sometimes referred to as, e.g., a target sequence) present in the HIF-2 α (EPAS1) mRNA target. The sense strand core sequence has 100% (perfect) complementarity or at least about 85% (substantial) complementarity to the core sequence in the antisense strand, and thus the sense strand core sequence typically has perfect identity or at least about 85% identity to a nucleotide sequence (target sequence) present in the HIF-2 α mRNA target. The sense strand core segment sequence may be the same length as the corresponding antisense core sequence, or it may be a different length. In certain embodiments, the antisense strand core segment sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In certain embodiments, the sense strand core segment sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

Examples of nucleotide sequences useful for forming HIF-2. alpha. RNAi agents are provided in tables 2, 3, and 4 (as well as 4.1, 4.2, and 4.3). Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in tables 2, 3 and 4 are shown in table 5.

The HIF-2. alpha. RNAi agent sense and antisense strands anneal to form a duplex. The sense and antisense strands of a HIF-2. alpha. RNAi agent can be partially complementary, substantially complementary, or fully complementary to each other. Within the complementary duplex region, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In certain embodiments, a sense strand core segment sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of an antisense strand core segment sequence (e.g., the sense and antisense core segment sequences of a HIF-2 α RNAi agent can have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base paired or 100% base paired).

In certain embodiments, the antisense strand of a HIF-2 α RNAi agent disclosed herein differs from any of the antisense strand sequences in table 2 or table 3 by 0, 1, 2, or 3 nucleotides. In certain embodiments, the sense strand of a HIF-2 α RNAi agent disclosed herein differs from any of the sense strand sequences in table 2 or table 4, 4.1, 4.2, or 4.3 by 0, 1, 2, or 3 nucleotides.

The sense strand and/or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (stretches) at the 3 'end, 5' end, or both the 3 'and 5' ends of the core stretch sequence. The antisense strand may or may not be complementary to the corresponding sequence in the HIF-2. alpha. mRNA, if present. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the HIF-2. alpha. mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

An extension as used herein comprises 1, 2, 3, 4, 5 or 6 nucleotides at the 5 'and/or 3' end of the sense strand core segment sequence and/or the antisense strand core segment sequence. The stretch of nucleotides on the sense strand may or may not be complementary to the nucleotides (core stretch sequence nucleotides or stretch nucleotides) in the corresponding antisense strand. Conversely, the stretch nucleotides on the antisense strand may or may not be complementary to the nucleotides (core stretch nucleotides or stretch nucleotides) in the corresponding sense strand. In certain embodiments, the sense strand and antisense strand of the RNAi agent contain 3 'and 5' stretches. In certain embodiments, one or more of the 3 'stretch nucleotides of one strand base pair with one or more of the 5' stretch nucleotides of the other strand. In other embodiments, one or more of the 3 'stretch nucleotides of one strand do not base pair with one or more of the 5' stretch nucleotides of the other strand. In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand having a 3 'extension and a sense strand having a 5' extension. In certain embodiments, the stretches of nucleotides are unpaired and form overhangs. As used herein, an "overhang" refers to a segment of one or more unpaired nucleotides located at the terminal end of a sense strand or antisense strand that does not form part of the hybridizing or double-stranded portion of an RNAi agent disclosed herein.

In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand having a 3' stretch of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, a HIF-2 α RNAi agent comprises an antisense strand having a 3' stretch of 1, 2, or 3 nucleotides in length. In certain embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to a corresponding HIF-2 α mRNA sequence. In certain embodiments, one or more of the antisense strand extension nucleotides comprise a nucleotide that is not complementary to a corresponding HIF-2 α mRNA sequence.

In certain embodiments, the 5 'and/or 3' end of the antisense strand may include an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide. An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety (see, e.g., U.S. patent No. 5,998,203, which is incorporated herein by reference). In certain embodiments, the abasic residue may be located within the nucleotide sequence. In certain embodiments, an Ab or AbAb may be added to the 3' terminus of the antisense strand. In certain embodiments, the 5' terminus of the sense strand may comprise one or more additional abasic residues (e.g., (Ab) or (AbAb)). In certain embodiments, a UUAb, UAb, or Ab may be added to the 3' end of the sense strand. In certain embodiments, an abasic (deoxyribose) residue may be replaced with a ribitol (abasic ribose) residue.

In certain embodiments, the sense strand or the antisense strand may comprise a "terminal cap," which as used herein is a non-nucleotide compound or other moiety that may be incorporated at one or more ends of a strand of an RNAi agent disclosed hereinAnd in some cases may provide certain beneficial properties to the RNAi agent, e.g., protection from exonuclease degradation. In certain embodiments, an inverted abab residue (invAb) is added as an end cap (see table 7). (see, e.g., f. czauderna, Nucleic Acids res, 2003,31(11), 2705-16). Terminal caps are generally known in the art and include, for example, inverted abasic residues and carbon chains such as terminal C₃H₇(propyl group), C₆H₁₃(hexyl) or C₁₂H₂₅(dodecyl) group. In certain embodiments, a terminal cap is present at the 5 'terminal end, the 3' terminal end, or both the 5 'and 3' terminal ends of the sense strand. In certain embodiments, the 3' terminus of the sense strand may comprise additional abasic residues or an inverted abasic end cap.

In certain embodiments, one or more inverted abasic residues (invAb) are added to the 3' terminus of the sense strand. In certain embodiments, one or more inverted abasic residues (invAb) are added to the 5' terminus of the sense strand. In certain embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the nucleotide sequence of the sense strand of the RNAi agent and the targeting ligand. In certain embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more terminal ends of the sense strand of an RNAi agent allows for enhancement of the activity or other desired property of the RNAi agent.

In certain embodiments, one or more inverted abasic residues (invAb) are added to the 5' terminus of the sense strand. In certain embodiments, one or more inverted abasic residues may be inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. In certain embodiments, the inclusion of one or more inverted abasic residues at or near one or more terminal ends of a sense strand of an RNAi agent may allow for enhancement of the activity or other desired property of the RNAi agent. In certain embodiments, an inverted abasic (deoxyribose) residue may be replaced with an inverted ribitol (abasic ribose) residue.

In certain embodiments, the 3 'end of the antisense strand core segment sequence or the 3' end of the antisense strand sequence may include an inverted abab residue (invAb (see table 7)).

In certain embodiments, a HIF-2 α RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In certain embodiments, one or more of the sense strand extension nucleotides comprise an adenosine, uracil or thymidine nucleotide, an AT dinucleotide, or a nucleotide corresponding to or identical to a nucleotide in a HIF-2 α mRNA sequence. In certain embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited thereto: t, UT, TT, UU, UUT, TTT, or TTTT (each listed 5 'to 3').

In certain embodiments, a HIF-2 α RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In certain embodiments, one or more of the sense strand extension nucleotides comprise nucleotides corresponding to or identical to nucleotides in a HIF-2 α mRNA sequence. In certain embodiments, the sense strand 5' extension is one of the following sequences, but is not limited to: CA. AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5 'to 3'). The sense strand may have a 3 'stretch and/or a 5' stretch.

Examples of sequences used to form HIF-2 α RNAi agents are provided in tables 2, 3 and 4, 4.1, 4.2, and 4.3. In certain embodiments, the HIF-2 α RNAi agent antisense strand comprises a sequence of any one of the sequences in tables 2 or 3. In certain embodiments, the HIF-2 α RNAi agent antisense strand comprises or consists of a modified sequence of any one of table 3. In certain embodiments, a HIF-2. alpha. RNAi agent antisense strand comprises a sequence of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any one of the sequences in Table 2 or 3 (from 5 'terminus → 3' terminus). In certain embodiments, a HIF-2 α RNAi agent sense strand comprises a sequence of any one of the sequences in tables 2 or 4. In certain embodiments, a sense strand of a HIF-2. alpha. RNAi agent includes a sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any one of the sequences of Table 2 or 4 (from 5 'terminus → 3' terminus). In certain embodiments, a HIF-2 α RNAi agent sense strand comprises or consists of a modified sequence of any one of tables 4, 4.1, 4.2, or 4.3.

In certain embodiments, the sense strand and the antisense strand of an RNAi agent described herein contain the same number of nucleotides. In certain embodiments, the sense strand and antisense strand of an RNAi agent described herein contain a different number of nucleotides. In certain embodiments, the 5 'end of the sense strand and the 3' end of the antisense strand of the RNAi agent form blunt ends. In certain embodiments, the 3 'end of the sense strand and the 5' end of the antisense strand of the RNAi agent form blunt ends. In certain embodiments, both ends of the RNAi agent form blunt ends. In certain embodiments, neither end of the RNAi agent is blunt-ended. As used herein, "blunt-ended end" refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealing strands are complementary (forming complementary base pairs).

In certain embodiments, the 5 'end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a flanged end. In certain embodiments, the 3 'end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a nicked terminus. In certain embodiments, both ends of the RNAi agent form a flipped end. In certain embodiments, neither end of the RNAi agent is a flipped end. As used herein, a flipped end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealing strands form a pair (do not form an overhang), but are not complementary (form a non-complementary pair). In certain embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. Unpaired nucleotides can be on the sense or antisense strand, creating a 3 'or 5' overhang. In certain embodiments, the RNAi agent comprises: a blunt end and a rabbeted end, a blunt end and a 5 'protruding end, a blunt end and a 3' protruding end, a rabbeted end and a 5 'protruding end, a rabbeted end and a 3' protruding end, two 5 'protruding ends, two 3' protruding ends, a 5 'protruding end and a 3' protruding end, two rabbeted ends, or two blunt ends. Typically, when present, the overhang is located at the 3' terminal end of the sense strand, the antisense strand, or both the sense and antisense strands.

When used in different polynucleotide or oligonucleotide constructs, the modified nucleotides can retain the activity of the compounds in the cell while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the polynucleotide or oligonucleotide construct.

In certain embodiments, a HIF-2 α RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In certain embodiments, the HIF-2 α RNAi agent is prepared as a sodium salt. Such forms, which are well known in the art, are within the scope of the invention disclosed herein.

Definition of

The terms "oligonucleotide" and "polynucleotide" as used herein refer to a polymer of linked nucleosides, each of which may be independently modified or unmodified.

As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrading or inhibiting under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. The RNAi agents used herein may function as follows: by RNA interference mechanisms (e.g., RNA interference is induced by interaction with an RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of the mammalian cell), or by alternative mechanisms or pathways. Although it is believed that RNAi agents, as the term is used herein, act primarily through the mechanism of RNA interference, the disclosed RNAi agents are not constrained or limited by any particular pathway or mechanism of action. RNAi agents disclosed herein comprise a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering rnas (sirnas), double-stranded rnas (dsrnas), micrornas (mirnas), short hairpin rnas (shrnas), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the mRNA being targeted (HIF-2 α mRNA). The RNAi agent can include one or more modified nucleotides and/or one or more non-phosphodiester linkages.

The terms "silence," "decrease," "inhibit," "down-regulation," or "knock-down," as used herein, when referring to the expression of a given gene, means that the expression of the gene is decreased when the cell, collection of cells, tissue, organ, or subject is treated with an RNAi agent described herein, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in the cell, collection of cells, tissue, organ, or subject in which the gene is transcribed, as compared to a second cell, collection of cells, tissue, organ, or subject not so treated.

The terms "sequence" and "nucleotide sequence" as used herein refer to a series or order of nucleobases or nucleotides described by consecutive letters using standard nomenclature.

As used herein, a "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide and includes the primary purine bases adenine and guanine as well as the primary pyrimidine bases cytosine, thymine and uracil. Nucleobases can be further Modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases (see, e.g., Modified nucleotides in Biochemistry, Biotechnology and Medicine, Herdewijn, p. eds Wiley-VCH, 2008). The synthesis of such modified nucleobases, including phosphoramidite compounds comprising modified nucleobases, is known in the art.

As used herein and unless otherwise specified, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeted mRNA) relative to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) to an oligonucleotide or polynucleotide comprising the second nucleotide sequence and form a duplex or duplex structure under certain standard conditions. The complementary sequence comprises a Watson-Crick base pair or a non-Watson-Crick base pair and comprises a natural or modified nucleotide or nucleotide mimic, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is not relevant for the modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to a for the purpose of determining identity or complementarity.

As used herein, "perfectly complementary" or "fully complementary" means that, in a hybridization pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a portion of the first or second nucleotide sequence.

As used herein, "partially complementary" means that, in a hybridizing pair of nucleobase or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a portion of the first or second nucleotide sequence.

As used herein, "substantially complementary" means that at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in a contiguous sequence of a second oligonucleotide in a hybridizing pair of nucleobase or nucleotide sequence molecules. The contiguous sequence may comprise all or a portion of the first or second nucleotide sequence.

As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used with respect to nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent or between the antisense strand of an RNAi agent and the sequence of an HIF-2 α (EPAS1) mRNA.

The term "substantially identical" or "substantially identical" as applied to nucleic acid sequences as used herein means that the nucleotide sequence (or a portion of the nucleotide sequence) has at least about 85% sequence identity or greater, e.g., at least 90%, at least 95%, or at least 99% identity, as compared to a reference sequence. The percentage of sequence identity is determined by comparing the two optimally aligned sequences over a comparison window. The percentages are calculated as follows: determining the number of positions at which the same type of nucleobase occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

As used herein, the terms "treat," "treating," and the like refer to a method or step used to provide relief or reduction in the number, severity, and/or frequency of one or more symptoms of a disease in a subject. As used herein, "treating" and "treatment" may include prophylactic treatment, management, prophylactic treatment, and/or inhibition or reduction in the number, severity, and/or frequency of one or more symptoms of a disease in a subject.

When referring to an RNAi agent, the phrase "introduced into a cell" as used herein refers to the functional delivery of the RNAi agent into the cell. The phrase "functional delivery" refers to the delivery of an RNAi agent to a cell in a manner such that the RNAi agent possesses the desired biological activity (e.g., sequence-specific inhibition of gene expression).

The term "isomer" as used herein denotes a compound that: they have the same molecular formula but differ in the bonding nature or order of their atoms or their arrangement in space. Isomers whose atoms are arranged differently in space are referred to as "stereoisomers". Stereoisomers that are not mirror images of each other are referred to as "diastereomers", and stereoisomers that are non-superimposable mirror images are referred to as "enantiomers" or sometimes optical isomers. The carbon atom bonded to 4 different substituents is called a "chiral center".

As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which an asymmetric center is present and thus an enantiomer, diastereomer, or other stereoisomeric configuration results, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

The phrase "consisting of … …" as used in the claims herein does not include any elements, steps or ingredients not specified in the claims. As used in the claims herein, the phrase "consisting essentially of … …" limits the scope of the claims to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

One of ordinary skill in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is located. Thus, as used herein, the structures disclosed herein contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. As will be readily understood by one of ordinary skill in the art, the disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (such as pH).

The term "link" or "conjugation" as used herein when referring to a link between two compounds or molecules means that the two molecules are bound by a covalent bond or by a non-covalent bond (e.g., hydrogen or ionic bonds). In certain embodiments, wherein the term "linked" or "conjugated" denotes a binding between two molecules by a non-covalent bond, the binding between two different molecules has less than 1x10 in a physiologically acceptable buffer (e.g., buffered saline)^-4M (e.g., less than 1x10^-5M, less than 1x10^-6M or less than 1x10^-7K of M)_D. The terms "linked" and "conjugated" as used herein, unless otherwise specified, may mean with or without any intervening atoms or groups of atomsThe first compound and the second compound.

A linking group, as used herein, is one or more atoms that link one molecule or portion of a molecule to a second molecule or second portion of a molecule. Similarly, as used in the art, the term scaffold is sometimes used interchangeably with linking group. The linking group may comprise any number of atoms or functional groups. In certain embodiments, the linking group may not promote any biological or drug response, but is merely used to link two biologically active molecules.

Unless otherwise indicated, the symbols used hereinBy use of (a) is meant that any one or more groups according to the scope of the invention described herein may be attached thereto.

The term "including" as used herein is used herein to mean, and is used interchangeably with, the phrase "including, but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless the context clearly dictates otherwise.

As used in the claims herein, the phrase "consisting of … …" does not include any elements, steps, or ingredients not specified in the claims. As used in the claims herein, the phrase "consisting essentially of … …" limits the scope of the claims to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

Modified nucleotides

In certain embodiments, a HIF-2 α RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2' -hydroxynucleotide). In certain embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. Modified nucleotides as used herein may include, but are not limited to: deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2 '-modified nucleotides, inverted nucleotides, nucleotides comprising a modified nucleobase, bridged nucleotides, Peptide Nucleic Acids (PNA), 2', 3 '-open-loop nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3' -O-methoxy (2 'internucleoside linked) nucleotides, 2' -F-arabinonucleotides, 5'-Me, 2' -fluoro nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides and cyclopropyl phosphonate containing nucleotides. 2 '-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to: 2 '-O-methyl nucleotides, 2' -fluoro nucleotides (also referred to herein as 2 '-deoxy-2' -fluoro nucleotides), 2 '-deoxy nucleotides, 2' -methoxyethyl (2 '-O-2-methoxyethyl) nucleotides (also referred to as 2' -MOE), 2 '-amino nucleotides, and 2' -alkyl nucleotides. All positions in a given compound are not necessarily uniformly modified. Conversely, more than one modification may be incorporated in a single HIF-2. alpha. RNAi agent or even in a single nucleotide thereof. The sense and antisense strands of a HIF-2 α RNAi agent can be synthesized and/or modified by methods known in the art. The modification at one nucleotide is independent of the modification at another nucleotide.

Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-N-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-N-butyl) derivatives of adenine and guanine, and other alkyl derivatives, 2-Thiourea, 2-Thiocyytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azacytosine, 6-azothymine, 5-uracil (pseudouracil), 4-Thiourea, 8-halo, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

In certain embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is one that has four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands that are ribonucleotides (unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand that are unmodified ribonucleotides. In certain embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides.

As mentioned elsewhere herein, in certain embodiments, a HIF-2 α RNAi agent disclosed herein can be linked to one or more targeting ligands and/or one or more PK enhancers on internal nucleotides of a sense strand or an antisense strand of the RNAi agent to facilitate in vivo delivery of the HIF-2 α RNAi agent. In certain embodiments, the targeting ligand or PK enhancer is linked or conjugated to one or more internal nucleotides of the sense strand of the HIF-2 α RNAi agent. For example, the targeting ligand may be attached to a single nucleotide at the 2 ' position of the ribose ring, the 3 ' position of the ribose ring, the 1 ' position of the ribose ring, or to the nucleobase of the nucleotide, the 4 ' position of the ribose ring, the 5 ' position of the nucleotide, or to an oxygen atom on the ribose ring. One putative ribonucleotide is depicted below, wherein the carbons are numbered:

In certain embodiments, to facilitate attachment of one or more targeting ligands to internal nucleotides, 2' -O-propargyl modified nucleotides are incorporated into the nucleotide sequences (see, e.g., table 7 and tables 4, 4.1, 4.2, and 4.3). After synthesis of each strand, the 2 '-O-propargyl modified nucleotides can be linked or conjugated to a targeting ligand, targeting group, and/or PK enhancer at the 2' position using standard coupling techniques known in the art.

In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized to have at least one 2' -O-propargyl modified nucleotide in the sense strand to facilitate attachment to a targeting ligand or targeting group. In certain embodiments, the sense strand of the RNAi agent is synthesized to include at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more than 10 2' -O-propargyl modified nucleotides to facilitate linkage of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more than 10 targeting ligands and/or targeting groups to internal nucleotides. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized having a 2' -O-propargyl modified nucleotide in the sense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized with 2' -O-propargyl modified nucleotides in the sense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized with 3 2' -O-propargyl modified nucleotides in the sense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized with 4 nucleotides with 2' -O-propargyl modifications in the sense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized with 5 2' -O-propargyl modified nucleotides in the sense strand. In certain embodiments, HIF-2 α RNAi agents disclosed herein can be synthesized with more than 5 2' -O-propargyl modified nucleotides in the sense strand.

Modified internucleoside linkages

In certain embodiments, one or more nucleotides of a HIF-2 α RNAi agent are linked by a non-standard bond or backbone (e.g., a modified internucleoside linkage or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to: phosphorothioate groups (denoted herein by the lower case letter "s"), chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3 '-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3' -phosphoramidate, aminoalkyl phosphoramidate, or thionocarbamate), thionochloroalkyl-phosphonates, thionochlorophosphotriesters, morpholino linkages, boranophosphates having normal 3 '-5' linkages, 2 '-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity, wherein pairs of adjacent nucleoside units are linked 3 '-5' to 5 '-3' or 2 '-5' to 5 '-2'. In certain embodiments, the modified internucleoside linkages or backbones lack a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short chain heteroatom or heterocyclic intersugar linkages. In certain embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, methylacetoyl and thiometaoyl backbones, methylene methylacetoyl and thiometaoyl backbones, olefin containing backbones, sulfamate backbones, methylene imino and methylene hydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others having mixed N, O, S and CH ₂The backbone of the component.

In certain embodiments, the sense strand of a HIF-2. alpha. RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a HIF-2. alpha. RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense and antisense strands can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In certain embodiments, the sense strand of a HIF-2. alpha. RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a HIF-2. alpha. RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense and antisense strands can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

In certain embodiments, the sense strand of a HIF-2 α RNAi agent comprises at least 2 phosphorothioate internucleoside linkages. In certain embodiments, the at least 2 phosphorothioate internucleoside linkages are between the nucleotides from 1 to 3 positions from the 3' terminus of the sense strand. In certain embodiments, one phosphorothioate internucleoside linkage is located at the 5 'terminus of the sense strand and another phosphorothioate linkage is located at the 3' terminus of the sense strand. In certain embodiments, two phosphorothioate internucleoside linkages are located at the 5 'end of the sense strand and another phosphorothioate linkage is located at the 3' end of the sense strand. In certain embodiments, the sense strand does not include any phosphorothioate internucleoside linkages between nucleotides, but contains 1, 2, or 3 phosphorothioate linkages between the terminal nucleotides on the 5 'and 3' termini, and optionally an inverted abasic residue end cap. In certain embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate bond.

In certain embodiments, the HIF-2. alpha. RNAi agent antisense strand comprises 4 phosphorothioate internucleoside linkages. In certain embodiments, the 4 phosphorothioate internucleoside linkages are between the nucleotides from 1 to 3 from the 5 'terminus of the antisense strand, and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25 or 24-26 from the 5' terminus. In certain embodiments, the 3 phosphorothioate internucleoside linkages are between positions 1 to 4 from the 5 'terminus of the antisense strand and the fourth phosphorothioate internucleoside linkage is between positions 20 to 21 from the 5' terminus of the antisense strand. In certain embodiments, a HIF-2 α RNAi agent comprises at least 3 or 4 phosphorothioate internucleoside linkages in the antisense strand.

In certain embodiments, a HIF-2 α RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In certain embodiments, the 2' -modified nucleoside is combined with a modified internucleoside linkage.

HIF-2 alpha RNAi agents

In certain embodiments, the HIF-2 α RNAi agents disclosed herein target the HIF-2 α gene at or near the position of the HIF-2 α gene sequences shown in Table 1. In certain embodiments, the antisense strand of a HIF-2 α RNAi agent disclosed herein comprises a core sequence that is fully, substantially, or at least partially complementary to a target HIF-2 α 19-mer sequence disclosed in table 1.

TABLE 1 HIF-2 α 19-mer mRNA target sequence (taken from homo sapiens endothelial PAS domain protein 1(EPAS1 or HIF-2 α) transcript, GenBank NM-001430.4 (SEQ ID NO:1))

In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand, wherein position 19 of the antisense strand (5 '→ 3') is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in table 1. In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand, wherein position 1 of the antisense strand (5 '→ 3') is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in table 1.

In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand, wherein position 2 of the antisense strand (5 '→ 3') is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in table 1. In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand, wherein positions 2 to 18 of the antisense strand (5 '→ 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 to 2 of the 19-mer target sequences disclosed in table 1.

For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) may be fully complementary to the HIF-2 α gene, or may be non-complementary to the HIF-2 α gene. In certain embodiments, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) is U, A or dT. In certain embodiments, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) forms an a: U or U: a base pair with the sense strand.

In certain embodiments, a HIF-2. alpha. RNAi agent antisense strand comprises the sequence of nucleotides (from 5 'terminus → 3' terminus) 2-18 or 2-19 of any of the antisense strand sequences of Table 2 or Table 3. In certain embodiments, a HIF-2 α RNAi sense strand comprises the sequence of nucleotides (from 5 'terminus → 3' terminus) 1-17, 1-18, or 2-18 of the sense strand sequence of table 2 or any of tables 4, 4.1, 4.2, or 4.3.

In certain embodiments, a HIF-2 α RNAi agent comprises: (i) an antisense strand comprising the sequence of nucleotides (from 5 'terminus → 3' terminus) 2-18 or 2-19 of any one of the antisense strand sequences of table 2 or table 3; and (ii) a sense strand comprising the sequence of nucleotides (from 5 'terminus → 3' terminus) 1 to 17 or 1 to 18 of the sense strand sequence of table 2 or any one of tables 4, 4.1, 4.2 or 4.3.

In certain embodiments, the HIF-2 α RNAi agent comprises a core 19-mer nucleotide sequence set forth in Table 2 below.

The sense and antisense strands of a HIF-2 α RNAi agent comprising or consisting of the sequences in table 2 can be modified nucleotides or unmodified nucleotides. In certain embodiments, HIF-2 α RNAi agents having both sense and antisense strand sequences (which comprise or consist of the sequences in table 2) are both or substantially both modified nucleotides.

In certain embodiments, the antisense strand of a HIF-2 α RNAi agent disclosed herein differs from any of the antisense strand sequences in table 2 by 0, 1, 2, or 3 nucleotides. In certain embodiments, the sense strand of a HIF-2 α RNAi agent disclosed herein differs from any one of the sense strand sequences in table 2 by 0, 1, 2, or 3 nucleotides.

As used herein, each N listed in the sequences disclosed in table 2 may be independently selected from any and all nucleobases (including those found on modified and unmodified nucleotides). In certain embodiments, the N nucleotides listed in the sequences disclosed in table 2 have nucleobases complementary to the N nucleotides at the corresponding position on the other strand. In certain embodiments, the N nucleotides listed in the sequences disclosed in table 2 have nucleobases that are not complementary to the N nucleotides at the corresponding position on the other strand. In certain embodiments, the N nucleotides listed in the sequences disclosed in table 2 have the same nucleobase as the N nucleotide at the corresponding position on the other strand. In certain embodiments, the N nucleotides listed in the sequences disclosed in table 2 have a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

Certain modified HIF-2 α RNAi agent antisense strands, as well as the unmodified nucleobase sequences underlying them, are provided in table 3. Certain modified HIF-2 α RNAi agents sense strands, as well as their underlying unmodified nucleobase sequences, are provided in table 4 (and reflected in 4.1, 4.2, and 4.3). In forming the HIF-2 α RNAi agent, each nucleotide in each of the base sequences listed in tables 3 and 4 and table 2 above may be a modified nucleotide.

The HIF-2 α RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand comprising a sequence listed in table 2 or table 4, 4.1, 4.2, or 4.3 can hybridize to any antisense strand comprising a sequence listed in table 2 or table 3, provided that the two sequences have a region of at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

In certain embodiments, the HIF-2 α RNAi agent antisense strand comprises a nucleotide sequence of any one of the sequences in table 2 or table 3.

In certain embodiments, a HIF-2 a RNAi agent comprises or consists of a duplex having nucleobase sequences of the sense and antisense strands of any one of the sequences of table 2, table 3, or table 4, 4.1, 4.2, or 4.3.

Examples of antisense strands containing modified nucleotides are provided in table 3. Examples of sense strands containing modified nucleotides are provided in table 4.

As used in tables 3 and 4 and 4.1, 4.2 and 4.3, modified nucleotides, targeting groups and linking groups are indicated using the following notation:

a ═ adenosine-3' -phosphate;

c ═ cytidine-3' -phosphate;

g ═ guanosine-3' -phosphate;

u-uridine-3' -phosphate

I-inosine-3' -phosphate

a ═ 2 '-O-methyladenosine-3' -phosphate

as 2 '-O-methyladenosine-3' -phosphorothioate

c ═ 2 '-O-methylcytidine-3' -phosphate

cs ═ 2 '-O-methylcytidine-3' -phosphorothioate

2 '-O-methylguanosine-3' -phosphate

2 '-O-methylguanosine-3' -phosphorothioate

t ═ 2 '-O-methyl-5-methyluridine-3' -phosphate

ts ═ 2 '-O-methyl-5-methyluridine-3' -phosphorothioate

u ═ 2 '-O-methyluridine-3' -phosphate

us ═ 2 '-O-methyluridine-3' -phosphorothioate

2 '-O-methylinosine-3' -phosphate

is ═ 2 '-O-methylinosine-3' -phosphorothioate

Af 2 '-fluoroadenosine-3' -phosphate ester

Afs-2 '-fluoroadenosine-3' -phosphorothioate

2 '-Fluorocytidine-3' -phosphate

2 '-fluorocytidine-3' -thiophosphate in Cfs

2 '-fluoroguanosine-3' -phosphate

Gfs-2 '-fluoroguanosine-3' -phosphorothioate

Tf 2 ' -fluoro-5 ' -methyluridine-3 ' -phosphate

Tfs ═ 2 ' -fluoro-5 ' -methyluridine-3 ' -phosphorothioate

2 '-Fluorouridine-3' -phosphate

Ufs-2 '-fluorouridine-3' -thiophosphate

2 '-deoxyadenosine-3' -phosphate

dAs-2 '-deoxyadenosine-3' -phosphorothioate

dC ═ 2 '-deoxycytidine-3' -phosphate

dCs-2 '-deoxycytidine-3' -thiophosphate

2 '-deoxyguanosine-3' -phosphate

dGs-deoxyguanosine-3' -phosphorothioate

dT 2 '-deoxythymidine-3' -phosphate

dTs-2 '-deoxythymidine-3' -phosphorothioate

2 '-deoxyuridine-3' -phosphate

2 '-deoxyuridine-3' -thiophosphate for dUs

A_UNA2 ', 3 ' -seco-adenosyl-3 ' -phosphate

A_UNAs ═ 2 ', 3 ' -seco-adenosyl-3 ' -phosphorothioate

C_UNA2 ', 3 ' -Ring-opened Cytidine-3 ' -phosphate

C_UNAs ═ 2 ', 3 ' -ring-opened cytidine-3 ' -phosphorothioate

G_UNA2 ', 3 ' -Ring-opened-guanosine-3 ' -phosphate

G_UNAs ═ 2 ', 3 ' -ring-opened guanosine-3 ' -phosphorothioate

U_UNA2 ', 3 ' -Ring-opened-uridine-3 ' -phosphate

U_UNAs ═ 2 ', 3 ' -ring-opened uridine-3 ' -phosphorothioate

aAlk ═ 2 '-O-propargyladenosine-3' -phosphate, see table 7

aAlks ═ 2 '-O-propargyladenosine-3' -phosphorothioate, see table 7

(iv) cAlk ═ 2 '-O-propargylcytidine-3' -phosphate, see Table 7

2 '-O-propargylcytidine-3' -phosphorothioate, see Table 7

gAlk 2 '-O-propargylguanosine 3' -phosphate, see Table 7

gAlks ═ 2 '-O-propargylguanosine-3' -phosphorothioate, see Table 7

tALK ═ 2 '-O-propargyl-5-methyluridine-3' -phosphate, see Table 7

tip ═ 2 '-O-propargyl-5-methyluridine-3' -phosphorothioate, see table 7

uAlk ═ 2 '-O-propargyl uridine 3' -phosphate, see table 7

uAlks ═ 2 '-O-propargyl uridine-3' -phosphorothioate, see Table 7

See table 7 for a _2N ═ N

See table 7 for a _2Ns ═ c

(invAb) ═ inverted abasic deoxyribonucleotides, see Table 7

(invAb) s ═ inverted abasic deoxyribonucleotide-5' -phosphorothioate, see Table 7

s ═ phosphorothioate linkages

(C6-SS-Alk) ═ see Table 7

(C6-SS-C6) ═ see Table 7

(C3-SS-C3) ═ see Table 7

(6-SS-6) ═ see Table 7

(NH2-C6) ═ see Table 7

(C6-NH2) ═ see Table 7

(TriAlk #) -, see table 7

(TriAlk #) s ═ see table 7

As one of ordinary skill in the art will readily appreciate, nucleotide monomers, when present in an oligonucleotide, are interconnected by 5'-3' -phosphodiester linkages unless otherwise indicated by sequence (e.g., by phosphorothioate linkages "s"). As is clearly understood by one of ordinary skill in the art, the phosphorothioate linkages shown in the modified nucleotide sequences as disclosed herein replace the phosphodiester linkages typically present in oligonucleotides. Furthermore, one of ordinary skill in the art will readily appreciate that the terminal nucleotide at the 3 'end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of a given monomer rather than an ex vivo phosphate moiety. In addition, for the embodiments disclosed herein, when each strand is viewed 5'→ 3', inverted abasic is inserted such that the 3 'position of the deoxyribose sugar is attached to the 3' end of the preceding monomer on each strand. Furthermore, as is readily understood and appreciated by one of ordinary skill, while the phosphorothioate chemical structures described herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., wherein the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise specifically indicated herein, such understanding by one of ordinary skill in the art is used when describing the compositions of HIF-2. alpha. RNAi agents and HIF-2. alpha. RNAi agents disclosed herein.

Certain specific examples of linking groups for use with the HIF-2 α RNAi agents disclosed herein are provided in Table 7 below. Also disclosed herein are certain examples of targeting ligands and/or targeting groups and PK enhancers that may be linked or conjugated to the HIF-2 α RNAi agents disclosed herein. For example, certain example PK enhancing compounds are provided in table 6 below. Further, in certain embodiments, the PK enhancer may be located at the 3' terminal end of the sense strand of the HIF-2 α RNAi agent.

Linking groups include, but are not limited to, the following, whose chemical structures are provided in table 7 below: (NH-C), (C-NH), (C-SS-C), (6-SS-6), (TriAlk) s, (TriAlk) s or (TriAlk) s. Each sense strand and/or antisense strand may have any of the targeting ligands or targeting groups, linking groups, and/or PK enhancers listed herein conjugated to the 5 'and/or 3' end of the sequence, as well as other targeting ligands/groups, other linking groups, and/or other PK enhancers.

As shown in table 4 above, a number of example HIF-2 α nucleotide sequences are shown to further include a reactive linking group at the 5 'terminal end, the 3' terminal end, or both the 5 'and 3' terminal ends of the nucleotide sequence of the sense strand. For example, several HIF-2 α nucleotide sequences shown in Table 4 above have a (NH2-C6) linkage or a (TriAlk) linkage at the 5' end of the nucleotide sequence. Similarly, several HIF-2 α nucleotide sequences shown in Table 4 above have a (C6-SS-C6) or (6-SS-6) linking group at the 3' end of the nucleotide sequence. Such reactive linking groups are positioned to facilitate linkage of the targeting ligand, targeting group, and/or PK enhancer to the HIF-2 α RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and provide for the formation of a covalent bond between two molecules or reactants. Suitable conjugation reactions for use within the scope of the present invention herein include, but are not limited to, amide coupling reactions, michael addition reactions, hydrazone-forming reactions, and click chemistry cycloaddition reactions.

In certain embodiments, a targeting ligand may be synthesized as a Tetrafluorophenyl (TFP) ester, which may be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a HIF-2 α RNAi agent disclosed herein. In certain embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, by click chemistry cycloaddition reactions.

In addition, several nucleotide sequences were synthesized with a dT nucleotide at the 3 ' terminal end of the sense strand, followed by a (3 ' → 5 ') linker (e.g., C6-SS-C6), which in certain embodiments can be used to facilitate attachment to additional components (e.g., a PK enhancer or one or more targeting ligands) after cleavage from the resin. Synthesis performed in this manner involves attaching dT to the resin and then coupling the linker and the remaining nucleotides of the sense strand. As described herein, the terminal dT is cleaved from the molecule after conjugation to the desired PK enhancer (or targeting ligand). Table 4.1 below shows the nucleotide sequences identified in Table 4 above, but excluding the 3' terminal dT nucleotide.

In addition, table 4.2 below shows the nucleotide sequences identified in table 4 above, but without the presence of a terminal linking group.

As discussed herein, in certain embodiments, one or more targeting ligands and/or PK enhancing agents are linked or conjugated to an RNAi agent. In certain embodiments, a targeting ligand (or targeting group) and/or PK enhancer is linked to the 5 'terminus of the sense strand, the 3' terminus of the sense strand, and/or one or more internal nucleotides. Synthesis of the sense strand and/or antisense strand can be designed such that the reactive group is readily available to facilitate attachment to additional components, such as a targeting ligand or PK enhancer. Table 4.3 below depicts the sense strand of the HIF-2 α RNAi agents disclosed in table 4 above after ligation with one or more targeting ligands and/or PK enhancers (collectively shown below as Z).

TABLE 4.3 shows HIF-2. alpha RNAi agent sense strand sequences targeting ligand and/or PK enhancer sites

(X, Y and Z each independentlyIs a pharmacological moiety (e.g., targeting ligand, targeting group, and/or PK enhancer); (Z)₃Three ligands (e.g., tridentate targeting groups) attached; u. of^Z、a^Z、g^ZAnd c^ZRespectively represent uridine, adenosine, guanosine, and cytidine, wherein a pharmacological moiety (e.g., targeting ligand, targeting group, and/or PK enhancer) is attached to the 2 'position of the nucleotide (which ends up by coupling to 2' -O-propargyl for the HIF-2 α RNAi agents disclosed in the examples herein)

The HIF-2 α RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand comprising a sequence listed in table 2 or table 4 (or 4.1, 4.2, or 4.3) can hybridize to any antisense strand comprising a sequence listed in table 2 or table 3, provided that the two sequences have a region of at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences.

In certain embodiments, the antisense strand of a HIF-2 α RNAi agent disclosed herein differs from any of the antisense strand sequences in table 3 by 0, 1, 2, or 3 nucleotides. In certain embodiments, the sense strand of a HIF-2 α RNAi agent disclosed herein differs from any one of the sense strand sequences in table 4 by 0, 1, 2, or 3 nucleotides.

In certain embodiments, the HIF-2 α RNAi agent antisense strand comprises a nucleotide sequence of any one of the sequences in table 2 or table 3. In certain embodiments, a HIF-2. alpha. RNAi agent antisense strand comprises the sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any one of the sequences of Table 2 or Table 3 (from 5 'terminus → 3' terminus). In certain embodiments, a HIF-2 α RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in table 3.

In certain embodiments, a HIF-2 α RNAi agent sense strand comprises a nucleotide sequence of any one of the sequences in table 2 or table 4 (or table 4.1, 4.2, or 4.3). In certain embodiments, a HIF-2. alpha. RNAi agent sense strand comprises a sequence of nucleotides (from 5 'terminus → 3' terminus) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any one of the sequences of Table 2 or Table 4 (or Table 4.1, 4.2, or 4.3). In certain embodiments, the sense strand of a HIF-2 α RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in table 4 (or table 4.1, 4.2, or 4.3).

For the HIF-2 α RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) can be perfectly complementary to the HIF-2 α gene, or can be non-complementary to the HIF-2 α gene. In certain embodiments, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) is U, A or dT (or modified form thereof). In certain embodiments, the nucleotide at position 1 of the antisense strand (from 5 'terminus → 3' terminus) forms an a: U or U: a base pair with the sense strand.

In certain embodiments, a HIF-2. alpha. RNAi agent antisense strand comprises the sequence of nucleotides (from 5 'terminus → 3' terminus) 2-18 or 2-19 of any of the antisense strand sequences of Table 2 or Table 3. In certain embodiments, a HIF-2 α RNAi sense strand comprises a sequence from nucleotides (from 5 'terminus → 3' terminus) 1-17 or 1-18 of the sense strand sequence of any one of table 2 or table 4 (or table 4.1, 4.2, or 4.3).

In certain embodiments, a HIF-2 α RNAi agent comprises: (i) an antisense strand comprising the sequence of nucleotides (from 5 'terminus → 3' terminus) 2 to 18 or 2 to 19 of any one of the antisense strand sequences of table 2 or table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5 'terminus → 3' terminus) 1 to 17 or 1 to 18 of any one of the sense strand sequences of table 2 or table 4 (or table 4.1, 4.2 or 4.3).

A sense strand comprising a sequence listed in table 2 or table 4 may hybridize to any antisense strand comprising a sequence listed in table 2 or table 3, provided that the two sequences have a region of at least 85% complementarity over 16, 17, 18, 19, 20, or 21 consecutive nucleotide sequences. In certain embodiments, the HIF-2 α RNAi agent has a sense strand consisting of a modified sequence of any one of the modified sequences in table 4 (or table 4.1, 4.2, or 4.3), and an antisense strand consisting of a modified sequence of any one of the modified sequences in table 3. Some representative sequence pairings are exemplified by duplex ID nos. shown in table 5.

In certain embodiments, a HIF-2 α RNAi agent comprises, consists of, or consists essentially of a duplex represented by any of the duplex ID nos. presented herein. In certain embodiments, a HIF-2 α RNAi agent comprises the sense and antisense strand nucleotide sequences of any duplex represented by any of the duplex ID nos. presented herein. In certain embodiments, a HIF-2 a RNAi agent comprises the sense and antisense strand nucleotide sequences of any duplex represented by any of the duplex ID nos. presented herein and a targeting ligand, targeting group, and/or linking group, wherein the targeting ligand, targeting group, and/or linking group is covalently attached (conjugated) to the sense strand or the antisense strand. In certain embodiments, a HIF-2 α RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID nos. presented herein. In certain embodiments, a HIF-2 a RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any of the duplex ID nos. presented herein and a targeting ligand, targeting group, and/or linking group, wherein the targeting ligand, targeting group, and/or linking group is covalently attached to the sense strand or the antisense strand.

In certain embodiments, a HIF-2 a RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense strand/sense strand duplexes of table 2 or table 5, and further comprises a targeting group. In certain embodiments, a HIF-2 a RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense/sense strand duplexes of table 5, and further comprises an integrin receptor ligand targeting group.

In certain embodiments, a HIF-2 a RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense/sense strand duplexes of table 5, and further comprises one or more linking groups selected from: (NH-C), (C-NH), (C-SS-C), (6-SS-6), (TriAlk) s, (TriAlk) s or (TriAlk) s, each as defined in Table 7.

In certain embodiments, a HIF-2 α RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any one of the antisense and/or sense strand nucleotide sequences in table 3 or table 4, 4.1, 4.2, or 4.3.

In certain embodiments, a HIF-2 a RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense and/or sense strand nucleotide sequences of any of the duplexes in table 5, and further comprises an integrin targeting group.

In certain embodiments, a HIF-2 α RNAi agent comprises, consists of, or consists essentially of any one of the duplexes of table 5.

TABLE 5 HIF-2. alpha RNAi agent duplexes with corresponding sense and antisense strand ID numbering

In certain embodiments, HIF-2 α RNAi agents are prepared or provided as salts, mixed salts, or free acids, either before or after optional attachment or conjugation to one or more targeting ligands, targeting groups, and/or PK enhancers. Upon delivery to cells expressing HIF-2 α genes, the RNAi agents described herein inhibit or knock down the expression of one or more HIF-2 α genes in vivo and/or in vitro.

Targeting ligands and targeting groups

The targeting group or targeting moiety enhances the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent attached thereto to improve the cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. The targeting group may be monovalent, divalent, trivalent, tetravalent, or have a higher valence state for the target to which it is directed. Representative targeting groups include, but are not limited to: compounds having affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments and antibody mimetics having affinity for cell surface molecules. In certain embodiments, a targeting group is linked to an RNAi agent using a linker (such as a PEG linker) or one, two, or three abasic residues and/or ribitol (abasic ribose) residues, which may serve as linkers in some cases. In certain embodiments, the targeting group comprises an integrin targeting ligand.

In certain embodiments, the RNAi agents described herein are conjugated to a targeting group. In certain embodiments, the targeting ligand enhances the ability of the RNAi agent to bind to a specific cellular receptor on the target cell. In certain embodiments, a targeting ligand conjugated to an RNAi agent described herein has affinity for integrin receptors. In certain embodiments, suitable targeting ligands for use with the HIF-2 α RNAi agents disclosed herein have affinity for integrin α -v- β 3, integrin α -v- β 5, or both integrins.

In certain embodiments, a HIF-2 α RNAi agent disclosed herein is linked to one or more integrin targeting ligands, including compounds of the formula:

wherein the content of the first and second substances,

x is-C (R)³)₂-、-NR³-、

Y is an optionally substituted alkylene group having 1 to 8 carbon atoms in the alkylene chain;

z is O, NR³Or S;

R¹is optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted cycloalkyl, or R¹Comprising an RNAi agent;

R²is H, optionally substituted alkyl, or R²Comprising an RNAi agent;

R³each instance of (A) is independently selected from H and optionally substituted alkyl, or R ³Comprising an RNAi agent;

R⁴is H or optionally substituted alkyl; and is

Y, R therein¹、R²At least one of R³Any examples of (2) and R⁴Comprising an RNAi agent.

In certain embodiments, a HIF-2 α RNAi agent disclosed herein is linked to one or more integrin targeting ligands, which ligands comprise one of the following structures:

whereinIndicating the point of attachment to the HIF-2 α RNAi agent.

In certain embodiments, the targeting group is conjugated to the RNAi agent using a "click" chemistry reaction. In certain embodiments, the RNAi agent is functionalized with one or more alkyne-containing groups, and the targeting ligand comprises an azide-containing group. After reaction, the azide and alkyne form a triazole. An example reaction scheme is shown below:

wherein TL comprises a targeting ligand and RNA comprises an RNAi agent.

The HIF-2 α RNAi agent can comprise more than one targeting ligand. In certain embodiments, a HIF-2 α RNAi agent comprises 1-20 targeting ligands. In certain embodiments, a HIF-2 α RNAi agent comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 targeting ligands to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 targeting ligands.

In certain embodiments, a HIF-2 α RNAi agent comprises a targeting group that includes 2 or more targeting ligands. In certain embodiments, a targeting group may be conjugated to the 5 'or 3' terminus of the sense strand of a HIF-2 α RNAi agent. In certain embodiments, a targeting group may be conjugated to an internal nucleotide on the HIF-2RNAi agent. In certain embodiments, the targeting group may consist of 2 targeting ligands linked together, referred to as a "bidentate" targeting group. In certain embodiments, the targeting group may consist of 3 targeting ligands linked together, referred to as a "tridentate" targeting group. In certain embodiments, the targeting group may consist of 4 targeting ligands linked together, referred to as a "tetradentate" targeting group.

In certain embodiments, a HIF-2 α RNAi agent can comprise a targeting group conjugated to the 3 'or 5' terminus of the sense strand, and an additional targeting ligand conjugated to an internal nucleotide. In certain embodiments, a tridentate targeting group is conjugated to the 5' terminus of the sense strand of the HIF-2 α RNAi agent, and at least one targeting ligand is conjugated to an internal nucleotide of the sense strand. In other embodiments, a tridentate targeting group is conjugated to the 5' terminus of the sense strand of the HIF-2 α RNAi agent, and four targeting ligands are conjugated to the internal nucleotides of the sense strand. In certain embodiments, four targeting ligands are conjugated to the sense strand at nucleotide positions 2, 4, 6, and 8.

In certain embodiments, a HIF-2 α RNAi agent is linked to one or more targeting groups of the formula:

whereinIndicating the connection point. In certain embodiments, the point of attachment is the 5' end of the sense strand of the HIF-2 α RNAi agent.

Internally linked targeting ligands

Some embodiments of the HIF-2 α RNAi agents described herein include targeting ligands conjugated to internal nucleotides of the sense or antisense strand. In certain embodiments, up to 15 targeting ligands may be conjugated to an internal nucleotide of the sense strand of a HIF-2 α RNAi agent. In certain embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 targeting ligands may be conjugated to an internal nucleotide of the sense strand of a HIF-2 α RNAi agent. In certain embodiments, 1-5 (e.g., 1, 2, 3, 4, or 5) targeting ligands are conjugated to an internal nucleotide of the sense strand of a HIF-2 α RNAi agent. In certain embodiments, 3-4 targeting ligands are conjugated to an internal nucleotide of the sense strand of a HIF-2 α RNAi agent.

In certain embodiments, placement of an internal targeting ligand may affect the efficacy or potency of a HIF-2 α RNAi agent. In certain embodiments of the HIF-2 α RNAi agent, the targeting group is conjugated to the 5 'terminus of the sense strand, and at least 10 nucleotides are positioned between the tridentate targeting group located on the 5' terminus of the sense strand and the next nearest targeting ligand located on the sense strand. In certain embodiments, at least 5 nucleotides are positioned between the tridentate targeting group located on the 5' end of the sense strand and the next nearest-to-target ligand located on the sense strand.

In certain embodiments, wherein 2 or more targeting ligands are conjugated to an internal nucleotide located on the sense strand of the HIF-2 α RNAi agent, there is a space of at least one nucleotide that is not conjugated to a targeting ligand located between the 2 internal nucleotides conjugated to the targeting ligand. In certain embodiments, wherein 2 or more targeting ligands are conjugated to the sense strand of the HIF-2 α RNAi agent, at least 2 nucleotides not conjugated to the targeting ligand are positioned between the 2 internal nucleotides conjugated to the targeting ligand.

In certain embodiments, targeting ligands are conjugated to the 2, 4, and 6 nucleotides of the sense strand, numbered from 3 'to 5' starting with the most distal 3 'nucleotide that forms a base pair with the 5' terminal nucleotide on the antisense strand. In certain embodiments, the targeting ligand is conjugated to 2, 4, 6 and 8 nucleotides (3 '→ 5') beginning with the 3 'terminal nucleotide which forms a base pair with the 5' terminal nucleotide on the antisense strand.

Pharmacokinetic enhancer

In certain embodiments, a Pharmacokinetic (PK) enhancer is linked to a HIF-2 α RNAi agent disclosed herein to facilitate delivery of the RNAi agent to a desired cell or tissue. PK enhancing compounds with readily available reactive groups (such as maleimide or azido) can be synthesized to facilitate attachment to one or more linkers on the HIF-2 α RNAi agent. In certain embodiments, PK enhancers may be synthesized as maleimides and conjugated to RNAi agents using the reactions described herein. Other conjugation reactions such as "click" chemistry or amide conjugation may also be used.

In certain embodiments, PK enhancers may include molecules that: it is a fatty acid, lipid, albumin binder, antibody binder, polyester, polyacrylate, poly-amino acid, and has about 20-1000 ethylene oxide (CH)₂-CH₂-O) linear or branched polyethylene glycol (PEG) moieties of units.

In certain embodiments, a HIF-2RNAi agent is linked to a PK enhancer, comprising a compound having the structure of the formula:

wherein Y is an optionally substituted saturated or unsaturated aliphatic chain and n is an integer from 5 to 25.

In certain embodiments, a HIF-2RNAi agent is linked to a PK enhancer, comprising a compound having the structure:

in certain embodiments, a HIF-2RNAi agent is linked to a PK enhancer, comprising a compound having the structure:

table 6 below shows certain exemplary PK enhancing compounds that can be used as starting materials to link to the HIF-2 α RNAi agents disclosed herein. The PK enhancing compound may be added to the HIF-2 α RNAi agent using any method known in the art.

TABLE 6 exemplary PK enhancer compounds suitable for linking to HIF-2 α RNAi agents

In certain embodiments, a HIF-2 α RNAi agent may comprise one or more PK enhancers. In certain embodiments, a HIF-2 α RNAi agent comprises 1, 2, 3, 4, 5, 6, 7, or more PK enhancers.

The PK enhancer may be conjugated to the HIF-2 α RNAi agent using any method known in the art. In certain embodiments, the PK enhancer may comprise a maleimide moiety and react with the RNAi agent comprising a disulfide bond to form an RNAi agent comprising the PK enhancer. The disulfide may be reduced and added to the maleimide by a Michael-addition reaction. An example reaction scheme is shown below:

wherein PK comprises a PK enhancer, RNA comprises an RNAi agent, and R can be any suitable group known in the art. In some instances of the above reaction schemes, R is an alkyl group such as hexyl (C)₆H₁₃)。

In certain embodiments, a PK enhancer may comprise an azide moiety and react with an RNAi agent comprising an alkyne to form an RNAi agent comprising a PK enhancer. The pair can be reacted using a "click" reaction of the following general reaction scheme:

wherein the PK comprises the PK enhancer and the RNA comprises the RNAi agent.

In certain embodiments, the PK enhancer may be conjugated to the 5 'terminus of the sense or antisense strand, the 3' terminus of the sense or antisense strand, or internal nucleotides of the HIF-2 α RNAi agent. In certain embodiments, HIF-2 α RNAi agents having a disulfide-containing moiety at the 3 'terminus of the sense strand can be synthesized, and PK enhancers can be conjugated to the 3' terminus of the sense strand using the general synthetic protocols shown above. In certain embodiments, HIF-2 α RNAi agents are synthesized to include 2' -O-propargyl modified nucleotides (see, e.g., table 7), and PK enhancers can be conjugated to internal nucleotides using the general synthetic protocols shown above.

In certain embodiments, after the PK enhancing agent has been conjugated to the RNAi agent, the PK enhancing agent may have the formula:

whereinIndicating the point of attachment to the RNAi agent.

Linker and delivery vehicle

In certain embodiments, a HIF-2 α RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a linking group or a delivery vehicle. The non-nucleotide groups can enhance targeting, delivery, or attachment of RNAi agents. Non-limiting examples of linking groups are provided in table 7. The non-nucleotide groups may be covalently linked to the 3 'and/or 5' terminus of the sense strand and/or antisense strand. In certain embodiments, a HIF-2 α RNAi agent comprises a non-nucleotide moiety attached to the 3 'and/or 5' terminus of the sense strand. In certain embodiments, a non-nucleotide group is attached to the 5' terminus of the sense strand of a HIF-2 α RNAi agent. The non-nucleotide group may be directly or indirectly linked to the RNAi agent via a linker/linker. In certain embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

In certain embodiments, the non-nucleotide groups enhance the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which they are attached to improve the cell-or tissue-specific distribution and cell-specific uptake of the conjugate. In certain embodiments, the non-nucleotide groups enhance endocytosis of the RNAi agent.

HIF-2 α RNAi agents described herein can be synthesized with reactive groups such as amino groups (also referred to herein as amines) at the 5 '-end and/or 3' -end. The reactive group can then be used to attach a targeting moiety using methods typical in the art.

For example, in certain embodiments, the synthesis has an NH at the 5' -end of the sense strand of the RNAi agent₂-C₆Group of HIF-2. alpha. RNAi agents disclosed herein. The terminal amino groups can then be reacted to form conjugates, e.g., with groups comprising compounds having affinity for one or more integrins (integrin targeting ligands) or PK enhancers. In certain embodiments, a HIF-2 α RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5' -end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted to form a conjugate, for example, with a group comprising a targeting ligand.

In certain embodiments, the targeting group comprises an integrin targeting ligand. In certain embodiments, the integrin targeting ligand comprises a compound having affinity for integrin α -v- β 3 and/or integrin α -v- β 5. The use of integrin targeting ligands can facilitate cell-specific targeting to cells having various integrins on their respective surfaces, and the binding of an integrin targeting ligand can facilitate entry of its attached HIF-2 α RNAi agent into cells (such as ccRCC cells). Targeting ligands, targeting groups, and/or PK enhancers can be attached to the 3 'and/or 5' end of a HIF-2 a RNAi agent and/or internal nucleotides on the HIF-2 a RNAi agent using methods generally known in the art. The preparation of targeting ligands and targeting groups (such as integrin α v β 3/α v β 5) is described, for example, in U.S. provisional patent application No. 62/663,763, the contents of which are incorporated herein in their entirety.

Embodiments of the disclosure include pharmaceutical compositions for delivering HIF-2 α RNAi agents to ccRCC cells in vivo. Such pharmaceutical compositions can include, for example, HIF-2 α RNAi agents conjugated to a targeting group comprising an integrin targeting ligand having affinity for integrin α v β 3 and/or integrin α v β 5. In certain embodiments, the targeting ligand comprises a compound having affinity for integrin α v β 3 and/or integrin α v β 5.

In certain embodiments, a HIF-2 α RNAi agent is synthesized with a linking group that can then facilitate covalent attachment of the HIF-2 α RNAi agent to a targeting ligand, a targeting group, a PK enhancer, or another type of delivery vehicle (such as a delivery polymer). The linking group may be attached to the 3 'and/or 5' end of the sense strand or antisense strand of the RNAi agent. In certain embodiments, the linking group is attached to the sense strand of the RNAi agent. In certain embodiments, the linking group is conjugated to the 5 'or 3' terminus of the sense strand of the RNAi agent. In certain embodiments, the linking group is conjugated to the 5' terminus of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6 and C6-SS-Alk-Me, reactive groups such as primary and alkyne, alkyl, abasic residues/nucleotides, amino acids, trialkyne functionalized groups, ribitol, and/or PEG groups.

A linker or linking group is a connection between two atoms that connects one chemical group of interest (such as an RNAi agent) or segment to another chemical group of interest (such as a targeting ligand, targeting group, PK enhancer, or delivery polymer) or segment via one or more covalent bonds. The labile linkage contains a labile bond. The linkage may optionally include a spacer that increases the distance between two linked atoms. The spacer may further add flexibility and/or length to the connection. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl and aralkynyl; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides and sugars. Spacer groups are well known in the art and the foregoing list is not intended to limit the scope of the specification.

In certain embodiments, a targeting group is attached to a HIF-2 α RNAi agent without the use of an additional linker. In certain embodiments, targeting groups with linkers that are susceptible to presence are designed to facilitate ligation to HIF-2 α RNAi agents. In certain embodiments, when two or more RNAi agents are included in the composition, the same linker may be used to attach the two or more RNAi agents to their respective targeting groups. In certain embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.

Any of the HIF-2 α RNAi agent nucleotide sequences listed in tables 2, 3, and 4 (or tables 4.1, 4.2, or 4.3), whether modified or unmodified, can contain 3 'and/or 5' targeting groups, linking groups, and/or pharmacokinetic enhancers. Any of the HIF-2 α RNAi agent sequences listed in tables 3 and 4 or otherwise described herein that contain a 3 'or 5' targeting ligand, targeting group, PK enhancer, or linking group may alternatively not contain a 3 'or 5' targeting ligand, targeting group, linking group, or PK enhancer, or may contain a different 3 'or 5' targeting ligand, targeting group, linking group, or PK enhancer, including, but not limited to those shown in tables 6 and 7. Any of the HIF-2 a RNAi agent duplexes listed in table 5, whether modified or unmodified, may further comprise a targeting ligand, targeting group, linking group, or PK enhancer, including but not limited to those shown in tables 6 and 7, and the targeting group or linking group may be attached to the 3 'or 5' end of the sense or antisense strand of the HIF-2 a RNAi agent duplex.

In certain embodiments, a linking group can be synthetically conjugated to the 5 'or 3' terminus of the sense strand of a HIF-2 α RNAi agent described herein. In certain embodiments, a linking group is synthetically conjugated to the 5' terminus of the sense strand of the HIF-2 α RNAi agent. In certain embodiments, a linker conjugated to a HIF-2 α RNAi agent can be a trialkyne linker.

In certain embodiments, a HIF-2 α RNAi agent is linked to one or more tridentate targeting groups having the formula:

formula II

Wherein the content of the first and second substances,

L¹、L²and L³Each independently is a linker comprising an optionally substituted alkylene;

L⁴is a linker comprising an optionally substituted alkylene, an optionally substituted aryl, or an optionally substituted cycloalkyl;

R⁵is H or optionally substituted alkyl;

TL is a targeting ligand; and is

Y is O or S.

In other embodiments, the HIF-2 α RNAi agent is linked to one or more tridentate targeting groups using a linker having the formula of any of TriAlk 1-14 shown in table 7 below. Methods for synthesizing compounds of formula II are described in PCT application No. PCT/US19/18232 entitled "Trialkyne Linking Agents and Methods of Use".

Examples of certain modified nucleotides and linking groups are provided in table 7.

TABLE 7 structures representing various modified nucleotides and linking groups

In certain embodiments, the RNAi agent comprises a linker having the structure: TriAlk 14:

or TriAlk14 s:wherein TL comprises a targeting ligand which is the result of a "click" reaction of a compound of (TriAlk14) or (TriAlk14) s with a targeting ligand comprising an azide.

Alternatively, other linking groups known in the art may be used.

In addition to or alternatively to linking the HIF-2 α RNAi agent to one or more targeting ligands, targeting groups, and/or PK enhancers, in certain embodiments, a delivery vehicle may be used to deliver the RNAi agent to a cell or tissue. Delivery vehicles are compounds that can improve delivery of RNAi agents to cells or tissues, and can include, but are not limited to: a polymer (such as an amphiphilic polymer), a membrane active polymer, a peptide, melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

In certain embodiments, the RNAi agent can be combined with a lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO 2000/053722, WO 2008/022309, WO 2011/104169 and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

Pharmaceutical composition

In certain embodiments, the present disclosure provides pharmaceutical compositions comprising, consisting of, or consisting essentially of one or more of the HIF-2 α RNAi agents disclosed herein.

As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an Active Pharmaceutical Ingredient (API) and optionally one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the active pharmaceutical ingredient (API, therapeutic product) that are intentionally included in a drug delivery system. The excipient does not exert a therapeutic effect or is not intended to exert a therapeutic effect at the intended dose. Excipients may function as follows: a) facilitating processing of the drug delivery system during manufacture, b) protecting, supporting or enhancing stability, bioavailability or patient acceptability of the API, c) facilitating product identification, and/or d) enhancing any other attribute of the overall safety, effectiveness of API delivery during storage or use. The pharmaceutically acceptable excipient may or may not be an inert substance.

Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, dextrans, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

The pharmaceutical compositions described herein may contain other additional components typically present in pharmaceutical compositions. In certain embodiments, the additional component is a pharmaceutically active substance. Pharmaceutically active substances include, but are not limited to: anti-pruritic, astringent, local anesthetic or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.), small molecule drugs, antibodies, antibody fragments, aptamers, and/or vaccines.

The pharmaceutical compositions may also contain preserving agents, solubilising agents, stabilising agents, wetting agents, emulsifying agents, sweetening agents, colouring agents, flavouring agents, salts for varying the osmotic pressure, buffering agents, coating agents or antioxidants. They may also contain other agents with known therapeutic benefits.

The pharmaceutical composition may be administered in a variety of ways depending on whether local or systemic treatment is desired and the area to be treated. Administration can be by any means known in the art, such as, but not limited to, topical (e.g., by transdermal patch), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal), epidermal, transdermal, oral, or parenteral. Parenteral administration includes, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal (e.g., via an implanted device), intracranial, intraparenchymal, intrathecal, and intraventricular administration. In certain embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. The pharmaceutical compositions may be administered orally, for example in the form of tablets, coated tablets, dragees, hard or soft gelatine capsules, solutions, emulsions or suspensions. Rectal administration may also be carried out, for example using suppositories; topical or transdermal administration, e.g., using ointments, creams, gels or solutions; or parenterally, for example using injectable solutions.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ), or phosphate buffered saline. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared as follows: the active compound is incorporated in the required amount in an appropriate solvent with a combination of ingredients or combinations of ingredients as required with one of those enumerated above, followed by filter sterilization. Typically, the dispersion is prepared as follows: the active compound is incorporated into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Formulations suitable for intra-articular administration may be in the form of a sterile aqueous formulation of any of the ligands described herein, which may be in microcrystalline form, e.g., in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present any of the ligands described herein for intra-articular and ophthalmic administration.

The active compound can be prepared with carriers that will protect the compound from rapid elimination from the body, such as controlled release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions may also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

The pharmaceutical composition may contain other additional components that are common in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritic, astringent, local anesthetic, or anti-inflammatory agent (e.g., antihistamines, diphenhydramine, etc.). As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" means the amount of a pharmaceutically active agent that produces a pharmacological, therapeutic, or prophylactic result.

Medicaments comprising HIF-2 α RNAi agents are also an object of the invention, as are methods for making such medicaments, comprising bringing into pharmaceutically acceptable form one or more compounds comprising HIF-2 α RNAi agents and, if desired, one or more other substances of known therapeutic benefit.

The described HIF-2 α RNAi agents and pharmaceutical compositions disclosed herein comprising HIF-2 α RNAi agents can be packaged or included in a kit, container, pack, or dispenser. The HIF-2. alpha. RNAi agent and pharmaceutical compositions comprising the HIF-2. alpha. RNAi agent can be packaged in pre-filled syringes or vials.

Methods of treatment and inhibition of expression

The HIF-2 α RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In certain embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) who would benefit from a reduction and/or inhibition of expression of HIF-2 α mRNA and/or HIF-2 α (EPAS1) protein levels, for example, subjects who have been diagnosed with or are suffering from symptoms associated with cancer, kidney cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, herpesviruses associated with kaposi's sarcoma, preeclampsia, inflammation, chronic inflammation, neovascular disease, and rheumatoid arthritis.

In certain embodiments, a therapeutically effective amount of any one or more HIF-2 α RNAi agents is administered to a subject. Treatment of a subject may include therapeutic and/or prophylactic treatment. Administering to the subject a therapeutically effective amount of any one or more of the HIF-2 α RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child or infant. The pharmaceutical compositions described herein may be administered to a human or animal.

The HIF-2 α RNAi agents described herein can be used to treat at least one condition in a subject having a HIF-2 α -associated disease or disorder, or having a disease or disorder mediated at least in part by HIF-2 α gene expression. In certain embodiments, the HIF-2 α RNAi agent is used to treat or manage clinical manifestations in a subject having a disease or disorder that would benefit from or be mediated at least in part by a reduction in HIF-2 α mRNA. Administering to the subject a therapeutically effective amount of one or more of a HIF-2. alpha. RNAi agent or a composition comprising a HIF-2. alpha. RNAi agent described herein. In certain embodiments, the methods disclosed herein comprise administering to a subject to be treated a composition comprising a HIF-2 α RNAi agent described herein. In certain embodiments, a subject is administered a prophylactically effective amount of any one or more of the described HIF-2 α RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

In certain embodiments, the present disclosure provides methods of treating a disease, disorder, condition, or pathological state mediated at least in part by HIF-2 α gene expression in a patient in need thereof, wherein the methods comprise administering to the patient any of the HIF-2 α RNAi agents described herein.

In certain embodiments, the gene expression level and/or mRNA level of a HIF-2 α gene in a subject to which a described HIF-2 α RNAi agent is administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% as compared to the subject prior to administration of the HIF-2 α RNAi agent, or as compared to a subject not receiving the HIF-2 α RNAi agent. The level of gene expression and/or mRNA level in a subject may be reduced in a cell, collection of cells, and/or tissue of the subject.

In certain embodiments, HIF-2 α protein levels in a subject to which a described HIF-2 α RNAi agent has been administered are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% as compared to a subject prior to administration of the HIF-2 α RNAi agent, or as compared to a subject not receiving the HIF-2 α RNAi agent. Protein levels in a subject may be reduced in cells, cell collections, tissues, blood and/or other fluids of the subject.

Reduction of HIF-2 α mRNA levels and HIF-2 α protein levels can be assessed by any method known in the art. As used herein, a decrease or reduction in HIF-2 α mRNA levels and/or protein levels is collectively referred to herein as a decrease or reduction in HIF-2 α, or inhibition or reduction of expression of HIF-2 α. The examples set forth herein illustrate known methods for assessing inhibition of HIF-2 α gene expression.

In certain embodiments, HIF-2 α RNAi agents can be used to prepare pharmaceutical compositions for treating a disease, disorder, or condition mediated at least in part by HIF-2 α gene expression. In certain embodiments, the disease, disorder or condition mediated at least in part by HIF-2 α gene expression is cancer, kidney cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, kaposi's sarcoma-associated herpes virus, preeclampsia, inflammation, chronic inflammation, neovascular disease, or rheumatoid arthritis.

In certain embodiments, the method of treating a subject is dependent on the weight of the subject. In certain embodiments, a HIF-2. alpha. RNAi agent can be administered at a dose of about 3mg/kg to about 80mg/kg of subject body weight. In other embodiments, the HIF-2. alpha. RNAi agent can be administered at a dose of about 5mg/kg to about 20mg/kg of body weight of the subject.

In certain embodiments, a HIF-2 α RNAi agent can be administered in divided doses, meaning that 2 doses are administered to a subject in a short (e.g., less than 24 hours) time period. In certain embodiments, about half of the desired daily amount is administered in the initial administration and the remaining about half of the desired daily amount is administered about 4 hours after the initial administration.

In certain embodiments, the HIF-2 α RNAi agent can be administered 1 time per week (weekly). In other embodiments, the HIF-2. alpha. RNAi agent can be administered 1 time every 2 weeks (once every other week).

In certain embodiments, the dose of HIF-2 α RNAi agent administered is a fixed dose of 225mg administered weekly. In certain embodiments, the dose of HIF-2 α RNAi agent administered is a fixed dose of 525mg administered weekly. In certain embodiments, the dose of HIF-2 α RNAi agent administered is a fixed dose of 1,050mg administered weekly. In certain embodiments, the HIF-2 α RNAi agent is administered by intravenous infusion.

In certain embodiments, a HIF-2. alpha. RNAi agent or a composition comprising a HIF-2. alpha. RNAi agent can be used to treat a disease, disorder, or condition mediated, at least in part, by expression of a HIF-2. alpha. (EPAS1) gene. In certain embodiments, the disease, disorder, or condition mediated at least in part by HIF-2 α (EPAS1) gene expression is ccRCC.

Cells, tissues and non-human organisms

Cells, tissues, and non-human organisms are contemplated that include at least one of the HIF-2 α RNAi agents described herein. The HIF-2 α RNAi agent is delivered to a cell, tissue, or non-human organism by any means available in the art to prepare the cell, tissue, or non-human organism. In certain embodiments, the cell is a mammalian cell, including, but not limited to, a human cell.

The embodiments and items provided above are now illustrated by the following non-limiting examples.

Examples

The following examples are not limiting and are intended to illustrate certain embodiments disclosed herein.

Example 1 Synthesis of HIF-2. alpha. RNAi Agents and compositions containing HIF-2. alpha. RNAi agents.

The following describes general procedures for synthesizing certain HIF-2 α RNAi agents and conjugates thereof, which are exemplified in the non-limiting examples set forth herein.

RNAi agents can be synthesized using methods generally known in the art. With respect to the synthesis of RNAi agents exemplified in the examples set forth herein, the sense and antisense strands of the RNAi agents are synthesized according to phosphoramidite technology on a solid phase used in oligonucleotide synthesis. Depending on the scale, use(Bioautomation)、(Bioautomation) or Oligopilot 100(GE Healthcare). In the case of a glass made of controlled porosity glass (CPG,orObtained from Prime Synthesis, Aston, PA, USA) or polystyrene (obtained from Kinovate, Oceanside, CA, USA). All RNA and 2' -modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA), ChemGenes (Wilmington, MA, USA) or Hongnee Biotech (Morrisville, NC, USA). In particular, use is made ofThe following 2' -O-methylphosphorous acid amides include the following: (5' -O-dimethoxytrityl-N⁶- (benzoyl) -2 ' -O-methyl-adenosine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5 ' -O-dimethoxy-trityl-N⁴- (acetyl) -2 ' -O-methyl-cytidine-3 ' -O- (2-cyanoethyl-N, N-diisopropyl-amino) phosphoramidite, (5 ' -O-dimethoxytrityl-N ²- (isobutyryl) -2 ' -O-methyl-guanosine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5 ' -O-dimethoxytrityl-2 ' -O-methyl-uridine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite. 2 '-deoxy-2' -fluoro-phosphoramidites and 2 '-O-propargyl phosphoramidites bear the same protecting groups as 2' -O-methyl phosphoramidites. 5 ' -Dimethoxytrityl-2 ' -O-methyl-inosine-3 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3 ' -O-dimethoxytrityl-2 ' -deoxyribose-5 ' -O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidites UNA phosphoramidites available from ChemGenes include 5 ' - (4,4' -dimethoxytrityl) -N6- (benzoyl) -2 ', 3 ' -seco-adenosine, 2 ' -benzoyl-3 ' - [ (2-cyanoethyl) - (N, N-diisopropyl)]-phosphoramidite, 5 '- (4,4' -dimethoxytrityl) -N-acetyl-2 ', 3' -seco-cytosine, 2 '-benzoyl-3' - [ (2-cyanoethyl) - (N, N-diisopropyl)]Phosphoramidite, 5 '- (4,4' -dimethoxytrityl) -N-isobutyryl-2 ', 3' -seco-guanosine, 2 '-benzoyl-3' - [ (2-cyanoethyl) - (N, N-diisopropyl) ]Phosphoramidite and 5 '- (4,4' -dimethoxy-trityl) -2 ', 3' -seco-uridine, 2 '-benzoyl-3' - [ (2-cyanoethyl) - (N, N-diisopropyl)]-phosphoramidites. For the introduction of phosphorothioate bonds, a 100mM solution of 3-phenyl 1,2, 4-dithiazolin-5-one (POS, from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile OR a 200mM solution of xanthane hydride (TCI America, Portland, OR, USA) in pyridine was used.

Amino-linked phosphoramidites of TFA were also commercially available (ThermoFisher) to introduce (NH2-C6) reactive group linkers. Dissolving TFA amino-linked phosphoramidite in anhydrous EthaneNitrile (50mM) and molecular sieves added5-benzylthio-1H-tetrazole (BTT,250mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT,250mM in acetonitrile) is used as the activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2 'O-Me) and 60 seconds (2' F). Phosphoramidites containing trisalkynes were synthesized to introduce various (TriAlk #) linkers. When used in association with the RNAi agents presented in certain embodiments herein, the phosphoramidite containing trialkyne was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50mM), while all other amidites (amidites) were dissolved in anhydrous acetonitrile (50mM), and molecular sieves were added 5-benzylthio-1H-tetrazole (BTT,250mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT,250mM in acetonitrile) is used as the activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2 'O-Me) and 60 seconds (2' F).

For certain RNAi agents, a linker such as a C6-SS-C6 or 6-SS-6 group is introduced at the 3' terminal end of the sense strand. Pre-loaded resins with various joints are commercially available. Alternatively, for some sense strands, a dT resin was used, and then various linkers were added by standard phosphoramidite synthesis.

After completion of solid phase synthesis, the dried solid support was treated with 40% by weight aqueous methylamine solution and 28% -31% ammonium hydroxide solution (Aldrich) in 1:1 volume at 30 ℃ for 1.5 hours. The solution was evaporated and the solid residue was reconstituted in water (see below).

Purification the crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20mM Tris,5mM EDTA, pH 9.0, and contained 20% acetonitrile, and buffer B was the same as buffer A except 1.5M sodium chloride was added. Record the UV trace at 260 nm. The appropriate fractions were combined and then run on a size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G25 fine with 100mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or running buffer of filtered water.

Annealing complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1 × PBS (phosphate buffered saline, 1 ×, Corning, Cellgro) to form RNAi reagents. Some of the RNAi agents were lyophilized and stored at-15 to-25 ℃. Duplex concentrations were determined by measuring solution absorbance on a UV-Vis spectrometer in 1 × PBS. The absorbance of the solution at 260nm was then multiplied by a scaling factor and a dilution factor to determine duplex concentration. The conversion factor used was 0.037mg/(mL · cm), or calculated from an experimentally determined extinction coefficient.

Synthesis of the ligation reagent TriAlk 14

In certain embodiments, a linking agent such as TriAlk 14 may be attached to an RNAi agent in the form of a phosphoramidite as follows: by reacting a phosphoramidite containing a trisyne, or by synthesizing an RNAi agent comprising a reactive group (such as a terminal amine) and reacting the RNAi agent with a trisyne moiety comprising an activated ester after the RNAi agent has been cleaved from the resin. The following protocol provides a method for synthesizing an activated ester form of TriAlk 14 (compound 22) or a phosphoramidite form of TriAlk 14 (compound 14).

To a 3-L jacketed reactor was added 500mL DCM and 4(75.0g,0.16 mol). The internal temperature of the reaction was cooled to 0 ℃ and TBTU (170.0g,0.53mol) was added. The suspension was then treated dropwise with amine 5(75.5g,0.53mol) maintaining the internal temperature below 5 ℃. The reaction was then slowly treated with DIPEA (72.3g,0.56mol) maintaining the internal temperature below 5 ℃. After the addition was complete, the reaction was warmed to 23 ℃ over 1 hour and stirred for 3 hours. A 10% kicker load of all three reagents was added and stirred for an additional 3 hours. When remaining <When 4 was 1%, the reaction was considered to be complete. The reaction mixture was washed with saturated ammonium chloride solution (2 × 500mL) and once with saturated sodium bicarbonate solution (500 mL). Then the organic layer is passed throughDried over sodium sulfate and concentrated to an oil. The crude oil had a mass of 188g and was determined by QNMR to contain 72% of 6. The crude oil was used for the next step. C₄₆H₆₀N₄O₁₁845.0 m/z. Actually measured [ M + H]＝846.0。

121.2g of crude oil containing 72% by weight of Compound 6 (86.0g,0.10mol) were dissolved in DMF (344mL) and treated with TEA (86mL,20 v/v%), maintaining the internal temperature below 23 ℃. Dibenzofulvene (DBF) formation was monitored by HPLC method 1 relative to Fmoc-amine 6 consumption (figure 2) and the reaction was complete within 10 hours. Glutaric anhydride (12.8g,0.11mol) was added to the solution and the intermediate amine 7 was converted to compound 8 within 2 hours. After completion, DMF and TEA were removed at 30 ℃ under reduced pressure to give 100g of crude oil. Due to the high solubility of compound 7 in water, aqueous workup cannot be used and chromatography is the only route to remove DBF, TMU and glutaric anhydride. The crude oil (75g) was divided into three portions in Teledyne ISCO Combi-And (5) purifying on a purification system. The crude oil (25g) was loaded onto a 330g silica gel column and eluted with 0-20% methanol in DCM over 30 min to give 42g of compound 8 (54% yield over 3 steps). C ₃₆H₅₅N₄O₁₂736.4 m/z. Actually measured [ M + H]＝737.0。

Compound 8(42.0g,0.057mol) was co-stripped with 10 volumes of acetonitrile before use to remove any residual methanol from the chromatographic solvent. The oil was redissolved in DMF (210mL) and cooled to 0 ℃. The solution was treated with 4-nitrophenol (8.7g,0.063moL) followed by EDC-hydrochloride (12.0g,0.063moL) and found to be complete within 10 hours. The solution was cooled to 0 c,and 10 volumes of ethyl acetate were added followed by 10 volumes of saturated ammonium chloride solution, maintaining the internal temperature below 15 ℃. The layers were allowed to separate and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted 2 times with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55g) was divided into three portions in Teledyne ISCO Combi-And (5) purifying on a purification system. The crude oil (25g) was loaded onto a 330g silica gel column and eluted from 0-10% methanol in DCM over 30 min to give 22g pure 9 (compound 22) (50% yield). C₄₂H₅₉N₅O₁₄857.4 m/z. Actually measured [ M + H]＝858.0。

A solution of ester 9(49.0g,57.1mmol) and 6-amino-1-hexanol (7.36g,6.28mmol) in dichloromethane (3 vol) was treated dropwise with triethylamine (11.56g,111.4 mmol). The reaction was monitored by observing the disappearance of compound 9 on HPLC method 1 and found to end within 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was applied to a 330g silica gel column on a Teledyne ISCO Combi- And (5) purifying on a purification system. The 4-nitrophenol was eluted with 100% ethyl acetate and 10 was washed from the column using 20% methanol/DCM to give a colorless oil (39g, 81% yield). C₄₂H₆₉N₅O₁₂836.0 m/z. Actually measured [ M + H]＝837.0。

Reacting an alcohol 10 with10 volumes of acetonitrile were co-stripped 2 times to remove any residual methanol from the chromatographic solvent and combined with dry dichloromethane (KF)<60ppm) were co-stripped once more to remove traces of water. Alcohol 10(2.30g,2.8mmol) was dissolved in 5 volumes of dry dichloromethane (KF)<50ppm) and treated with diisopropylammonium tetrazolide (188mg,1.1 mmol). The solution was cooled to 0 ℃ and treated dropwise with 2-cyanoethyl N, N, N ', N' -tetraisopropyl phosphoramidite (1.00g,3.3 mmol). The solution was removed from the ice bath and stirred at 20 ℃. The reaction was found to be complete within 3-6 hours. The reaction mixture was cooled to 0 ℃ and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate/brine and then warmed to ambient temperature over 1 minute and stirred at 20 ℃ for an additional 3 minutes. The two-phase mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze unreacted diphosphorus reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08g of 94% by weight compound 14. C ₅₁H₈₆N₇O₁₃The calculated mass of P is 1035.6 m/z. Actually measured [ M + H]＝1036。

The 5 'or 3' amine functionalized sense strand of the RNAi agent can be conjugated to the trialkyne scaffold before or after annealing. Conjugation of the trialkyne scaffold to the annealed duplex is described below: dissolving the amine-functionalized duplexes in 90% DMSO/10% H at about 50-70mg/mL₂And (4) in O. 40 equivalents of triethylamine are added, followed by 3 equivalents of the trialkyne-PNP. Once finished, the conjugate was precipitated 2 times in a 1x phosphate buffered saline/acetonitrile (1:14 ratio) solvent system and dried.

Prior to or after annealing and prior to or after conjugation of the PK enhancer, one or more targeting ligands can be linked to the HIF-2RNAi agents disclosed herein. The following describes a general conjugation process for linking integrin targeting ligands to alkyne-functionalized linkers (e.g. (TriAlk) or 2' -O-propargyl) on internal nucleotides. The protocol describes a three targeting ligand to tridentate targeting group scaffoldOr (2) is added. The same procedure can be used to attach targeting ligands to internal nucleotides, although the equivalent number of targeting ligands can be adjusted to take into account the number of targeting ligands to be added: preparation of 0.5M tris (3-hydroxypropyl-triazolylmethyl) amine (THPTA), 0.5M copper (II) sulfate pentahydrate (Cu (II) SO) in deionized water ₄·5H₂O) and 2M sodium ascorbate solution. A solution of 75mg/mL of the desired integrin ligand in DMSO was prepared. In a vial containing the sense strand (75mg/mL in deionized water), the integrin ligand was added to the reaction (2 equivalents/alkyne) with stirring. Triethylamine (40 equivalents/sense strand) was added to the reaction flask. In a separate bottle, 5 parts of 0.5M THPTA and 1 part of 0.5M Cu (II) SO₄·5H₂O mixed, vortexed, and incubated at room temperature for 5 min. After 5min, the THPTA/Cu solution (0.5 equivalents Cu/alkyne) was added to the reaction flask. 2M ascorbate (5 eq/Cu) was then added to the reaction flask immediately. Once the reaction is complete (usually within 0.5-1 h), the reaction is immediately purified by non-denaturing anion exchange chromatography. Unless otherwise indicated, all constructs described in the following examples that include tridentate targeting groups include groups having the following structure:

TriAlk14:

TriAlk14s:

wherein TL comprises a targeting ligand andindicating the point of attachment to the RNAi agent.

The one or more PK enhancers can be linked to the HIF-2 a RNAi agents disclosed herein before or after annealing and before or after conjugation with one or more targeting ligands. The following describes a general conjugation process for attaching a PK enhancer to the constructs set forth in the examples described herein. The following describes a general method for attaching maleimide-functionalized PK enhancers to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of a HIF-2 α RNAi agent by performing dithiothreitol reduction of disulfide bonds followed by thiol-michael addition of various PK enhancers: in the vial, the functionalized sense strand was dissolved at 75mg/mL in 0.1M Hepes pH 8.5 buffer, and 25 equivalents of dithiothreitol were added. Once the reaction is complete (typically within 0.5-1 h), the conjugate is immediately precipitated 3 times in a 1x phosphate buffered saline/acetonitrile (1:40 ratio) solvent system and dried. A solution of 75mg/mL of the maleimide-functionalized PK enhancer in DMSO was then prepared. Disulfide reduced (3 ' C6-SH, 5 ' HS-C6, or 3 ' 6-SH functionalized) sense strand was dissolved at 100mg/mL in deionized water and 3 equivalents of maleimide-functionalized PK enhancer were added. Once the reaction is complete (typically over 1h-3 h), the conjugate is precipitated in a 1x phosphate buffered saline/acetonitrile (1:40 ratio) solvent system and dried.

Method for preparing targeting ligand

Some abbreviations used in the following experimental details of the syntheses of the examples are defined as follows: h or hr-hr; min is minutes; mol is mol; mmol to millimole; m is mole; μ M to micromolar; g is gram; μ g to μ g; RT or RT ═ room temperature; l is liter; mL to mL; wt is weight; et (Et)₂O ═ diethyl ether; THF ═ tetrahydrofuran; DMSO ═ dimethyl sulfoxide; EtOAc ═ ethyl acetate; et (Et)₃N or TEA ═ triethylamine; i-Pr₂NEt or DIPEA or DIEA ═ diisopropylethylamine; CH (CH)₂Cl₂Or DCM ═ dichloromethane; CHCl₃Chloroform; CDCl₃Deuterated chloroform; CCl₄Carbon tetrachloride; MeOH ═ methanol; EtOH ═ ethanol; DMF ═ dimethylformamide; BOC ═ tert-butoxycarbonyl; CBZ ═ benzyloxycarbonyl; TBS ═ tert-butyldimethylsilyl; TBSCl or TBDMSCl ═ tert-butyldimethylsilyl chloride; TFA ═ trifluoroacetic acid; DMAP ═ 4-dimethylaminopyridine; NaN₃Sodium azide; na (Na)₂SO₄Sodium ═ sulfate; NaHCO 2₃Sodium bicarbonate; NaOH ═ sodium hydroxide; MgSO (MgSO)₄Magnesium sulfate; k₂CO₃Potassium carbonate; KOH is potassium hydroxide; NH (NH)₄OH ═ ammonium hydroxide; NH (NH)₄Cl ═ ammonium chloride; SiO 2₂(ii) silica; Pd-C ═ palladium on carbon; HCl ═ hydrogen chloride or hydrochloric acid; NMM ═ N-methylmorpholine; h ₂Hydrogen; KF ═ potassium fluoride; EDC-HCl ═ N- (3-dimethylaminopropyl) -N' -ethylcarbodiimide hydrochloride; MTBE ═ methyl-tert-butyl ether; MeOH ═ methanol; ar is argon; n is a radical of₂(ii) nitrogen; SiO 2₂(ii) silica; r_TRetention time; PTSA ═ p-toluenesulfonic acid; PPTS ═ pyridinium p-toluenesulfonate.

Structure 1c synthesis of ((S) -3- (6- ((1-azido-15-oxo-3, 6,9, 12-tetraoxa-16-azanonacan-19-yl) oxy) pyridin-3-yl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

A mixture containing Compound 1(1.03g,8.23mmol), Compound 2(0.92g14.8mol), and PTSA hydrate (156mg,0.82mmol) in benzene (25mL) was refluxed overnight in a Dean Stark apparatus. The next morning, the reaction mixture was poured into saturated sodium bicarbonate and then ethyl acetate was added. The organic phase was separated, filtered over sodium sulfate, and concentrated to give compound 3 in 95% yield, which was then used without further purification.

To a solution of Compound 4(5.39g,53.3mmol) in DMF (100mL) andto the solution of molecular sieves was added sodium hydride (60 wt%, 2.13g,53.3mmol) and the reaction was stirred for 1 hour. Followed by addition of Compound 3 (7.5) 2g,7.52g) in DMF (20mL) and the suspension was heated at 80 ℃ overnight. At the end, the suspension was filtered over a cotton plug and concentrated under reduced pressure. The residue was partitioned between ether and water, and the organic phase was separated, filtered over sodium sulfate, and concentrated under reduced pressure. The residue was taken up in 20ml of 10% H₂A solution of O in TFA was treated and stirred for 30 minutes. After completion, the solution was cooled to 0 ℃ and the pH was adjusted to 11 with 6M NaOH, after which the product precipitated as an oil. Compound 5 was extracted 3 times from the oil suspension with diethyl ether. The organic phases were combined, filtered over sodium sulfate and concentrated. Compound 5 was then isolated by separation on silica gel, eluting with a gradient of ethyl acetate in hexanes, in 26% yield.

A mixture containing compound 5(2.29g,9.94mmol), compound 6(4.82g,39.8mmol), PPTS (125mg,0.50mmol), magnesium sulfate (3g,24.9mmol), copper sulfate (3.97g,24.9mmol), and 3 angstrom molecular sieves in DCM (22mL) was heated to reflux overnight. After completion, the mixture was filtered and concentrated under reduced pressure. Compound 7 was then isolated by separation on silica gel, eluting with a gradient of ethyl acetate in hexanes, in 76% yield.

A flame dried flask was charged with THF (40mL) and diisopropylamine (2.29g,22.6 mmol). It was cooled to-20 ℃ and n-BuLi (2.5M,8.64mL,21.6mmol) was added via cannula. The solution was stirred at-20 ℃ for 10min and then cooled to-78 ℃. Compound 8(2.02mL,20.6mmol) was added dropwise with vigorous stirring. After addition, the solution was stirred at-78 ℃ for 30 min. Next, ClTi (iPrO)₃A solution of (11.26g,43.2mmol) in THF (10mL) was added via addition funnel with vigorous stirring over about 10 minutes. The reaction was stirred at-78 ℃ for 30 minutes. Finally, a suspension of compound 7(2.29g.6.86mmol) in THF was added dropwise,and stirred at-78 ℃ for 1.25 hours until the reaction was complete. To the reaction at-78 ℃ was added a saturated aqueous ammonium chloride solution. The reaction was then removed from cooling and the aqueous phase was gradually melted and quenched (yellow orange disappearance). The mixture was partitioned between EtOAc and saturated aqueous ammonium chloride. The organic phase was separated and the aqueous phase was extracted 2 times with EtOAc. The organic phases were combined and dried over brine, then dried over sodium sulfate, then filtered and concentrated. The residue was purified on silica gel, eluting with a gradient of ethyl acetate in hexane. Compound 9 was obtained as a single diastereoisomer in 75% yield after purification.

Compound 9(1.28g,3.21mmol) in MeOH (3.2mL) was treated with a solution of HCl in dioxane (4M,3.2mL,12.9mmol) and stirred at room temperature for 30 min. After completion, the reaction mixture was diluted with water and washed with diethyl ether. Subsequently, the pH was adjusted to 11 using 2N aqueous NaOH, and the product was extracted with ethyl acetate. The organic phase was dried over sodium sulfate, filtered, and concentrated to give compound 10 in 92% yield, which was then used without further purification.

To a mixture of compound 10(0.78g,2.67mmol) and compound 11(0.60g,3.46mmol) in THF (6mL) was added STAB-H solid (1.29g,6.12mmol) portionwise at 15 ℃. After addition, the cooling was removed and the mixture was stirred for about 2.5 hours to completion. The reaction was quenched by the addition of saturated aqueous sodium bicarbonate and the pH was brought to 9. The product was extracted 3 times with EtOAc, the organic phases were combined, dried over brine, then filtered over sodium sulfate and concentrated. Compound 12 was isolated by separation on silica gel, eluting with a gradient of ethyl acetate in hexanes, in 85% yield.

To DIPEA (7.53mL,53.75mmol) in THF (35mL) was added n-BuLi (2.5M,19.9mL,49.8mmol) via an oven dried air tight syringe at-10 ℃ over 2 minutes. The mixture was stirred at-10 ℃ for 10 minutes, then cooled to-60 ℃ and a solution of dimethyl methylphosphonate (6.42g,51.8mmol) in THF (8mL) was added dropwise over 5-10 minutes. After aging at-60 ℃ for about 1 hour, a solution of compound 13(7.37g.39.82mmol) in THF (15mL) was added dropwise at-60 ℃ over 5 minutes. The reaction mixture was stirred at-60 ℃ for 1 hour, and then at-41 ℃ for about 1.5 hours. By adding 2.6 equivalents of H ₂SO₄The reaction was quenched (2.0M) and extracted 3 times with ethyl acetate (ca. 50 mL). The organic phases were combined and dried with brine, filtered over sodium sulfate, and briefly concentrated to determine the crude weight and sampled for NMR. After determination of dry weight, compound 14 was dissolved in MeOH and used for the next reaction without further purification. The yield was calculated to be 75.83%. Crude wt./wt.% 76.3% was determined by NMR.¹H NMR:400MHz CDCl₃δ4.75(s,1H),3.81(s,3H),3.78(s,3H),3.10-3.14(m,2H),3.04-3.09(m,2H),2.68(t,2H),1.82-1.75(m,2H),1.44(s,9H)。

To compound 14(9.33g by weight, NMR from about 12g of crude, 30.16mmol) in MeOH (40mL) was added a solution of NaOH (1.45g,36.2mmol) in water (1.5 mL). The mixture was heated to 50 ℃ and Compound 15(2.76g,22.62mmol) was added. After stirring for 30 min, a second portion of compound 15 (736mg,6.03mmol) was added and the reaction mixture was stirred at 50 ℃ overnight. The reaction mixture was then concentrated to an oil and washed with 2 volumes of EtOAc and 1 volume of H₂And (4) distributing among the O. The organic phase was separated and washed with 1 volume of water. The aqueous washes were combined and back-extracted with EtOAc (2x,1 volume). The combined organic phases were dried over sodium sulfate, filtered and concentrated. The crude material was dried on approximately 20g of silica gel by passing over silicaCompound 16 was isolated in 69% yield from a gel eluted with a gradient of ethyl acetate in hexane containing 1% triethylamine. ¹H NMR:400MHzCDCl₃δ9.09(dd,1H),8.17(dd,1H),8.12(d,1H),7.46(dd,1H),7.41(d,1H),4.78(s,1H),3.24(q,2H),3.10(t,2H),2.12(quin,2H),1.43(s,9H)。

To a solution of compound 16(5.98g,20.8mmol) in EtOH (50mL) at 1 atmosphere was added palladium (10% on carbon, 2.22g,2.08mmol) and hydrogen. The reaction mixture was stirred at room temperature overnight. After completion, the reaction mixture is washed with waterFiltered and concentrated. Compound 17 was isolated in 79% yield by separation on silica gel eluting with a gradient of ethyl acetate in hexane containing 1% triethylamine.¹H NMR:400MHz CDCl₃δ7.05(d,1H),6.34(d,1H),5.48(s,1H),4.81(s,1H),3.36-3.43(m,2H),3.16(q,2H),2.68(t,2H),2.59(t,2H),1.90(dt,2H),1.83(quin,2H),1.44(s,9H)。

Compound 17(4.81g,16.53mmol) was dissolved in 6M aqueous HCl (16.4mL) and heated at 42 ℃ for 2 hours. Another portion of 6M HCl (2.8mL) was then added and the reaction mixture was stirred for an additional 2 hours. Sodium chloride was added to the reaction followed by 2N aqueous NaOH until the product precipitated as an oil (pH greater than 12). The mixture was extracted 3 times with 2-butanol. The combined organic phases were dried over sodium sulfate, filtered and concentrated. Compound 18 was obtained in 85% yield and was subsequently used without further purification.¹H NMR:400MHz CDCl₃δ7.06(d,1H),6.35(d,1H),4.83(s,1H),3.35-3.46(m,2H),2.75-2.67(m,4H),2.58(t,2H),1.88-1.95(m,2H),1.84-1.76(m,4H)。

To a solution of triphosgene (85mg,0.28mmol) in THF (0.9mL) in a flame-dried flask was added dropwise a solution of compound 18(236mg,0.62mmol) and TEA (0.134mL,0.96mmol) in THF (0.5mL) at-10 ℃. The reaction mixture was warmed to room temperature. After TLC indicated complete reaction, additional TEA (0.134mL) was added followed by compound 12(166mg,0.87mmol) as a solid. The heterogeneous mixture was heated at 50 ℃ for 2 hours with vigorous stirring. After completion, the reaction mixture was quenched with 1 volume of water and extracted 3 times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate and concentrated. Compound 19 was obtained assuming 100% yield and was subsequently used without further purification.

To crude compound 19(400mg, assuming 0.62mmol) dissolved in THF (37mL) was added H₂SO₄(2M,0.6mL), and the mixture was stirred at room temperature overnight. The next morning, add H₂SO₄Another portion (0.65 eq). After 4 hours, the reaction was complete. The reaction mixture was diluted with ethyl acetate. The organic phase was separated and the aqueous phase was back-extracted once with ethyl acetate. The combined organic phases were filtered over sodium sulfate and concentrated. Compound 20 was isolated by separation on silica gel, eluting with a gradient of MeOH in DCM, in 75% yield.

A suspension of compound 20(251mg,0.47mmol) and Pd/C (10 wt%, 100mg,0.094mmol) in ethanol (9mL) was charged with H₂Brought to 1 atmosphere and stirred at 35 ℃ overnight. After finishing, byThe palladium was removed by filtration. Use of C₁₈5u 19X250mm BEH column (Waters Corp.) with acetonitrile in H containing 1% TFA₂Gradient elution in O, compound 21 was isolated as TFA salt by reverse phase HPLC in 20% yield.

To a solution of compound 21(61mg,0.097mmol) in DCM (250uL) was added TEA (8uL,0.24mmol) followed by NHS-PEG₄-N₃(41.4mg,0.11mmol) in DCM (275. mu.L). The reaction mixture was stirred for 15 minutes and checked by LC-MS, which indicated the end of the reaction. All volatiles were removed and the residue was dissolved in EtOH (0.4mL) and water (0.4 mL). LiOH (11.2mg,0.47mmol) was added and the reaction mixture was heated at 40 ℃ for 2 hours. After completion, the reaction mixture was concentrated under reduced pressure. Use of C ₁₈5u 19X250 mm BEH column (Waters Corp.) with acetonitrile in H containing 1% TFA₂Gradient elution in O, isolated compound 22 by reverse phase HPLC in 42% yield (structure 1 c).

Structure 2c synthesis of ((S) -3- (4- (2- (2- (2- (2-azidoethoxy) ethoxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

To a solution of compound 23(10g,43.4mmol) in toluene (80mL) was added compound 6(21.1g,0.17mol), PPTS (0.55g,2.2mmol), and then acetic acid (1.24mL,21.7 mmol)). The reaction vessel was equipped with a Dean Stark trap and then heated to reflux overnight. After completion, the reaction mixture was concentrated and dried on 60 g of silica gel and graded on SiO with ethyl acetate in hexane₂Purification above yielded compound 24 in 66% yield.¹H NMR:400MHz CDCl₃δ8.47(s,1H),7.68(d,1H),7.31-7.56(m,6H),6.98-7.16(m,1H),5.23(s,2H),1.26(s,9H)。

The flame dried flask was charged with THF (190mL) and DIPEA (9.07g,89.7mmol), cooled to-20 deg.C, then charged with n-BuLi (2.5M,34.2mL,85.6mmol) via cannula. The solution was stirred at-20 ℃ for 10min and then cooled to-78 ℃. Compound 8(8mL,81.5mmol) was added dropwise with vigorous stirring. After the addition, the mixture was stirred at-78 ℃ for 30 min. Next, ClTi (iPrO) was added through an addition funnel over a period of 10 minutes ₃(44.6g,0.171mol) in THF (40 mL). The reaction was stirred at-78 ℃ for 30 minutes. Finally, a suspension of compound 24(9.06g,27.2mmol) in THF (20mL) was added dropwise and stirred at-78 deg.C for 1.25 h until the reaction was complete. To the reaction at-78 ℃ was added a saturated aqueous ammonium chloride solution. The reaction was then removed from cooling and the aqueous phase was gradually melted and quenched (yellow orange disappearance). The mixture was partitioned between EtOAc and saturated aqueous ammonium chloride. The organic phase was separated and the aqueous phase was washed 2 times with EtOAc. The organic phases were combined and dried over brine, then dried over sodium sulfate, filtered, and concentrated. Compound 25 was obtained as a single diastereomer in 70% yield by separation on silica gel eluting with a gradient of ethyl acetate in hexanes.¹H NMR:400MHz CDCl₃δ7.31-7.48(m,5H),7.09(dd,1H),6.89-7.04(m,2H),5.13(s,2H),4.59-4.76(m,2H),4.13(q,2H),2.81(dd,2H),1.21-1.25(m,12H)。

To compound 25(8.07g,19.1mmol) was added aqueous HCl (6M,20.7mL,0.124mol) followed by MeOH (60 mL). THF was added until a homogeneous solution was obtained, and the reaction mixture was stirred at room temperature for 6 hours. The reaction mixture was basified to pH 10 with 2N aqueous NaOH and then extracted 3 times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate and concentrated. Obtained in 95% yield Compound 26 and then used without further purification.¹H NMR:400MHz CDCl₃δ7.28-7.46(m,6H),7.18(d,1H),6.99(t,1H),5.11(s,2H),4.57(t,1H),4.09(q,2H),2.97-3.09(m,1H),2.81-2.93(m,1H),1.18(t,3H)。

To a mixture of compound 26(5.76g,18.2mmol) and compound 27(4.09g,23.6mmol) in THF (40mL) was added STAB-H solid (8.85g,41.8mmol) portionwise at 0 deg.C. After the last addition, the cooling was removed and the mixture was stirred for about 2.5 hours to completion. The reaction mixture was quenched by addition of saturated aqueous sodium bicarbonate solution. The mixture was extracted 3 times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate and concentrated. Compound 28 was isolated by separation on silica gel, eluting with a gradient of ethyl acetate in hexanes, in 73% yield.¹H NMR:400MHz CDCl₃δ7.30-7.49(m,5H),7.11(dd,1H),6.88-7.02(m,2H),5.13(s,2H),4.40(t,1H),4.10(q,2H),4.00(dd,1H),3.35(s,3H),3.31(s,3H),2.47-2.75(m,4H),1.20(t,3H)。

To a solution of triphosgene (1.2g,4.04mmol) in THF (24mL) in a flame dried flask was added dropwise a solution of compound 19(3.64g,8.99mmol) and TEA (1.94mmol,13.9mmol) in THF (6mL) at-10 ℃. The reaction mixture was warmed to room temperature. After TLC indicated complete reaction, additional TEA (3.3mL,23.6mmol) was added followed by compound 28(2.61g,13.7mmol) as a solid. The heterogeneous mixture was heated at 50 ℃ for 2 hours with vigorous stirring. After completion, the reaction mixture was quenched with 1 volume of water and extracted 3 times with EtOAc. The combined organic phases were dried with brine, filtered over sodium sulfate and concentrated. Compound 29 was obtained assuming 100% yield and the crude was subsequently used without further purification.

To compound 29(5.59g,8.97mmol) dissolved in THF (37mL) was added water (0.8mL) and H₂SO₄(2M,8.07ml,16.2mmol) and the reaction mixture was stirred at 28 ℃ overnight. The next morning, the pH of the mixture was adjusted to 9 using sodium bicarbonate and extracted 3 times with DCM. The combined organic phases were dried with brine, filtered over sodium sulfate and concentrated. Compound 30 was isolated in 82% yield by separation on silica gel eluting with a gradient of MeOH in DCM containing 1% TEA.

Compound 30(4.13g,7.39mmol) dissolved in EtOH (30mL) was loadedPalladium (10 wt%, 3.15g,2.96mmol) and hydrogen to 50 psi. The mixture was stirred at room temperature overnight. The next day, the reaction was 64% complete. The reaction mixture is added inFiltered and concentrated. The residue was dissolved in EtOH and loaded with palladium (10 wt%, 1.57g,1.48mmol)) and hydrogen to 50 psi. After stirring for 48 hours, the reaction mixture was heated to 30 ℃ and stirred for another 24 hours. After finishing, the suspension is addedFiltered over and all volatiles were removed in vacuo. The residue was purified on silica gel, eluting with a gradient of MeOH in DCM to give compound 31 in 72% yield.¹H NMR:400MHz DMSO-d₆δ9.88(s,1H),7.02-7.14(m,2H),6.86-6.93(m,2H),6.50-6.76(m,1H),6.31(d,1H),5.17(t,1H),4.00(q,2H),3.23-3.28(m,4H),2.79-3.18(m,7H),2.61(t,2H),2.41(t,2H),1.65-1.78(m,4H),1.09(t,3H)。

At-10 ℃ to PPh₃(699mg,2.66mmol) in THF (0.47mL) was added dropwise to a solution of DEAD. The mixture was warmed to room temperature and compound 31(600mg,1.33mmol) and HO-PEG were added ₄-N₃(466mg,3.06mmol) in pure mixture and stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel, eluting with a gradient of MeOH in DCM to give compound 32 in 50% yield.¹H NMR:400MHz DMSO-d₆δ7.10-7.19(m,2H),6.97-7.06(m,2H),6.18-6.31(m,2H),5.20(t,1H),4.13-4.16(m,1H),3.98-4.04(m,2H),3.71-3.80(m,2H),3.52-3.61(m,8H),3.38-3.37(m,5H),3.10-3.25(m,5H),2.79-3.08(m,5H),2.59(t,2H),2.31-2.42(m,2H),1.65-1.75(m,4H),1.10(t,3H)。

To compound 32(826mg,1.23mmol) was added EtOH (3mL) and H₂O (3mL), followed by LiOH (97mg,4.05mmol) was added. The mixture was stirred at 30 ℃ overnight. After completion, the mixture was neutralized to pH 5 with 6M aqueous HCl and concentrated. The residue was purified by reverse phase HPLC on a Phenomenex Gemini C18,50x250mm,10 μm column eluting with a gradient of acetonitrile in water containing 0.1% TFA to yield compound 33 (structure 2C) in 81% yield.¹H NMR:400MHz D₂Oδ7.30(d,1H),7.01-7.19(m,3H),6.45(d,1H),5.24(t,1H),4.14-4.32(m,2H),3.84-3.92(m,2H),3.59-3.77(m,10H),3.14-3.45(m,8H),.02-3.12(m,1H),2.97(d,2H),2.85(q,1H),2.50-2.72(m,4H),1.68-1.94(m,4H)。

Structure 2.1 synthesis of ((S) -3- (4- ((11-azidoundecyl) oxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propionic acid).

At room temperature to PPh₃To the solution in THF was added dropwise a solution of DEAD. Transferring the mixture to a solution containing compound 31 and OH- (CH)₂)₁₁-N₃A bottle of the mixture of (a), and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. Addition of LiOH to H₂O, and additional water/EtOH was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was washed with H ₂SO₄Acidified to pH3, concentrated and purified by reverse phase HPLC (Phenomenex Gemini C18,50x250mm,10 μm, 0.1% TFA in acetonitrile/water, gradient elution).

Structure 2.2c synthesis of ((S) -3- (4- (2- (1- (6-azidohexanoyl) piperidin-4-yl) ethoxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

Compound 35 dissolved in DCM was treated with EDAC at 0 ℃ and acetonitrile was added to aid dissolution. After 5 minutes, TEA and Compound 36 were added, the cooling removed, and stirring continued for 2 hours. After completion, saturated ammonium chloride was added and the organic phase was separated, filtered over sodium sulfate and concentrated. The resulting crude was subsequently used without further purification.

At room temperature to PPh with vigorous stirring₃To the solution in THF was added dropwise a solution of DEAD. The mixture was transferred to a bottle containing a mixture of compound 31 and compound 37, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. Addition of LiOH to H₂O, and adding additional water untilThe reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was washed with H ₂SO₄Acidification to pH3, concentration, and purification by reverse phase HPLC (Phenomenex Gemini C18,50x250mm,10 μm, 0.1% TFA in acetonitrile/water, gradient elution) yielded compound 38 (structure 2.2C).

Structure 2.3c synthesis of ((S) -3- (4- (2- ((1r,4S) -4- (5-azidopentanamido) cyclohexyl) ethoxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

To a suspension of compound 35 in DCM at 0 ℃ was added a solution of EDAC in DCM. After 5 minutes, the cooling was removed and compound 39 was added followed by TEA. The heterogeneous mixture was stirred at room temperature overnight. The next day, the reaction was diluted with DCM and the precipitate was dissolved. Mixing the mixture with 5% KHSO₄Wash 2 times and wash 1 time with brine. The organic phase was filtered over sodium sulfate and concentrated. The crude residue containing compound 40 was used without further purification.

At room temperature to PPh with vigorous stirring₃To the solution in THF was added dropwise a solution of DEAD. The mixture was transferred to a bottle containing a mixture of compound 31 and compound 40, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. Addition of LiOH to H ₂O, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was washed with H₂SO₄Acidification to pH3, concentration, and purification by reverse phase HPLC (Phenomenex Gemini C18,50x250mm,10 μm, 0.1% TFA in acetonitrile/water, gradient elution) yielded compound 41 (structure 2.3C).

Structure 2.4c synthesis of ((S) -3- (4- (4- (5-azidopentanamido) phenethyloxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

To a mixture of compound 35 and compound 42 in DCM was added EEDQ and the solution was stirred at rt overnight. The reaction mixture was then diluted with DCM, washed 3 times with 1M HCl and 1 time with brine. The organic phase was dried over sodium sulfate, filtered, and concentrated. Compound 43 was then used without further purification.

At room temperature to PPh with vigorous stirring₃To the solution in THF was added dropwise a solution of DEAD. The mixture was transferred to a bottle containing a mixture of compound 31 and compound 43, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. Addition of LiOH to H ₂O, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was washed with H₂SO₄Acidification to pH3, concentration, and purification by reverse phase HPLC (Phenomenex Gemini C18,50x250mm,10 μm, 0.1% TFA in acetonitrile/water, gradient elution) yielded compound 44 (structure 2.4C).

Structure 2.5c synthesis of ((S) -3- (4- (4- ((5-azidopentyl) oxy) phenethyloxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

To a solution of compound 45 and compound 46 in acetone was added potassium carbonate. In N₂Under the protection of violent stirringThe mixture was heated to 65 ℃ overnight in a sealed bottle as a suspension under stirring. The reaction was then filtered, concentrated, and purified on silica gel, eluting with a gradient of ethyl acetate in hexanes to give compound 47.

To a solution of compound 47 in DMF was added sodium azide and the mixture was stirred in a sealed bottle under nitrogen at 80 ℃ overnight. At the end, 1 volume of water was added and the product was extracted with ethyl acetate. The separated organic phase was filtered over sodium sulfate and concentrated. The crude compound 48 was used without further purification.

At room temperature to PPh with vigorous stirring₃To the solution in THF was added dropwise a solution of DEAD. The mixture was transferred to a bottle containing a mixture of compound 31 and compound 48, and the reaction mixture was stirred at room temperature overnight. Volatiles were removed from the reaction mixture and the crude was dissolved in EtOH. Addition of LiOH to H₂O, and additional water was added until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was washed with H₂SO₄Acidification to pH3, concentration, and purification by reverse phase HPLC (Phenomenex Gemini C18,50x250mm,10 μm, 0.1% TFA in acetonitrile/water, gradient elution) gave compound 49 (structure 2.5C).

Structure 2.6c Synthesis of ((S) -3- (3- (3- (3- (17-azido-3-oxo-6, 9,12, 15-tetraoxa-2-azepane yl) -5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) -2-oxoimidazolidin-1-yl) -3- (3-fluoro-4-methoxyphenyl) propionic acid).

At 0 ℃ toPPh₃To the solution in THF was added dropwise a solution of DEAD. After complete addition, the mixture was transferred to a bottle containing a pure mixture of compound 31 and MeOH. Using the bottle with N₂Capped and stirred at room temperature overnight. After completion, all volatiles were removed and the resulting crude was purified on silica gel eluting with a gradient of MeOH in DCM to give compound 50.

To a solution of compound 50 in AcOH was added bromine and the mixture was stirred for 0.5 h. After completion, the reaction was diluted with 5 volumes of ethyl acetate and 2.5 volumes of water. The aqueous layer was neutralized to pH 7 with saturated aqueous sodium bicarbonate solution and the organic phase was separated. The aqueous layer was extracted 2 additional times with ethyl acetate. The combined organic phases were dried over sodium sulfate, filtered and concentrated. The resulting crude compound 51 was subsequently used without further purification.

Compound 51, Pd (PPh)₃)₄And Zn (CN)₂The solution in DMAC was degassed with nitrogen for 30 minutes. The mixture was heated in a sealed bottle at 128 ℃ overnight. After completion, the mixture was diluted with 5 volumes of EtOAc. The organic phase was separated, then washed 2 times with water, 2 times with brine, then the organic phase was filtered over sodium sulfate and concentrated. The residue was purified on silica gel, eluting with 100% EtOAc, to give compound 52.

To a solution of compound 52 in MeOH was added ammonia, followed by raney nickel slurry, which was pre-washed 3 times with methanol. Will be provided withThe flask was charged to 60psi with hydrogen and stirred at room temperature for 16 hours. At the end, the suspension was filtered and concentrated. The resulting crude residue was redissolved in DMF. DIEA and NHS-PEG were added ₄-N₃And the mixture was stirred for 1 hour. At the end, all volatiles were removed and the crude residue was redissolved in a mixture of MeOH and THF. Addition of LiOH to H₂O, and the mixture was stirred at room temperature for 17 hours. After the reaction was complete, the pH was adjusted to 3 with TFA and the mixture was directly injected onto semi-preparative reverse phase HPLC (Phenomenex Gemini c18,250x21.2mm,5 μm, 0.1% TFA in water/ACN, gradient elution) to yield compound 53 (structure 2.6 c).

Structure 2.7c synthesis of ((S) -N- (2- (2- (2- (2-azidoethoxy) ethoxy) ethyl) -3- (3-fluoro-4-methoxyphenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propionamide), structure 2.8c, structure 2.9c, and structure 2.10 c.

THF, PPh were added dropwise to Compound 31 at 0 deg.C₃And a solution of DEAD. The mixture was stirred at room temperature for 16 hours. The mixture was then cooled to-20 ℃ for 1 hour and filtered to remove triphenylphosphine oxide. The filtrate was concentrated and the O-alkylated intermediate was isolated by purification on silica gel, eluting with a gradient of ethyl acetate in hexane containing 1% TEA. The isolated intermediate was then suspended in THF and H ₂In mixtures of O, with LiOH in H₂The solution in O was treated and stirred at 35 ℃ for 16 hours. After completion, the pH was adjusted to 7 with 2M HCl and all volatiles were removed. The crude was suspended in H₂O is in; sodium chloride was added and compound 54 was extracted 5 times with ethyl acetate. The organic phases were combined, filtered over sodium sulfate and concentrated. Compound 54 was subsequently used without further purification.

A solution of compound 54 in DMF was treated with HBTU and stirred for 5 minutes. Followed by the addition of DIEA and N₃-PEG₃-NH₂And the mixture was stirred at room temperature for 16 hours. Upon completion, the pH was adjusted to 3 with TFA and compound 55 was isolated by direct injection into semi-preparative reverse phase HPLC (Phenomenex Gemini c18,250x21.2mm,5 μm, 0.1% TFA in water/ACN, gradient elution) to yield compound 55.

Using N separately₃-PEG₁₁-NH₂、N₃-PEG₂₃-NH₂And N₃-PEG₃₅-NH₂Compounds 2.8c, 2.9c and 2.10c were synthesized using a similar protocol.

Structure 2.11c synthesis of ((R) -3- (4- (2- (2- (2- (2-azidoethoxy) ethoxy) -3-fluorophenyl) -3- (2-oxo-3- (3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl) imidazolidin-1-yl) propanoic acid).

THF (1.50L), DIPEA (150.00mL,716.000mmol,0.88 equiv.), n-BuLi (430.00mL,680.000mmol,0.84 equiv.) were placed in a 3-L4-necked round bottom flask purged and maintained with a nitrogen inert atmosphere. This was followed by addition of trimethyl phosphite (195.00mL) at-60 ℃ and stirring for 1h at-60 ℃. To this was added tert-butyl 2-oxopyrrolidine-1-carboxylate (150.00g,809.835mmol,1.00 equiv.) at-60 ℃. The resulting solution was stirred in a liquid nitrogen bath at-60 ℃ for 1 h. The reaction was then quenched by addition of 350mL H ₂SO₄(2N) quench and use 1.5L H₂And (4) diluting with oxygen. The resulting solution was extracted with 2x1L ethyl acetate. The resulting mixture was washed with 1X1L H₂Washed with O, dried over anhydrous sodium sulfate and concentrated in vacuo. This gives 200g (crude) of N- [5- (dimethoxyphosphoryl) -4-oxopentyl as yellow oil](iii) carbamic acid tert-butyl ester.

In a 3-L round bottom flask was placed N- [5- (dimethoxyphosphoryl) -4-oxopentyl group]Tert-butyl carbamate (200.00g,1500.00mmol,1.50 equivalents), MeOH (1.50L), 2-aminopyridine-3-carbaldehyde (53.00g,1000.00mmol,1.00 equivalents), NaOH (50.00g,1500.00mmol,1.50 equivalents). The resulting solution was stirred in an oil bath at 50 ℃ for 16 h. With NaHCO₃(aqueous solution) the pH of the solution was adjusted to 8. The resulting mixture was concentrated. The reaction was then quenched by the addition of 1.5L of water and extracted with 2 × 1.5L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This gave 160g (crude) of N- [3- (1, 8-naphthyridin-2-yl) propyl as a yellow oil](iii) carbamic acid tert-butyl ester.

Placing N- [3- (1, 8-naphthyridin-2-yl) propyl ] in a 5-L round-bottom flask]Tert-butyl carbamate (160.00g,556.787mmol,1.00 eq.), MeOH (2.00L), Rh/C (140.00g,1.360mmol), H ₂(40 Psi). The resulting solution was stirred at 25 ℃ for 16 h. The solid was filtered off. The resulting mixture was concentrated. This gave 106g (65.33%) of N- [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl ] as a yellow solid](iii) carbamic acid tert-butyl ester.

Placing N- [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl ] in a 1-L round-bottom flask]Tert-butyl carbamate (106.00g,363.767mmol,1.00 eq), EtOAc (500.00mL), a solution of HCl in EtOAc (4M,400.00 mL). The resulting solution was stirred at 25 ℃ for 3 h. The obtained solution was used 1L H₂And (4) diluting with oxygen. The pH was adjusted to 11 with NaOH (aq). The resulting solution was extracted with 2x1L ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This gave 56g (80.48%) of 3- (5,6,7, 8-tetrahydro-1, 8-naphthyridine-2-Yl) propan-1-amine.

Into a 2-L round bottom flask were placed 3-fluoro-4-hydroxybenzaldehyde (140.00g,999.194mmol,1.00 equiv.), ACN (1000mL), (bromomethyl) benzene (205.08g,1199.039mmol,1.20 equiv.), K₂CO₃(414.28g,2997.581mmol,3.00 equiv.). The resulting solution was stirred at 25 ℃ for 16 h. The solid was filtered off. The resulting mixture was concentrated. This gave 230g (99.98%) of 4- (benzyloxy) -3-fluorobenzaldehyde as a white solid.

Into a 3-L round bottom flask was placed 4- (benzyloxy) -3-fluorobenzaldehyde (230.00g,998.966mmol,1.00 equiv.), DCM (1600mL), (S) -2-methylpropane-2-sulfinamide (145.29g,1198.762mmol,1.20 equiv.), Cs₂CO₃(650.97g,1997.933mmol,2.00 equiv.). The resulting solution was stirred in an oil bath at 50 ℃ for 6 h. The solid was filtered off. The resulting mixture was concentrated. This gave 260g (78.06%) of (S) -N- [ [4- (benzyloxy) -3-fluorophenyl ] as a white solid]Methylene group]-2-methylpropane-2-sulfinamide.

THF (2.0L), Zn (1.02kg,15595.945mmol,20.00 equivalents), CuCl (115.80g,1169.696mmol,1.50 equivalents), ethyl 2-bromoacetate (325.57g,1949.498mmol,2.50 equivalents), (S) -N- [ [4- (benzyloxy) -3-fluorophenyl ] methylene ] -2-methylpropane-2-sulfinamide (260.00g,779.797mmol,1.00 equivalents) were placed in a 3-L round bottom flask purged and maintained with a nitrogen inert atmosphere. The resulting solution was stirred in a water/ice bath at 0 ℃ for 30 min. The resulting solution was allowed to react for an additional 2h with stirring while maintaining the temperature at 50 ℃ in an oil bath. The solid was filtered off. The resulting mixture was concentrated. The reaction was then quenched by the addition of 2L water and extracted with 2x2L ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This gave 150g (45.63%) of ethyl (3R) -3- [4- (benzyloxy) -3-fluorophenyl ] -3- [ [ (S) -2-methylpropane-2-sulfinyl ] amino ] propionate as a yellow oil.

(3R) -3- [4- (benzyloxy) -3-fluorophenyl ] is placed in a 1-L round bottom flask]-3- [ [ (S) -2-methylpropane-2-sulfinyl group]Amino group]Ethyl propionate (150.00g,355.847mmol,1.00 equiv.), HCl in 1, 4-dioxane (400.00mL, 4M). The resulting solution was stirred at 25 ℃ for 2 h. The resulting mixture was concentrated. The reaction was then quenched by the addition of 1L of water. By using NaHCO₃The pH was adjusted to 8. The resulting solution was extracted with 2 × 1L ethyl acetate, dried over anhydrous sodium sulfate and concentrated. This gave 100g (88.55%) of (3R) -3-amino-3- [4- (benzyloxy) -3-fluorophenyl ] as a yellow oil]Ethyl propionate.

(3R) -3-amino-3- [4- (benzyloxy) -3-fluorophenyl ] group in 2-L round bottom flask]Ethyl propionate (100.00g,315.100mmol,1.00 equiv.), THF (1.00L), 2-dimethoxyacetaldehyde (49.21g,472.696mmol,1.50 equiv.), NaBH (OAc)₃(133.57g,630.199mmol,2.00 equiv.). The resulting solution was stirred at 25 ℃ for 2 h. The reaction was then quenched by the addition of 1L of water. The resulting solution was extracted with 2 × 1L ethyl acetate and filtered over Na₂SO₄Dried and concentrated under vacuum. This gave 80g (62.62%) of (3R) -3- [4- (benzyloxy) -3-fluorophenyl ] as a yellow oil]-3- [ (2, 2-dimethoxyethyl) amino group ]Ethyl propionate.

Into a 2-L3-necked round-bottomed flask were placed triphosgene (22.25g,74.975mmol,0.38 eq.), THF (500mL), (3R) -3- [4- (benzyloxy) -3-fluorophenyl)]-3- [ (2, 2-dimethoxyethyl) amino group]Ethyl propionate (80.00g,197.304mmol,1.00 equiv.), TEA (29.95g,295.956mmol,1.50 equiv.), 3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propan-1-amine (compound 177,33.97g,177.573mmol,0.90 equiv.). The resulting solution was stirred in an oil bath at 50 ℃ for 1 h. The reaction was then quenched by the addition of 1L of water. By using NaHCO₃The pH was adjusted to 8. The resulting solution was extracted with 2 × 1L ethyl acetate, dried over anhydrous sodium sulfate and concentrated. This gave 96g (78.13%) of (3R) -3- [4- (benzyloxy) -3-fluorophenyl as a yellow crude oil]-3- [ (2, 2-Dimethoxyethyl) ([ [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl ] methyl ester]Carbamoyl radical]) Amino group]Ethyl propionate.

In a 1000-mL round-bottom flask was placed (3R) -3- [4- (benzyloxy) -3-fluorophenyl ] group]-3- [ (2, 2-Dimethoxyethyl) ([ [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl ] methyl ester]Carbamoyl radical]) Amino group]Ethyl propionate (96.00g,154.158mmol,1.00 equiv.), THF (500.00mL), H₂SO₄(180.00mL, 2M). The resulting solution was stirred at 25 ℃ for 16 h. The pH was adjusted to 8 with NaOH (5M). The resulting solution was extracted with 2 × 1L dichloromethane, dried over anhydrous sodium sulfate and concentrated. The residue was applied to a silica gel column together with dichloromethane/methanol (50/1). The collected fractions were combined and concentrated. This gave 73g (84.76%) of (3R) -3- [4- (benzyloxy) -3-fluorophenyl ] as a yellow oil ]-3- [ 2-oxo-3- [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl]-2, 3-dihydro-1H-imidazol-1-yl]Ethyl propionate.

(3R) -3- [4- (benzyloxy) -3-fluorophenyl ] is placed in a 3-L round bottom flask]-3- [ 2-oxo-3- [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl]-2, 3-dihydro-1H-imidazol-1-yl]Ethyl propionate (73.00g,130.671mmol,1.00 equiv.), EtOH (1.50L), Pd (OH)₂C (60.00g,427.259mmol,3.27 equiv.), H₂(50 atmospheres). The resulting solution was stirred at 25 ℃ for 72 h. The solid was filtered off. The residue was applied to a silica gel column together with dichloromethane/methanol (9/1). The collected fractions were combined and concentrated. This gave 41.0415g (66.75%) of (3R) -3- (3-fluoro-4-hydroxyphenyl) -3- [ 2-oxo-3- [3- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) propyl as a yellow oil]Imidazolidin-1-yl radical]Ethyl propionate.

LCMS-PH-ARP-052-0:[MS+1]+＝471

Optically active [ a ]]_D ^20.0= 37.5 ° (C ═ 1g/100ml in MeOH)

H-NMR:(300MHz,DMSO-d₆,ppm)δ9.84(s,1H),7.07-7.00(m,2H),6.95-6.850(m,2H),6.24(d,2H),5.18(t,1H),4.06-3.96(m,2H),3.32-2.75(m,10H),2.60(t,2H),2.37(t,2H),1.77-1.67(m,4H),1.10(t,3H)。

At-10 ℃ to PPh₃To the solution in THF was added dropwise a solution of DEAD. The mixture was warmed to room temperature and compound 185 and HO-PEG were added₄-N₃And stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel, eluting with a gradient of MeOH in DCM to give compound 186.

Addition of EtOH and H to Compound 186₂O, followed by addition of LiOH. The mixture was stirred at 30 ℃ overnight. After completion, the mixture was neutralized to pH 5 using 6M aqueous HCl and concentrated. The residue was purified by reverse phase HPLC on a Phenomenex Gemini C18,50x250mm,10 μm column eluting with a gradient of acetonitrile in water containing 0.1% TFA to yield compound 187 (structure 2.11C).

Structure 28c (compound 118a) synthesis of structure 29c (compound 118b), structure 31c (compound 119a) and structure 30c (compound 119 b).

To a solution of LHMDS (1.0M in THF, 95mL,95mmol) and THF (60mL) at-78 deg.C was added dropwise compound 103 (2-methyl- [1, 8)]Naphthyridine (12.5g,86.7mmol)) in THF (180 mL). After stirring for 30 minutes, a solution of compound 104 (5-bromo-1-pentene (19.4g,130mmol)) in THF (120mL) was added dropwise to the reaction mixture. The reaction mixture was warmed to 0 ℃ and stirred for 4 hours. The reaction mixture was washed with saturated NH₄Aqueous Cl (100mL) and deionized water (100mL) were quenched and then extracted with ethyl acetate (2 × 400 mL). The combined organic phases are passed over Na₂SO₄Drying, filtering, concentrating, and passing compound 105 throughSeparate and elute with a gradient of 50-100% ethyl acetate in hexanes. Yield of compound 105 7.93g (43%).

To a solution of compound 105(2.50g,11.8mmol) in acetone (67.5mL), water (7.5mL) and 2,6 lutidine (2.74mL,23.6mmol) was added 4-methylmorpholine N-oxide (2.07g,17.7mmol) and osmium tetroxide (2.5 wt% in t-butanol, 2.40g,0.24mmol) at room temperature. After stirring for 75 min, (diacetoxyiodo) benzene (5.69g,17.7mmol) was added to the reaction mixture. The reaction mixture was stirred for 2 hours, then quenched with saturated aqueous sodium thiosulfate (100mL) and extracted with ethyl acetate (2 × 100 mL). The combined organic phases are passed over Na₂SO₄Drying, filtering, concentrating, and passing compound 106 throughSeparate and elute with a gradient of 0-5% methanol in ethyl acetate. Yield of compound 106 1.12g (44%).

To a suspension of sodium hydride (60% dispersion in mineral oil, 0.185g,4.64mmol) in THF (9mL) at 0 ℃ was added a solution of compound 107 diethyl ((N-methoxy-N-methylcarbamoylmethyl) phosphonate) (1.06g,4.43mmol) in THF (5 mL). After stirring for 30 min, a solution of compound 106(0.903g,4.21mmol) in THF (9mL) was added dropwise. The reaction mixture was stirred at 0 ℃ for 10 minutes and then saturated NH₄Aqueous Cl (30mL) was quenched and extracted with ethyl acetate (3 × 30 mL). The combined organic phases were washed with half-saturated NaHCO ₃The aqueous solution was washed 2 times. Passing the organic phase over Na₂SO₄Dried, filtered, and concentrated. Yield of compound 108: 1.40g (assuming 100% yield and used in subsequent steps without further purification).

To a solution of compound 108(1.31g,4.38mmol) in ethyl acetate (20mL) was added Pd/C (10% loading, 0.466g,0.44 mmol). The reaction vessel is filled with H₂Pressurized to 50 PSI. After stirring for 3.5 hours, the reaction mixture was stirred atFiltered and washed with methanol. The filtrate is concentrated and the compound 109 is passedSeparate and elute with a gradient of 50-100% ethyl acetate in hexane containing 1% triethylamine. Yield of compound 109 0.833g (62%).

To a solution of compound 109(0.833g,2.73mmol) in THF (10mL) was added DIEA (0.590mL,3.41mmol) and di-tert-butyl dicarbonate (0.744g,3.41 mmol). The reaction mixture was heated to 50 ℃ for 5 hours. Based on LC/MS, the reaction was incomplete and an additional portion of DIEA (0.590mL,3.41mmol) and di-tert-butyl dicarbonate (0.744g,3.41mmol) were added. The reaction mixture was heated at 50 ℃ for another 16 hours. The reaction mixture was concentrated and passed throughCompound 110 was isolated and eluted with a gradient of 50-100% ethyl acetate in hexanes. Yield of compound 110 0.934g (84%).

To a solution of n-butyllithium (2.5M in hexane, 0.70mL,1.8mmol) and THF (1.5mL) was added dropwise a solution of compound 111 (5-bromo-2- (phenylmethoxy) -pyridine) (0.465g,1.8mmol) in THF (0.8mL) at-78 deg.C over 3 minutes. Then a solution of compound 110(0.535g,1.3mmol) in THF (1mL) was added. After stirring for 30 minutes, the reaction was warmed to 0 ℃ with saturated NH₄Aqueous Cl (10mL) was quenched and further acidified to pH 7 with 6M aqueous HCl. The mixture was extracted with ethyl acetate (3 × 10 mL). The combined organic phases are passed over Na₂SO₄Dried, filtered, and concentrated. To a solution of the crude in THF (8mL) was added DIEA (0.94mL,5.4mmol) and di-tert-butyl dicarbonate (1.18g,5.4 mmol). The mixture was stirred at 40 ℃ overnight. The reaction mixture was concentrated and passed throughCompound 112 was isolated and eluted with a gradient of 0-40% ethyl acetate in hexanes. Yield of compound 112: 471mg (50%).

To a suspension of sodium hydride (60% dispersion in mineral oil, 0.106g,2.65mmol) in dimethoxyethane (2mL) was added a solution of compound 113 (triethyl phosphonoacetate) (0.593g,2.65mmol) in dimethoxyethane (1mL) at 0 ℃. After stirring for 20 min, the reaction mixture was warmed to room temperature and a solution of compound 112(0.467g,0.88mmol) in dimethoxyethane (2mL) was added. The reaction mixture was heated at 70 ℃ for 4 hours. With saturated NH ₄The reaction was quenched with aqueous Cl (10mL) and the product was extracted with ethyl acetate (3 × 15 mL). Passing the organic phase over Na₂SO₄Drying, filtering, concentrating, and passing compound 114 throughThe 1:1 mixture was separated as the cis: trans isomer, eluting with a gradient of 0-30% ethyl acetate in hexanes. Yield of compound 114: 392mg (74%).

To a solution of compound 114(390mg,0.65mmol) in ethanol (6mL) was added Pd/C (10% loading, 69mg,0.07 mmol). The reaction vessel is filled with H₂Pressurized to 50 PSI. After stirring for 4 hours, the reaction mixture is stirred atFiltered and washed with methanol. The filtrate is concentrated and the compound 115 is passedThe separation was a racemic mixture, eluting with a gradient of 0-10% methanol in DCM. Yield of compound 115 95mg (29%). Chiral semi-preparative HPLC (250X21 mm) was usedAD column, 5 μm,90/10 Hexane/EtOH, 40mL/min) separated 42mg of the first eluting R-isomer (R_T＝12-14m,>99% ee, Compound 115a) and 40mg of the second eluting S-isomer (R)_T＝15-18m,>98% ee, compound 115 b). The identities of the R-and S-isomers were assigned based on the elution order reported by Coleman et al 47j. med. chem.4834(2004) for structurally similar compounds.

Structure 28c ((R) -3- (6- (2- (2- (2- (2-azidoethoxy) ethoxy) pyridine- 3-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) nonanoic acid and 31c ((R) -3- (1- (2- (2- (2- (2-azidoethylethyl) azide) Oxy) ethoxy) ethyl) -6-oxo-1, 6-dihydropyridin-3-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridine- 2-yl) nonanoic acid

To compound 115a (41mg,0.08mmol) and N₃-PEG₄To a solution of OTs (61mg,0.16mmol) in DMF (0.5mL) was added cesium carbonate (53mg,0.16 mmol). The reaction mixture was stirred at 40 ℃ for 1 hour. The reaction mixture was washed with NaHCO₃Aqueous solution (1mL) was quenched and then extracted with ethyl acetate (3 × 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of the N-and O-alkylated positional isomers was subsequently used without further purification.

To a solution of compounds 116a and 117a (58mg,0.08mmol, 4:6 mixture of 9a:10 a) in THF (1.0mL) and deionized water (1.0mL) was added lithium hydroxide (6mg,0.25 mmol). The reaction mixture was stirred at room temperature for 1 hour, and then at 35 ℃ for 2 hours. Another portion of lithium hydroxide (4mg,0.16mmol) was added and the reaction temperature was raised to 40 ℃. After stirring for 3 hours, the last portion of lithium hydroxide (4mg,0.25mmol, ca. 16mg,0.66mmol) was added. The reaction mixture was stirred at 50 ℃ for 3 hours. The reaction mixture was acidified to pH7 with 6N aqueous HCl and concentrated under reduced pressure And (4) shrinking. By passingThe regioisomeric compounds 118a and 119a were separated, eluting with a gradient of 0-5% methanol in DCM containing 0.5% acetic acid. Compound 118a was purified by reverse phase HPLC (Thermo Scientific)^TM Aquasil^TMC18,250x21.2mm,5 μm,20mL/min, 0.1% TFA in water/ACN, gradient elution) further purified to yield 13mg of compound 118a (structure 28 c). Compound 119a was purified under the same conditions to yield 16mg of compound 119a (structure 31 c).

Structure 29c ((S) -3- (6- (2- (2- (2- (2-azidoethoxy) ethoxy) pyridine- 3-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) nonanoic acid and 30c ((S) -3- (1- (2- (2- (2- (2-azidoethylethyl) azide) Oxy) ethoxy) ethyl) -6-oxo-1, 6-dihydropyridin-3-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridine- 2-yl) nonanoic acid

To compound 115b (40mg,0.08mmol) and N₃-PEG₄To a solution of OTs (58mg,0.16mmol) in DMF (0.5mL) was added cesium carbonate (51mg,0.16 mmol). The reaction mixture was stirred at 40 ℃ for 30 minutes. The reaction mixture was washed with NaHCO₃Aqueous solution (1mL) was quenched and then extracted with ethyl acetate (3 × 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of the N-and O-alkylated positional isomers was subsequently used without further purification.

To a solution of compounds 116b and 117b (56mg,0.08mmol, 4:6 mixture of 9a:10 a) in THF (0.75mL) and deionized water (0.75mL) was added lithium hydroxide (6mg,0.25 mmol). The reaction mixture was stirred at 45 ℃ for 2.5 hours. Adding another part of lithium hydroxide (6mg,0.25mmol) and the reaction mixture is stirred for 2.5 hours. The reaction temperature was lowered to 35 ℃ and the mixture was stirred overnight. The reaction mixture was acidified to pH 7 with 6N aqueous HCl and concentrated under reduced pressure. Positional isomer compounds 118b and 119b were separated by CombiFlash, eluting with a gradient of 0-5% methanol in DCM containing 0.5% acetic acid. Compound 118b was purified by reverse phase HPLC (Thermo Scientific)^TM Aquasil^TMC18,250x21.2mm,5 μm,20mL/min, 0.1% TFA in water/ACN, gradient elution) further purified to yield 14mg of compound 118b (structure 29 c). Compound 119b was purified under the same conditions to yield 18mg of compound 119b (structure 30 c).

Synthesis of Structure 32c ((R) -3- (4- (2- (2- (2-azidoethoxy) ethoxy) -3-fluorophenyl) -3- (N-methyl-5- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) pentanamido) propanoic acid)

To pass throughTo a solution of sieved compound 120(2.75g,11.94mmol) in toluene (80mL) was added compound 121(5.79g,47.78mmol), followed by PPTS (300mg,1.19mmol) and then AcOH (683uL,11.94 mmol). The reaction was refluxed overnight. After completion, the reaction was quenched by addition of saturated sodium bicarbonate. The organic layer was diluted with 2 volumes of ethyl acetate, separated, and filtered over sodium sulfate. The product was isolated on silica gel eluting with a gradient of ethyl acetate (0-30%) in hexanes to give 2.054g (54%).

To a solution of DIA (2.85mL,20.33mmol) in THF (15mL) at-78 deg.C was added dropwise a 2.5M solution of n-BuLi (7.76mL,19.41 mmol). Stirring was continued at-78 ℃ for 5 minutes and ethyl acetate (1.81mL,18.48mmol) was added dropwise. Stirring was continued for another 10 minutes at-78 deg.C and a solution of titanium triisopropylchloride (9.27mL,38.381mmol) in THF (10mL) was added dropwise. Stirring was continued for an additional 15 minutes at-78 deg.C and a solution of compound 122(2.054g,6.16mmol) in THF (10mL) was added dropwise. Stirring was continued for 1.5 hours at-78 ℃. After completion, the reaction was quenched by addition of saturated ammonium bicarbonate. The suspension was diluted with 6 volumes of ethyl acetate and the organic layer was separated, dried over sodium sulfate, filtered and concentrated. The product was isolated on silica gel eluting with a gradient of ethyl acetate in hexane to yield 1.043g (53%).

To a stirred solution of compound 123(1.043g,2.47mmol) in MeOH (3mL) was added a 4M solution of HCl in dioxane (3.09mL,12.37 mmol). After complete deprotection, the solution was diluted with water (8mL) and washed 2 times with ether (6 mL). The aqueous layer was then adjusted to pH 11 with sodium hydroxide. The precipitate was extracted with ethyl acetate and the combined organic extracts were dried over sodium sulfate, filtered, and concentrated to yield 0.616g (78.5%) of product 124, which was used without further purification.

To a solution of compound 125(92.1mg,0.275mmol) in THF (1.5mL) at 0 deg.C was added DCC (68.1mg,0.331 mmol). After 5 min, PNP (106.1mg,0.331mmol) was added, the ice bath removed, and stirring continued for 1 h. After completion, the suspension was cooled to-20 ℃ for 1 hour, and the precipitate was removed by filtration. The supernatant was concentrated and yielded 129mg (103%) of crude product 126, which was subsequently used without further purification.

A mixture containing compound 124(148.6mg,0.468mmol) and potassium carbonate (129mg,0.937mmol) in DMF (2mL) was treated with iodomethane (66.5mg,0.468mmol) and stirred at 50 ℃ for 3 h. After the alkylation was complete, all volatiles were removed and the product was isolated on silica gel, eluting with a gradient of ethyl acetate in hexanes, each buffered with 1% TEA, yielding 94.6mg (61%).

To a solution of compound 127(94.5mg,0.285mmol) in DMF (2mL) was added DIEA (149uL,0.856mmol) followed by compound 126(129.9mg,0.285mmol) and the mixture stirred at 80 ℃ for 1 h. After completion, all volatiles were removed and the crude was dissolved in MeOH, treated with 10% palladium on charcoal (20mg), and the flask was sparged with 60PSI of hydrogen. After completion, the suspension was filtered. The supernatant was concentrated and the resulting crude product was subsequently used without further purification.

Compound 128(159mg,0.285mmol) in DMF (2mL), bromo-PEG₂A mixture of-azide (74.7mg,0.314mmol) and cesium carbonate (204mg,0.627mmol) was heated to 60 ℃ for 2 hours. After completion, all volatiles were removed and the crude was treated with 4M HCl in dioxane (0.5mL,2mmol) and heated to 40 ℃ for 3 hours. After completion, all volatiles were removed. The crude was suspended in THF (1mL), MeOH (1.5mL), and H₂A mixture of O (1.5mL) was treated with lithium hydroxide (83.5mg,3.48mmol) and heated to 40 ℃ for 16 h. After completion, the pH was adjusted to 3 with TFA and the product was passed overThe separation was performed on a C18 column (21.2x250mm,5 microns) eluting with a gradient of acetonitrile in water containing 0.1% TFA to yield 33.1mg (20%).

Synthesis of structure 33c ((R) -1-azido-13- (3-fluoro-4-methoxyphenyl) -12- (5- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) pentanoyl) -3,6, 9-trioxa-12-azapentadecane-15-oic acid)

A mixture containing compound 130(1.5g,9.73mmol), (R) tert-butylsulfinamide (2.36g,19.46mmol) and AcOH (0.14mL) in toluene (45mL) was refluxed in a flask equipped with a Dean-Stark trap for 16 hours. After completion, the reaction was quenched by addition of saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered and concentrated. The product was isolated by separation on silica gel eluting with a gradient of ethyl acetate in hexane to yield 1.714g (68.4%).

To a solution of DIA (3.056mL,21.80mmol) in THF (18mL) at-78 deg.C was added dropwise a 2.5M solution of n-BuLi (8.324mL,20.81 mmol). Stirring was continued at-78 ℃ for 5 minutes and ethyl acetate (1.94mL,19.82mmol) was added dropwise. Stirring was continued for another 10 minutes at-78 deg.C and a solution of titanium triisopropylate chloride (9.94mL,41.62mmol) in THF (10mL) was added dropwise. Stirring was continued for a further 15 minutes at-78 ℃ and a solution of compound 131(1.70g,6.61mmol) in THF (12mL) was added dropwise. Stirring was continued for 1.5 hours at-78 ℃. After completion, the reaction was quenched by addition of saturated ammonium bicarbonate. The suspension was diluted with 7 volumes of ethyl acetate and the organic layer was separated, dried over sodium sulfate, filtered and concentrated. The product was isolated on silica gel eluting with a gradient of ethyl acetate in hexane to yield 0.984g (43%).

To a solution of compound 132(0.975g,2.82mmol) in EtOH (6mL) at 0 deg.C was added 4M HCl in dioxane (2.12mL,8.47mmol) and stirred for 30 min. After completion, the reaction was diluted with water (15mL) and washed with ether. The organic layer was separated and the aqueous layer was adjusted to pH 12 with sodium hydroxide. The aqueous layer was washed with 5 volumes of ethyl acetate and the organic layer was separated, filtered over sodium sulfate and concentrated. The product was isolated by separation on silica gel eluting with a gradient of ethyl acetate in hexane containing 1% TEA to yield 0.434g (64%).

To pass throughTo a mixture of molecular sieve compound 133(0.120g,0.497mmol) and PEG (0.151g,0.696mmol) in THF (2mL) was added STAB-H (0.253g,1.19mmol), and the suspension was stirred at room temperature for 16H. After completion, the reaction was quenched by addition of saturated sodium bicarbonate and the crude was extracted with three portions of ethyl acetate. The separated organic extracts were combined, dried over sodium sulfate, filtered and concentrated. The crude obtained was subsequently used without further purification.

Compound 134(0.200g,0.597mmol) in DMF (2mL) was treated with HATU (0.227g,0.597mmol) and stirred for 5 min. To the activated ester was added DIEA (0.259mL,1.49mmol) followed by compound 125(0.220g,0.497mmol) in DMF (1mL) and the resulting mixture was stirred for 1 h. All volatiles were removed and the resulting crude was treated with neat TFA (3.8mL) and stirred at 40 ℃ for 3 hours. After the end of the BOC removal, all volatiles were removed and the crude was suspended in a mixture of THF (4mL), water (8mL) and MeOH (8 mL). The resulting mixture was treated with LiOH (71.6mg,2.98mmol) and heated to 40 ℃ for 16 hours. After completion, the pH was adjusted to 3 with TFA, and Passing the product throughThe separation was performed on a c18 column (21.2 × 250mm,5 μm) eluting with a gradient of acetonitrile in water containing 0.1% TFA to yield 56.2mg (18%, 3-steps).

Synthesis of structure 34c ((S) -1-azido-13- (3-fluoro-4-methoxyphenyl) -12- (5- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) pentyl) -3,6, 9-trioxa-12-azapentadecane-15-oic acid)

Compound 136(0.500g,1.45mmol) in a mixture of THF (9.0mL) and MeOH (0.5mL) was treated with lithium borohydride (94.5mg,4.34mmol) at 0 deg.C. The cooling was removed and stirring was continued until gas formation ceased. The reaction mixture was diluted with 5 volumes of EtOAc. The organic layer was washed with ammonium bicarbonate, dried over sodium sulfate, filtered, and concentrated. The product was isolated by elution on silica gel using a gradient of ethyl acetate in hexanes to yield 309mg (67%).

To a solution containing compound 137(0.305g,0.952mmol) in DCM (9mL) was added the Martin's reagent in portions at 0 deg.C. A few drops of water were added, the cooling removed, and the reaction stirred for 3 hours. After completion, the mixture was washed with saturated sodium bicarbonate and then with saturated sodium thiosulfate. The separated organic layer was dried over sodium sulfate, filtered and concentrated. Product 138 was isolated on silica gel eluting with a gradient of MeOH in DCM to yield 140mg (46%).

To pass throughSTAB-H (0.150g,0.706mmol) was added to a mixture of molecular sieves containing Compound 1(85.2mg,0.353mmol) and 138(134.9mg,0.424mmol) in THF (2.5mL) and the resulting suspension was heated to 40 ℃ for 16H. After completion, the reaction was diluted with 5 volumes of ethyl acetate and treated with saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered and concentrated. The product was isolated by separation on silica gel eluting with a gradient of MeOH in DCM containing 1% TEA to give 64mg (33%).

To pass throughCompound 140(60mg,0.110mmol) on molecular sieves in MeOH (1mL), Ald-PEG₃-N₃To a mixture of (71.9mg,0.331mmol) and AcOH (3. mu.L, 0.0276mmol) was added sodium cyanoborohydride (28.9mg,0.276mmol) and the reaction was stirred at 40 ℃ for 3 h. After completion, the mixture was cooled to 0 ℃, water (0.15mL) was added, and the solution was acidified to pH7 using a solution of HCl (4M) in dioxane. All methanol was then removed, a solution of 4M HCl (0.138mL,0.552mmol) in dioxane was added, and the mixture was stirred at 40 ℃ for 2 hours. After the end of the BOC removal, all volatiles were removed and the crude was suspended in a mixture of THF (1mL), water (2mL) and MeOH (2mL) and treated with lithium hydroxide (26.5mg,1.104 mmol). After the end of the ester removal, the pH was adjusted to 3 by addition of TFA and the product was passed over (21.2X250mm) separation on a C18 column eluting with a gradient of acetonitrile in water containing 0.1% TFA to give 16.4mg (24%, 3-steps).

Synthesis of structure 36c ((S) -3- (4- (2- (2- (2- (2-azidoethoxy) ethoxy) -3-fluorophenyl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) nonanoic acid)

To a solution of 6-oxoheptanoic acid (9.74g,68mmol) in DCM (30mL) and MeOH (75mL) at room temperature was added concentrated H₂SO₄(0.18mL,3.4 mmol). The reaction mixture was refluxed overnight. The reaction mixture was then concentrated to an oil, redissolved in DCM (150mL) and saturated NaHCO₃Aqueous (2 × 40mL) and brine (40 mL). Subjecting the organic layer to Na₂SO₄Dried, filtered, and concentrated. The product was used in the next step without further purification. Yield of compound 141: 10.2g (95%).¹H NMR(400MHz,DMSO-d6):δ3.58(s,3H),2.43(t,2H),2.29(t,2H),1.46(m,4H)。

To a solution of compound 141(10.2g,65mmol) and 2-amino-3-formylpyridine (7.89g,65mmol) in EtOH (80mL) was added L-proline (3.72g,32 mmol). The reaction mixture was heated at reflux overnight. The reaction mixture was then concentrated, dissolved in EtOAc (50mL) and washed with water (3 × 30 mL). Passing the organic phase over Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluted with a gradient of EtOAc in DCM (10-100%). Yield of compound 142 6.08g (39%). C ₁₄H₁₆N₂O₂[M+H]⁺245.13, and 245.21.

To a solution of compound 142(6.08g,24.9mmol) in MeOH (50mL) was added Pd/C (10% loading, Degussa type, 1.99g,1.87 mmol). The reaction flask was aerated with nitrogen, evacuated, and charged withNitrogen was backfilled 3 times. The procedure was repeated with hydrogen and the reaction vessel was finally aerated with hydrogen (1 atm) and stirred at room temperature overnight. The reaction mixture is added inFilter, rinse the pad with MeOH, and concentrate the filtrate. Assuming 100% yield, the product compound 143 was used in the next step without further purification. C₁₄H₂₀N₂O₂[M+H]⁺249.16, and 249.08.

To a solution of dimethyl methylphosphonate (12.3g,100mmol) in dry THF (120mL) was added n-BuLi solution (2.5M in hexane, 40mL,100mmol) by syringe pump at-78 deg.C over 1 h. A solution of compound 143(6.175g,24.9mmol) in THF (40mL) was added to the reaction mixture at-78 deg.C over 45 minutes. After stirring at-78 ℃ for 20 minutes, the reaction mixture was saturated with NH₄Aqueous Cl (200mL) was quenched, warmed to room temperature, and extracted with EtOAc (400 mL). The organic layer was washed with water (200mL) and brine (200 mL). Separating the organic phase over Na₂SO₄Dried, filtered, and concentrated. The product was used in the next step without further purification. Yield of compound 144 7.86g (93%). C ₁₆H₂₅N₂O₄P[M+H]⁺341.17, and 341.17.

A suspension of 3-fluoro-4- (phenylmethoxy) -benzaldehyde (0.38g,1.65mmol), compound 144(0.67g,1.98mmol) and anhydrous potassium carbonate (0.547g,3.96mmol) in THF (13.5mL) was heated at reflux overnight. Additional 3-fluoro-4- (phenylmethoxy) -benzaldehyde (0.19g,0.83mmol) and potassium carbonate (0.23g,1.65mmol) were added and the reaction mixture was refluxed for an additional 4 h. The mixture was washed with EtOAc (100mL)Diluted and washed with water (30mL) and brine (30 mL). Separating the organic phase over Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluted with a gradient of MeOH in DCM (0-10%). Yield of compound 145: 446mg (61%). C₂₈H₂₉FN₂O₂[M+H]⁺445.23, and 445.41.

Preparation of R-BINAL: to a slurry of LAH (0.396g,10.4mmol,0.98 equiv.) in dry THF (34mL) was added a solution of EtOH (0.492g,10.65mmol,1.00 equiv.) in THF (3.2mL) over 10 minutes while maintaining an internal temperature <35 ℃. After 30 minutes of aging, a solution of R-BINOL (3.05g,10.65mmol,1.00 equiv.) in THF (10mL) was added maintaining the internal temperature <35 deg.C (about 10 minutes). After stirring at room temperature for 2h, the reaction mixture was cooled to-78 ℃ on a dry ice/acetone bath.

Compound 145(1.18g,2.65mmol) was azeotropically dried with anhydrous toluene (50mL) and dissolved in anhydrous THF (12 mL). A solution of compound 145 was added dropwise to a solution of R-BINAL via a syringe pump at-78 ℃ over 45 minutes. After 1.5h, the reaction vessel was transferred to a very large dewar (lower) filled with dry ice/acetone and covered with aluminum foil. The reaction mixture was stirred at-78 ℃ overnight. Most of the reduction took place within the first 1.5h, with only a small additional conversion overnight. The reaction mass was adjusted by adding saturated NH₄Aqueous Cl (150mL) was quenched and warmed to room temperature. The mixture was further acidified to pH 7 using 6N HCl and then extracted with EtOAc (2x250 mL). The combined organic phases were washed with water (125mL) and brine (125 mL). Passing the organic phase over Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of MeOH in DCM (0-5%). Yield of compound 146: 634mg (53%). By analytical chiral HPLC, Chiralpak AD-H column 4.6X250mm,5 micron, EtOH 0.1% diethylamine isocratic, 1.75mL/min,the chiral purity was determined. The first eluting R isomer was 86 area% pure, corresponding to 72% ee. Compound 146 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H21.2 x250mm,5 μm, EtOH 0.1% diethylamine, 20 mL/min). Final yield of compound 146: 445mg (98% ee). C ₂₈H₃₁FN₂O₂[M+H]⁺447.25, and 447.30.

To a solution of compound 146(0.325g,0.73mmol) and monomethyl malonate (0.103g,0.87mmol) in DCM (3mL) was added a solution of DMAP (9mg,0.073mmol) in DCM. The mixture was cooled to 0 ℃ and DCC (0.180g,0.87mmol) was added. The cooling bath was removed and the reaction was stirred at room temperature overnight. The reaction mixture was then diluted with DCM (10mL) and filtered. The filtrate was concentrated and purified by CombiFlash using silica gel as stationary phase eluting with a gradient of MeOH (0-5%) in DCM. Yield of compound 147 142mg (37%). C₃₂H₃₅FN₂O₅[M+H]⁺547.26, and 547.58.

To a solution of compound 147(0.232g,0.42mmol) in NMP (0.5mL) was added N, O-bis (trimethylsilyl) acetamide (0.229g,1.12mmol) at room temperature. The mixture was heated at 60 ℃ for 30 minutes. Brine (58 μ L) was added in two portions over 5 minutes. The reaction mixture was then heated at 90 ℃ for 3h, then at room temperature overnight. The reaction mixture was diluted with EtOAc (12mL) and washed with water (3 mL). The aqueous layer was back-extracted with EtOAc (12 mL). The combined organic layers were concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of MeOH in DCM. Yield of compound 148: 140mg (66%). C ₃₁H₃₅FN₂O₃[M+H]⁺503.27, trueMeasurement of 503.29.

To a solution of compound 148(0.169g,0.34mmol) in EtOH (3mL) was added a slurry of Pd/C (10% loading, 36mg,0.034mmol) in EtOH (1 mL). The reaction vessel was pressurized and vented 3 times with hydrogen. The reaction vessel was repressurized to 55psi for 3 h. The reaction mixture was diluted with MeOH (5mL) and filtered. The filtrate was concentrated and the product compound 149 was used in the next step without further purification, assuming 100% yield. C₂₄H₃₁FN₂O₃[M+H]⁺415.24, and 415.07.

To compound 149(139mg,0.34mmol) and azido-PEG₄To a solution of tosylate (0.188mg,0.50mmol) in DMF (2.5mL) was added cesium carbonate (164mg,0.50 mmol). The reaction mixture was heated at 40 ℃ for 1h and then saturated NaHCO₃Aqueous solution (3mL) was quenched. The mixture was extracted with EtOAc (3 × 10 mL). The combined organic phases were washed with water (2 × 5 mL). Passing the organic phase over Na₂SO₄Dried, filtered, concentrated and used in the next step without further purification. C₃₂H₄₆FN₅O₆[M+H]⁺616.35, and 616.90.

To a solution of compound 150(0.207mg,0.34mmol) in THF (1.5mL) and water (1.5mL) was added lithium hydroxide (0.040g,1.68 mmol). The reaction mixture was heated to 40 ℃ overnight. The next morning, the reaction mixture was acidified to pH 7 with 6N HCl and concentrated under reduced pressure. The residue was dissolved in 35% ACN/H ₂O, 0.1% TFA, and by RP-HPLC (Thermo A)quasil C18,250x21mm,5 μm,20mL/min, ACN in H containing 0.1% TFA₂Gradient in O). Yield of compound 151(SM 36): 125mg (52%, over 3 steps). C₃₁H₄₄FN₅O₆[M+H]⁺602.34, and 602.85.

Synthesis of Structure 37c ((S) -3- (4- (2- (2- (2- (2-azidoethoxy) ethoxy) -3-fluorophenyl) -3- (5- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) pentanamido) propanoic acid)

Compound 169(90mg,0.268mmol) in DMF (1.5mL) was treated with HATU (112mg,0.295mmol) and stirred for 5 min. A mixture containing compound 170(94mg,0.295mmol) and DIEA (0.154mL,0.884mmol) in DMF (0.5) was then added and stirring was continued for 1 h. After completion, all volatiles were removed and compound 171 was isolated by separation on silica gel, eluting with a gradient of MeOH in DCM, yielding 123mg (72%).

A suspension containing 10% palladium on charcoal (21mg,0.0194mmol) and compound 171(123mg,0.194mmol) in MeOH (2mL) was sparged with 60PSI hydrogen and stirred for 1 h. After finishing, the suspension is addedFiltered and concentrated to yield 88mg (83%) of crude which was then used without further purification.

Compound 172(87mg,0.160mmol) in DMF (1mL), Br-PEG₃-N₃(50mg,0.176mmol) and cesium carbonate (115mg,0.352mmol)The suspension was heated to 60 ℃ and stirred for 2 hours. After completion, all volatiles were removed and compound 173 was isolated by separation on silica gel, eluting with a gradient of MeOH in DCM, yielding 91mg (76%).

Compound 173(50mg,0.067mmol) in dioxane (0.5mL) was treated with a solution of 4MHCl (0.671mmol,0.168mL) in dioxane and stirred at 40 ℃ for 3 hours. After completion, all volatiles were removed. Dissolving the crude product in H₂A mixture of O (0.4mL), THF (0.2mL) and MeOH (0.4mL) was treated with LiOH (8mg,0.356mmol) and stirred at 40 ℃ for 16 h. After completion, the pH was adjusted to 3 with TFA and the product was isolated by separation on a Phenomenx Gemini C18 column (21.2x250mm,5 microns), eluting with a gradient of acetonitrile in water containing 0.1% TFA to yield 25mg (60%, 2-steps).

Synthesis of structure 38c ((S) -3- (2- (3- ((2- (2- (2-azidoethoxy) ethoxy) ethyl) amino) -3-oxopropyl) pyrimidin-5-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) nonanoic acid) and structure 39c ((S) -3- (2- (1-azido-12-oxo-3, 6, 9-trioxa-13-azahexadecan-16-yl) pyrimidin-5-yl) -9- (5,6,7, 8-tetrahydro-1, 8-naphthyridin-2-yl) nonanoic acid)

To a solution of 5-bromo-2-iodo-pyrimidine (8.00g,28.1mmol) in anhydrous THF (95mL) at-78 deg.C was added a solution of i-PrMgBr in THF (0.75M,56mL,42.0mmol) while maintaining the internal temperature<-70 ℃ (about 15 minutes). The resulting solution was then stirred for 15 minutes, then a solution of CuCN.2LiCl in THF (1M,31mL,31.0mmol) was added, and then a solution of allyl bromide (5.10g,42mmol) in THF (10mL) was added. The reaction mixture was warmed to room temperature and stirred for 1 h. The reaction mixture was quenched with MeOH (40mL) and concentrated. The residue was purified by CombiFlash, using silica gel as stationary phase and EtA gradient (0-20%) of OAc in hexane eluted. Yield of compound 152: 4.13g (74%). C₇H₇BrN₂[M+H]⁺198.99, and 199.05.

To a solution of compound 152(7.70g,38.7mmol) in THF (115mL) was added a solution of 9-BBN in THF (0.5M,131mL,65.8mmol) at 0 deg.C over 30 min. The reaction mixture was warmed to room temperature and stirred overnight. NaHCO was added to the reaction mixture at 0 deg.C₃(48.7g,580mmol) in water (100mL) followed by addition of NaBO₃Slurry of monohydrate (46.3g,464mmol) in water (100 mL). The cooling bath was removed and the mixture was stirred vigorously for 1 h. The reaction mixture was transferred to a separatory funnel and the layers were separated. The aqueous layer was extracted with EtOAc (200 mL). The organic phases were combined and washed with brine (100 mL). The brine layer was back-extracted with EtOAc (100 mL). The combined organic phases are passed over Na ₂SO₄Dried, filtered, and concentrated to yield about 15g of a crude yellow oil. The crude was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of EtOAc in hexanes (50-100%). Yield of compound 153 3.44g (41%). C₇H₉BrN₂O[M+H]⁺217.00, and 216.97.

To a solution of compound 153(3.44g,15.8mmol) in DCM (40mL) was added a solution of imidazole (1.73g,25.4mmol) and TBDPSCl (5.23g,19.0mmol) in DCM (12mL) at 0 deg.C. The reaction was warmed to room temperature and stirred overnight. The reaction mixture was diluted with DCM (75mL) and washed with water (50mL) and brine (50 mL). Subjecting the organic layer to Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of EtOAc (0-8%) in hexanes. Process for preparation of compound 154Yield 5.56g (77%). C₂₃H₂₇BrN₂OSi[M+H]⁺455.12, and 455.44.

To a solution of compound 154(6.07g,13.3mmol) in THF (150mL) at-75 deg.C was added dropwise a solution of nBuLi in THF (2.5M,5.6mL,14.0mmol) maintaining the internal temperature<-70 ℃ (about 10 minutes). After 3 minutes, a solution of ethyl formate (1.04g,1.13mL,14.0mmol) in THF (5mL) was added dropwise, maintaining the internal temperature <-70 ℃. The mixture was stirred at-78 ℃ for 20 min, then quenched with a solution of HCl in dioxane (4M,3.67mL,14.7mmol), further diluted with THF (5mL), maintaining internal temperature<-65 ℃. The cooling bath was removed and the reaction was warmed to ambient temperature and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of EtOAc in hexanes (0-20%). Yield of compound 155: 1.79g (33%).¹H NMR(400MHz,CDCl₃):δ10.09(s,1H),9.06(s,2H),7.64(m,4H),7.38(m,6H),3.77(t,2H),3.20(t,2H),2.17(q,2H),1.03(s,9H)。

To a solution of compound 144(1.68g,4.15mmol) and compound 155(1.70g,4.98mmol) in THF (25mL) was added K₂CO₃(0.861g,6.23 mmol). The reaction mixture was heated to 40 ℃ for 2.5h and then at 50 ℃ for 12 h. The reaction mixture was diluted with EtOAc (100mL) and washed with water (50mL) and brine (50 mL). Passing the organic phase over Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of EtOAc (0-100%) in hexane containing 1% triethylamine. Yield of compound 156 2.04g (79%). C₃₈H₄₆N₄O₂Si[M+H]⁺619.35, measured 619.69。

Preparation of R-BINAL: LAH (1.169g,30.8mmol) was slurried in dry THF (90 mL). To the slurry was added a solution of EtOH in THF (6M,5.2mL,31.4mmol) and the T was maintained _{Inner part}<At 40 ℃. The mixture was aged at 35 ℃ for 40 minutes and then cooled to 30 ℃. A solution of R- (binaphthol) (9.00g,31.4mmol) in THF (45mL) was added, maintaining the T_{Inner part}<At 40 ℃. The mixture was aged at 50 ℃ for 1h, cooled to ambient temperature, then heated to 50 ℃ and TMEDA (14.1mL,11.0g,94.3mmol) was added. The mixture was aged at 50 ℃ for 1h, cooled to ambient temperature, and then used with compound 156.

To a solution of R-BINAL (ca. 0.2M,110mL,22.0mmol) in THF was added a solution of compound 16(1.16g,1.88mmol) in THF (12mL) at-78 deg.C over 5 minutes. After 30 minutes, the reaction mixture was washed with saturated NH₄Aqueous Cl was quenched, warmed to room temperature, and the product was extracted with EtOAc (3 × 125 mL). Subjecting the organic layer to Na₂SO₄Dried, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of MeOH (0-5%) in EtOAc containing 1% triethylamine. Yield of compound 157 0.96g (82%). Chiral purity was determined by analytical chiral HPLC (Chiralpak AD-H column 4.6x250mm,5 micron, 25% EtOH, 75% hexane, 0.1% diethylamine isocratic, 2 mL/min). The second eluting R isomer was about 95 area% pure, corresponding to about 90% ee. C ₃₈H₄₈N₄O₂Si[M+H]⁺621.36, and 621.71.

To a solution of compound 157(0.925g,1.49mmol) in triethyl orthoacetate (9.25mL) was added a solution of propionic acid in trimethyl orthoacetate (0.15M,0.55mL,0.08 mmol). The reaction mixture was brought to 140 ℃ in a sealed flaskHeating for 1.5 h. The reaction mixture was concentrated and the residue was purified by CombiFlash using silica gel as stationary phase eluting with a gradient of EtOAc (0-50%) in hexane containing 1% triethylamine. Yield of compound 158 0.898g (87%). C₄₂H₅₄N₄O₃Si[M+H]⁺691.41, and 691.93.

To a solution of compound 158(0.893g,1.30mmol) in EtOH (10mL) was added a slurry of Pd/C (degree of loading: 10 wt%, 0.138g,0.13mmol) in EtOH (4 mL). The reaction mixture was aerated with 50psi H₂And stirred for 4.5 h. The reaction mixture was filtered, concentrated and used in the next step without further purification. Yield of compound 159: 0.885g (99%). C₄₂H₅₆N₄O₃Si[M+H]⁺693.42, and 693.82.

A solution of Boc anhydride (0.836g,3.83mmol) in THF (2.5mL) was added to compound 159(0.885g,1.28mmol) followed by a solution of DMAP (20mg/mL in THF, 155uL,0.0031g,0.026 mmol). The mixture was heated to 60 ℃ for 6 h. The reaction mixture was concentrated and the residue was purified by CombiFlash using silica gel as stationary phase eluting with a gradient of EtOAc (0-50%) in hexanes. Yield of compound 160: 0.721g (71%). C ₄₇H₆₄N₄O₅Si[M+H]⁺793.47, and 794.28.

To a solution of compound 160(0.621g,0.783mmol) in THF (6mL) at 0 deg.C was added a solution of TBAF in THF (1M,1.2mL,1.2 mmol). Will be reversedThe mixture was warmed to room temperature and stirred for 2 h. The reaction mixture was diluted with EtOAc (30mL) and saturated NH₄Aqueous Cl (2 × 10mL) washes. The organic layer was concentrated. The residue was purified by CombiFlash using silica gel as stationary phase and eluting with a gradient of EtOAc (50-100%) in hexanes. Yield of Compound 21 0.362g (83%). Chiral purity was determined by analytical chiral HPLC, Chiralpak AD-H column 4.6x250mm,5 micron, 20% EtOH, 80% hexane, 0.1% diethylamine, isocratic, 1.5 mL/min. The second eluting R isomer was 93% pure, corresponding to 86% ee. Compound 161 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H21.2 × 250mm,5 μm, 20% EtOH, 80% hexane, 0.1% diethylamine, 60 mL/min). Final yield of compound 161 308mg (99% ee). C₃₁H₄₆N₄O₅[M+H]⁺555.36, and 555.72.

To a solution of compound 161(0.030g,0.054mmol) in ACN (0.30mL) at room temperature was added BAIB (0.042g,0.130mmol) and TEMPO (2.5mg,0.016mmol), followed by water (0.30 mL). After 2 hours, the reaction mixture was concentrated. The residue was purified by RP-HPLC (Phenomenex Gemini cz1821.2x 250mm,5 μm, 0.1% TFA water/ACN, 30-80% ACN gradient). Yield of compound 162: 0.030g (97%). C ₃₁H₄₄N₄O₆[M+H]⁺569.34, and 569.68.

To compound 162(33mg,0.058mmol) and amino-PEG at 0 deg.C₂To a solution of azide (15mg,0.087mmol) in DMF (0.5mL) was added TBTU (32mg,0.099mmol) followed by DIEA (35. mu.L, 26mg,0.203 mmol). The reaction mixture was warmed to room temperature and stirred for 30 minutes. The reaction mixture was concentrated and the product compound 163 was used in the next step without purification. C₃₇H₅₆N₈O₇[M+H]⁺725.44, and 725.77.

To a solution of compound 163(42mg,0.058mmol) in THF (0.30mL) was added a 1M solution of LiOH (0.174mL,0.174 mmol). The reaction mixture was heated at 40 ℃ for 1 hour. Another portion of LiOH (0.174mL,0.174mmol) was added. After 3h, the reaction was stopped and another portion of LiOH (0.174mL,0.174mmol) was added. The reaction was stirred for an additional 2 hours (9 equivalents LiOH for 5 hours). The reaction mixture was neutralized to pH 5 using 3N HCl and concentrated. The residue was dissolved in TFA water [95:5 ]]Neutralized and stirred at room temperature for 2 hours. The reaction mixture was concentrated and the residue was purified by RP-HPLC (Phenomenex Gemini c 1821.2x 250mm,5 μm, water/ACN containing 0.1% TFA, 20-50% ACN gradient). Yield of compound 164 (structure 38c) 23mg (66%). C ₃₀H₄₄N₈O₅[M+H]⁺597.35, and 597.85.

To a solution of compound 161(30mg,0.054mmol) in THF (150. mu.L) was added diphenylphosphoryl azide (35. mu.L, 45mg,0.162mmol) at 0 ℃ followed by DBU (12. mu.L, 12mg,0.081 mmol). The reaction mixture was warmed to room temperature and stirred overnight. The next morning, the reaction mixture was heated at 60 ℃ for 7 h. The reaction mixture was concentrated and purified by RP-HPLC (Phenomenex Gemini c 1821.2x 250mm,5 μm, 0.1% TFA water/ACN, 32-60% ACN gradient). Yield of compound 165: 14mg (44%). C₃₁H₄₅N₇O₄[M+H]⁺580.36, and 580.66.

To a solution of compound 165(18mg,0.031mmol) in EtOH (100. mu.L) was added a slurry of Pd/C (10% loading, 3.3mg,0.003mmol) in EtOH (170. mu.L). The reaction vessel is filled with H₂Aerating, then evacuating 3 times, and then applying H₂(1 atmosphere) aeration. After 30 min, the reaction mixture was filtered, concentrated and used in the next step without further purification. Yield of compound 166 17mg (99%). C₃₁H₄₇N₅O₄[M+H]⁺554.37, and 554.73.

To compound 166(17mg,0.031mmol) and azido-PEG at room temperature₃To a solution of-NHS ester (14mg,0.040mmol) in DMF (170. mu.L) was added DIEA (16. mu.L, 12mg,0.092 mmol). The reaction mixture was stirred at room temperature for 1h, concentrated, and then used for the next step without purification. C ₄₀H₆₂N₈O₈[M+H]⁺783.48, and 783.84.

To a solution of compound 167(24mg,0.031mmol) in THF (180. mu.L) was added a 1M solution of LiOH (153. mu.L, 0.153 mmol). The reaction mixture was heated at 40 ℃. After 1 h, another portion of LiOH (153uL,0.153mmol,5 equiv.) was added. The reaction mixture was stirred at 40 ℃ for 3h, then at room temperature overnight. The reaction mixture was neutralized to pH 5 using 3N HCl and concentrated. The residue was dissolved in TFA water [95:5 ]]Neutralized and stirred at room temperature for 3 hours. The reaction mixture was concentrated and the residue was purified by RP-HPLC (Phenomenex Gemini c 1821.2x 250mm,5 μm, water/ACN containing 0.1% TFA, 15-45% ACN gradient). Yield of compound 168 (structure 39c) 9.8mg (49%). C₃₃H₅₀N₈O₆[M+H]⁺655.40, and 656.01.

Synthesis of pharmacokinetic enhancers

Mal-C22-diacid

Compound 1(0.200g) was combined with TBTU (0.182g) in 2mL DMF. DIPEA (0.207mL) was added dropwise. Then, compound 2(0.227g) was added after 5 minutes. The mixture was stirred for 1 hour. The mixture was then diluted with 40mL DCM and washed with 5% citric acid (4 × 30mL) and Na₂SO₄Dried, filtered and concentrated. The product was dried on a rotary evaporator and under high vacuum. The obtained solid is loaded in a drying way 12G onOn Rf column, Hex: EtOAc0 ═>80% over 30 minutes. Yield: 53mg (39.2%).

Compound 1 was reacted with toluene, 20% piperidine in DMF and Et₃The N mixture was azeotropically distilled 2 times together. The yield was 50 mg.

Compound 1(0.0350g) and 2(0.105g) were combined in DMF and Et was added₃N (0.095 mL). The reaction was completed after 1 hour. The mixture was then diluted with DCM and washed with 5% citric acid (3 × 8mL) and Na₂SO₄Dried, filtered and concentrated. The product was dissolved in 1mL of toluene and loaded inOn the 4G Redi-Sep Rf column, Hex: EtOAc0 ═ is added>100% EtOAc over 15 minutes. The flow phase was then switched to DCM, DCM 0 ═ containing 20% MeOH>100% for 20 minutes. Yield: 12mg (24.9%).

Compound 1(0.012g) was dissolved in 1mL of a 1:1 mixture of DCM/TFA. The reaction was stirred for 3 hours. The product was dried on a rotary evaporator under high vacuum. Yield: 0.0110g (99.6%).

C18-diacid-N3

Compound 1(0.500g, Asta Tech.#64704) and Compound 2(0.454g, Chem-imprex #16167) were dissolved in DMF and TBTU (0.442g) and DIPEA (0.586mL) were added. The mixture was stirred for 2 hours. The mixture was then diluted with DCM (40mL) and H ₂O (4X40mL) over Na₂SO₄Dried, filtered and concentrated. The product was dissolved in 2mL DCM and loaded inRedi-Sep Rf column on (mobile phase DCM: DCM 0 ═ containing 20% MeOH)>20% over 25 minutes). The product was concentrated under high vacuum. Yield: 740mg (85%).

Compound 1(0.720g) was dissolved in 5mL MeOH in a flask. The septum was placed on the flask and the atmosphere was evacuated and replaced 2 times with nitrogen. Then, Pd/C30% (0.200g) was added by weighing the paper. The membrane was replaced and then the atmosphere was evacuated and replaced 2 times with hydrogen. The reaction was stirred at room temperature for 1 hour. The mixture was filtered and the filtrate was dried on a rotary evaporator under high vacuum. Yield: 665 mg.

Compound 1(0.150g) and compound 2(0.0618g) were dissolved in DMF and TBTU (0.0884g) and DIPEA (0.117mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (12mL), washed with water (4 × 8mL) and taken over Na₂SO₄Dried, filtered and concentrated under high vacuum. The product was dissolved in DCM (1mL) and loaded inOn a 4G Redi-Sep Rf column (mobile phase DCM: DCM 0 with 20% methanol)>50% over 25 minutes). Yield: 162mg (79%).

Compound 1(0.155g) was dissolved in a 1:1 mixture of DCM: TFA. The reaction was stirred at room temperature for 2 hours. The product was concentrated on a rotary evaporator and placed under high vacuum. Yield: 129mg (97%).

Mal-C18-diacid (D-form)

Compound 1(0.500g) and compound 2(0.4539g) were dissolved in DMF and TBTU (0.4418g) and DIPEA (0.586mL) were added to the mixture. The reaction was stirred at room temperature for 2 hours. The mixture was then diluted with DCM (40mL), washed with water (4 × 40mL) and taken over Na₂SO₄Dried, filtered and concentrated under high vacuum. The product was dissolved in DCM (2mL) and loaded inOn a 4G Redi-Sep Rf column (mobile phase DCM: DCM 0 with 20% methanol)>50% over 25 minutes). Yield: 740mg (85%).

Compound 1(0.720g) was dissolved in 5mL MeOH, then a membrane was placed over the flask and N was applied₂2 times. Pd/C (0.200g) was then added by weighing the paper, then the separator was replaced and vacuum and H were applied sequentially₂2 times. The reaction was stirred at room temperature for 1 hour. The product was filtered and the filtrate was dried on a rotary evaporator under high vacuum. Yield: 655 mg.

Compound 1(0.100g) and compound 2(0.0318g) were dissolved in DMF and TBTU (0.0589g) and DIPEA (0.078mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (10mL), washed with water (4 × 7mL), over Na ₂SO₄Dried, filtered and concentrated under high vacuum. The product was dissolved in DCM (0.5mL) and loaded inOn a 4G Redi-Sep Rf column (mobile phase DCM: DCM 0 with 20% methanol)>50% over 25 minutes). Yield: 100mg (82%).

Compound 1(96mg) was dissolved in a 1:1 mixture of TFA: DCM. The reaction was stirred at room temperature for 2 hours. The product was concentrated and placed under high vacuum. Yield 80mg (99%).

Mal-C18-methyl-triacid

At 0 deg.C, mixing#254487,0.405g) in 1mL THF was added to a suspension of NaH in THF (3.5 mL). The reaction was warmed to room temperature and stirred for 20 minutes. The reaction was mixed until it became clear. Then, compound 1 (C) was added dropwise at 0 ℃#684511,0.436g) in 2mL THF and stirred for 0.5 h. The ice bath was then removed and the reaction was stirred at room temperature overnight. The reaction was then diluted with DCM (35mL) and NH₄Cl solution (1 × 8 mL). The organics were back-extracted with DCM (1 × 8 mL). Combining the organics with H₂O (2 × 8mL) wash. Passing the organic phase over Na₂SO₄Dried, filtered and concentrated. The product was purified by chromatography, wet loaded in toluene (1mL)On 12G RediSep Rf Gold, mobile phase hexane 10% EA in hexane ═ >0＝>50% over 25 minutes). Yield: 390mg (64.5%).

Compound 1(0.100g in 0.5mL THF) was added to a suspension of NaH in 0.75mL THF at 0 deg.C. The reaction was warmed to room temperature and stirred for 20 minutes. The reaction mixture became clear. Then, compound 2 (C) was added dropwise at 0 ℃67692,0.016mL in 0.5mL THF) and stirring for 0.5 h. The ice bath was removed and the reaction was stirred at room temperature overnight. The reaction was diluted with DCM (20mL) andby NH₄Cl (1 × 5 mL). The organic layer was back-extracted with DCM (1 × 5 mL). Combining the organics with H₂O (2 × 5mL) wash. Passing the organic phase over Na₂SO₄Dried, filtered and concentrated. The product was purified by chromatography, wet loaded in toluene (1mL)12GRediSep Rf Gold, mobile phase hexane, hexane 0 containing 10% EA>50% over 25 minutes). Yield: 30mg (29.2%).

Compound 1(0.0300g) was dissolved in 0.4mL THF. LiOH (480mg in 10mL THF) was then added. The reaction was stirred for 16 hours. The reaction was acidified with citric acid to pH 3. The organic layer was extracted with 2x6mL DCM and the organics were combined and passed over Na₂SO₄Dried, filtered and concentrated. Yield: 25mg (85.7%).

Mixing compound 1(0.0250g) and compound 2 (Chem)#30487,0.0238g) was dissolved in DMF and TBTU (0.0190g) and DIPEA (0.022mL) were added to the mixture. The reaction was stirred at room temperature for 1 hour. The mixture was then diluted to 9mL with DCM, washed with water (3 × 7mL) and taken over Na ₂SO₄Dried, filtered and concentrated under high vacuum. The product was dissolved in DCM (0.5mL) and loaded inOn a 4G Redi-Sep Rf column (mobile phase DCM: DCM 0 with 20% methanol)>25% over 15 minutes). Yield: 37.1mg (84.7%).

Compound 1(0.0320g) was dissolved in 0.5mL of a 20% piperidine solution in DMF. The reaction was stirred at room temperature for 1 hour. The product was concentrated under high vacuum, then dissolved in toluene and concentrated under high vacuum. The product was dissolved in 0.5mL of DCM (containing 2X0.25mL of wash solution) and wet loaded inPre-equilibrated 4g RediSep Gold Rf column above (mobile phase DCM ═ mobile phase>DCM 0 ═ with 20% MeOH>50% over 20 minutes). Yield: 0.020g (84.7%).

Compound 1(0.0200g) was added to a solution of Et3N (0.022mL) in DMF (0.4 mL). Then compound 2 (Asta) is added#24961,0.0246 g). The reaction was stirred at room temperature for 1 hour. The reaction was diluted to 10mL with DCM and washed with 5% citric acid in water (3 × 5mL) over Na₂SO₄Dried, filtered and concentrated under high vacuum. The product was wet loaded onto a pre-equilibrated 4g Redi Sep Gold Rf column in 0.5mL DCM (containing 2x0.3mL wash) (mobile phase DCM ═>20％MeOH/DCM 0＝>30% over 20 minutes). Yield: 20 mg.

The product was then dissolved in 2mL of a 1:1 mixture of TFA: DCM and stirred for 2 hours. The product was concentrated on a rotary evaporator under high vacuum. Yield: 13 mg.

Mal-C₁₇-fluoro-PO₃Monoacid

Mixing compound 1 (A)#177490,5.00g) was dissolved in a mixture of 70mL THF and 20mL DMF. Then adding Dess-Martin (Dess-Martin) periodinane (#274623,11.7 g). The reaction was stirred for 3 hours. The mixture is concentrated on a rotary evaporator under high vacuum and then dry-loaded inOn a 120g Redi-Sep Gold Rf column, the mobile phase is hexane containing 10% DCM: EtOAc,0 ═ EtOAc>30% for 30 minutes. Yield: 2.86 g.

Compound 1(2.85g) and benzyl alcohol (1.36mL) were combined in 50mL DCM and cooled to 0 ℃. EDC (2.53g) and DMAP (0.257g) were then added successively. The reaction was allowed to warm to room temperature and then stirred for 2 hours while monitoring by TLC. The mixture is treated with NH₄Cl (1 × 50mL) solution and DCM. Passing the organic phase over Na₂SO₄Dried, concentrated and dry-loaded onto an 80g RediSep Gold Rf column, mobile phase ethyl acetate: hexane, 0 ═>15% over 30 minutes. Yield: 2.31g (61.0%).

NaH (60% in oil, 0.047mL) was added to the flask and the flask was charged with 15mL THF. The flask was cooled to 0 ℃ and a solution of compound 1(AK Scientific # J91196,0.500g) in 2mL THF was added dropwise. The reaction was stirred for 5 minutes, then the ice was removed and the reaction was stirred at room temperature for 15 minutes. The reaction was cooled to 0 ℃ and Compound 2(Tokyo Chemical Industry Co. # f 035) was added as a solid portion 8,0.768 g). Then 0.3mL of anhydrous DMF was added followed by removal of the ice bath. The reaction was stirred at rt overnight. The reaction was then diluted with DCM (50mL) and saturated NH₄Cl (1 × 12 mL). The aqueous layer was washed with DCM (1 × 10 mL). Combining the organics with H₂O (2X10mL) over Na₂SO₄Dried, filtered and concentrated on a rotary evaporator under high vacuum. The product was loaded onto a 4G Redi-Sep Gold Rf column on CombiFlash in 1.5mL DCM, mobile phase DCM: DCM containing 20% MeOH, 0 ═>30% over 20 minutes. Yield 157mg (36.2%).

Compound 2(0.149g in 0.5mL THF) was added to a suspension of NaH in THF (0.75mL) at 0 deg.C. The reaction was warmed to room temperature and stirred for 20 minutes. A solution of Compound 1(0.140g) in 1.25mL THF was added gradually at 0 deg.C and stirred for 0.5 h. The reaction was then diluted with DCM (20mL) and saturated NH₄Cl (1 × 5 mL). The product was back-extracted with DCM (1 × 5 mL). The combined organic layers were washed with H₂O (2 × 5mL) wash. Passing the organic phase over Na₂SO₄Dried, filtered and concentrated. The product was dry loaded on 1G silica gel, 4G RediSep Rf Gold, mobile phase hexanes: EtOAc 0 ═>50 percent. Yield 67mg (33.7%).

Compound 1(0.0530g) was dissolved in 2mL MeOH, then a membrane was placed over the flask and N was applied ₂2 times. Pd/C (0.0250g) was then added by weighing the paper, then the membrane was replaced, and vacuum and H were applied sequentially₂2 times. The reaction was stirred at room temperature for 2 hours. The product was filtered with a syringe filter and the filtrate was dried on a rotary evaporator under high vacuum. Yield: 36mg (82.0%).

Compound 1(0.0200g) was dissolved in 0.3mL DMF and then TBTU (0.0174g) was added followed by DIPEA (0.021 mL). The mixture was stirred for 5 minutes, then Compound 2 (Chem) was added#30487,0.0217 g). The reaction was stirred at room temperature for 1 hour. The mixture was then diluted with 6mL DCM and H₂O (3X3mL) and Na₂SO₄Dried, filtered and concentrated on a rotary evaporator under high vacuum. The product was loaded in 1mL DCMOn RediSep 4G Gold Rf column, mobile phase DCM containing 20% MeOH, 0 ═ 0->30% over 15 minutes. Yield 10mg (88.8%).

Compound 1(0.0330g) was dissolved in 0.5mL of DMF containing 20% piperidine. The reaction was stirred at room temperature for 1 hour. The reaction was concentrated on a rotary evaporator under high vacuum. The product was loaded onto a 4G RediSep Gold Rf column on CombiFlash in 1mL DCM, mobile phase DCM containing 20% MeOH, 0 ═ 50% over 20 min. Yield: 11.5mg (48.5%).

Compound 1(0.0115g) was dissolved in 0.3mL DMF and Compound 2 (Asta) was added#24961,0.0156g) and Et₃N (0.014 mL). The reaction was stirred at rt overnight. The reaction was then diluted with DCM (6mL) and washed with 5% citric acid (3 × 3mL) over Na₂SO₄Dried, filtered and concentrated. The product was loaded onto a 4G RediSep Gold Rf column on CombiFlash in 1mL DCM, mobile phase DCM: DCM containing 20% MeOH, from 0 ═ to>35% over 20 minutes. Yield: 10mg (64.9%).

Compound 1(0.0100g) was dissolved in 0.3mL DCM and the mixture was cooled to 0 ℃. Then 0.051mL TMS-Br was added and the reaction was stirred at 0 ℃ for 4 hours followed by 3 hours at room temperature. The reaction was dried and 1mL MeOH was added. The reaction was stirred overnight. The product was dried on a rotary evaporator under high vacuum by azeotropy with toluene (3x1 mL). The reaction was then dissolved in DCM: TFA 1:1(1mL) and stirred at room temperature. After 1.5h, the reaction was concentrated on a rotary evaporator under high vacuum. Yield: 8.5mg (99%).

Mal-C₁₇-fluoro-PO₃

Compound 1(0.0150g) was dissolved in 0.25mL of DMF. TBTU (0.0125) was then added to the mixture followed by DIEA (0.015mL) and the mixture was stirred for 5 minutes. Then, compound 2(0.0062g) was added to the mixture, and the reaction was stirred at room temperature for 1 hour. The reaction was then diluted with DCM (6mL) and H ₂O (3X3mL) over Na₂SO₄Dried, filtered and concentrated on a rotary evaporator under high vacuum. The product was loaded onto a 4G RediSep Gold Rf column on CombiFlash in 1mL DCM, mobile phase DCM: DCM containing 20% MeOH, from 0 ═ to>30% over 15 minutes. Yield: 12.5mg (64.7%).

A solution of compound 1(0.0125g) in 0.4mL DCM was cooled to 0 deg.C and TMSBr was added dropwise. The reaction was stirred at 0 ℃ for 3 hours. The volatiles were completely removed by rotary evaporator and high vacuum. The residue was stirred with MeOH for 2 hours to remove TMS. The mixture was dried on a rotary evaporator under high vacuum. Yield: 11.5mg (98.8%).

Synthesis of Mal-C18-dioic acid and related compounds

Step 1 compound 1 (molecular weight 370.57,0.741g,2mmol) was dissolved in 10mL DMF. TBTU (molecular weight 321,0.642g,2mmol) and DIPEA (molecular weight 129,0.87ml,5mmol) were added sequentially, and the mixture was stirred for 5 min. Compound 2 (molecular weight 418.9,0.838g,2mmol) was added. The solution was stirred for 1 hour. The solution was diluted with 40mL of DCM and washed 3 times with water (40 mL each). The organic phase was evaporated and purified using column chromatography (EA: HEX 0% -100%) to give compound 3 (80% yield). (mass observed, M +1 ═ 736).

Step 2 Compound 3 was treated with 20% piperidine in DMF for half an hour. The solvent was evaporated and the residue was purified by chromatography (MeOH: DCM ═ 0% to 10%). (mass observed, M +1 ═ 514). (mass observed, M + 1: 707).

Step 3 compound 4 (molecular weight 513,50mg,0.0975mmol) was dissolved in 1ml DMF. Compound 5 (molecular weight 308,36mg,1.2 equivalents) and TEA (0.041ml,3 equivalents) were added. The reaction was stirred for 2 hours. The solution was diluted with DCM and washed 3 times with water. The organic phase was evaporated and purified by chromatography (EA: HEX ═ 0% to 100%) to give compound 6 (mass observed, M +1 ═ 594).

Step 4 compound 6 was treated with 50% TFA in DCM for 2 hours. The solvent was evaporated to give compound 7 (Mal-C18-diacid) (observed mass, M +1 ═ 594.)

Mal-C18-triacid

Step 1 Compound 9(1.2 equiv.) is added to a solution of NaH (1.2 equiv.) in 3ml THF at 0 deg.C and stirred at room temperature for 0.5 h. A solution of compound 8(1mmol,1 eq.) in 1ml THF was then added dropwise to the mixture at 0 deg.C. The mixture was stirred at 0 ℃ for 0.5h until the solution was clear. The solution was then allowed to warm to room temperature and the solution slowly slurried. After 5h, use NH ₄The reaction was quenched with Cl and extracted with DCM. The product was purified on a column (Hex: 10% EtOAc in hexanes) and the peak appeared at about 0% -3% EtOAc (42% yield, 200mg) (observed mass, M +1 ═ 486).

Step 2 Compound 10 was dissolved in THF (3mL) and 1M LiOH (3mL) was added. The reaction was stirred at 25 ℃ for 16 hours. The solution was then acidified with citric acid to pH 3 and extracted with DCM (3 × 10 mL). The organic phases were combined and concentrated in vacuo without further purification. (mass observed, M +1 ═ 472).

By using compound 11 instead of compound 1 in the same synthesis described for Mal-C18-diacid, Mal-C18-triacid was synthesized (mass observed, M +1 ═ 638).

Mal-C₁₈-diacid-PO₃

Step 1 Compound 12(2.64mmol,1 equiv.) and Compound 13(2.909mmol,1.1 equiv.) are mixed together in DCM and the mixture is cooled to 0 ℃. EDC (1.1 equiv.) and DMAP (0.2 equiv.) were added sequentially. The reaction was warmed to room temperature. The reaction was stirred for 2 hours and monitored by TLC hexanes: EtOAc 8: 2. Using NH for organic matter₄Cl solution and DCM extraction. Passing the organic phase over Na₂SO₄Dried, concentrated and purified using chromatography (EA: HEX 0% to 10%). Product spotting occurred at about 2% EA (mass observed, M +1 ═ 426).

Step 2 Compound 15(1.2 equiv.) is added to a solution of NaH (1.2 equiv.) in 3mL THF at 0 deg.C and stirred at room temperature for 05 hours. A solution of compound 14(0.470mmol,1 eq.) in 1ml THF was added dropwise to the mixture at 0 deg.C. The reaction was stirred at 0 ℃ for 0.5h and the solution was clear. The mixture was then allowed to warm to room temperature and the solution slowly slurried. After 5h, use NH₄The reaction was quenched with Cl and extracted with DCM. Column (Hex: 10% EtOAc in hexanes) and peak appeared at about 3% EtOAc (16% yield, 45mg) (observed mass, M +1 ═ 598).

Step 3 Compound 16(0.0519mmol,1 eq) was dissolved in MeOH. Pd/C (60mg) was then added to the reaction, and H was used₂Several purge and refill cycles are performed. The reaction was stirred at 25 ℃ for 12 hours. The mixture was filtered through silica gel and concentrated in vacuo to give the product (24mg, 92% yield) (observed mass, M +1 ═ 508).

Mal-C was synthesized in the same manner as Mal-C18-diacid by substituting compound 17 for compound 1 in the synthesis of Mal-C18-diacid₁₈-diacid-PO₃(mass observed, M +1 ═ 674).

Mal-C6-PEG 2-C18-diacid

Step 1 Compound 1(1 eq, 2mmol) was dissolved in 10mL DMF. TBTU (1 equiv., 2mmol) and DIPEA (2.5 equiv., 5mmol) were added sequentially and the mixture was stirred for 5 min. Compound 2(1 eq, 2mmol) was added. The solution was stirred for 1 hour. The solution was diluted with 40mL of DCM and washed 3 times with water (40 mL each). The organic phase was evaporated and purified by chromatography (DCM: DCM ═ 0% to 25% with 20% MeOH) to afford compound 3 (80% yield). (mass observed, M +1 ═ 647). (mass observed, M +1 ═ 767.)

Step 2 Compound 3(1.6mmol,1 eq) was dissolved in MeOH. Pd/C (150mg) was added to the reaction, and H was used₂Several purge and refill cycles are performed. The reaction was stirred at 25 ℃ for 12 hours. The reaction was filtered through silica gel and concentrated in vacuo to give the product (1.5mmol, 94% yield) (observed mass, M +1 ═ 557).

Step 3 Compound 4(1 eq, 1.5mmol) was dissolved in 10ml DMF. TBTU (1 equiv.) and DIPEA (2.5 equiv.) were added sequentially and the mixture was stirred for 5 minutes. Compound 5(1 eq, 1.5mmol) was added. The solution was stirred for 1 hour. The solution was diluted with 40mL of DCM and washed 3 times with water (40 mL each). The organic phase was evaporated and chromatographed (DCM: DCM ═ 0% to 25% with 20% MeOH) to give compound 6 (80% yield). (observed mass, M +1 ═ 909).

Step 4 Compound 6(1 eq, 1.2mmol) was treated with a 20% solution of piperidine in DMF for 30 min. The solvent was evaporated and the residue was purified by chromatography (DCM: 0% -30% with 20% MeOH in DCM) to give compound 7(0.984mmol, 82% yield) (observed mass, M +1 ═ 687).

Step 5 Compound 7(1 eq, 0.984mmol) was dissolved in 1mL DMF. Compound 8(1.2 eq, 1.18mmol) and TEA (3 eq, 2.952mmol) were added. The reaction was stirred for 2 hours. The solution was diluted with DCM (30mL) and washed 3 times with water (15 mL each). The organic phase was evaporated and chromatographed (DCM: DCM containing 20% MeoH ═ 0% to 30%) to give compound 9(0.738mmol, 75% yield). (mass observed, M +1 ═ 880).

Step 6 Compound 9 was treated with 50% TFA in DCM for 2 h. The mixture was concentrated in vacuo to give compound 10 (mass observed, M +1 ═ 768).

Mal-C6-PEG 4-C18-diacid

Mal-C6-PEG 4-C18-diacid was synthesized in the same manner as Mal-C18-diacid, except that Compound 7 was subjected to NHFmoc-PEG₂-NH₂And (4) processing. Deprotection with 20% piperidine to remove the Fmoc protecting group as described in step 4, followed by repetition of steps 5 and 6 as described above (mass observed, M +1 ═ 912.)

Mal-di-C18-dioic acid

Step 1 and step 2: compound 4 was synthesized as described above in the synthesis of Mal-C18-diacid.

Step 3 Compound 5(1.0mmol,1 equiv.), Compound 6(1.3 equiv.) and TEA (5.0 equiv.) are mixed well in 3mL DMF. The reaction was stirred overnight. The mixture was concentrated on a rotary evaporator and purified by column chromatography. The product eluted in about 4% MeOH in DCM containing 1% HOAc. LC-MS showed the expected peak with impurities. The final product was 170mg with 45% yield.

Step 4 Compound 7(0.12mmol, 1 equiv.), Compound 8(2.4 equiv.), TBTU (2.4 equiv.), and DIPEA (5.0 equiv.) are mixed well in 1mL DMF. The reaction was stirred overnight. LC-MS showed the product as well as one major by-product (more than product) and three minor impurities. The mixture was concentrated by rotary evaporator and purified on column by DCM/MeOH. The product eluted in about 6-12% MeOH. 78mg of the final product (oil) are obtained with a yield of 42%.

Step 5 Compound 9(0.05mmol) was dissolved in 2mL DCM/TFA (1/1, v/v). The reaction was stirred for 1 hour. The solvent was evaporated to give 72mg of compound 10 with 99% yield.

Step 6 Compound 10(0.05mmol,1 eq), Compound 4(2.2 eq), TBTU (2.2 eq) and DIPEA (8.0 eq) were mixed well in 0.5mL DMF. The reaction was stirred for 1 h. LC-MS showed the product as well as one major by-product (non-polar TFA method). The mixture was concentrated by rotary evaporator and purified on column by DCM/MeOH. The product eluted in about 8-12% MeOH. 60mg of compound 11 are obtained with a yield of 49%.

Step 7 Compound 11(0.025mmol) was dissolved in 0.5mL DCM/TFA (1/1, v/v). The reaction was stirred for 1 hour. The solvent was evaporated to give 53mg of compound 12 with 97% yield.

Synthesis of Mal-C18-acids and related compounds

Step 1 Compound 1(0.27mmol,1 eq) was dissolved in 1mL DMF. TBTU (1 equiv.) and DIPEA (2.5 equiv.) were added sequentially and the mixture was stirred for 5 minutes. Compound 2(1 equivalent) was added. The solution was stirred for 1 hour. The solution was diluted with 40mL of DCM and washed 3 times with water (40 mL each). The organic phase was concentrated using a rotary evaporator and purified using column chromatography (EA: HEX ═ 0% to 100%) to give compound 3 (mass observed, M +1 ═ 494).

Step 2 Compound 3 was treated with 50% TFA in DCM for 2 h. The product was concentrated using a rotary evaporator to give compound 4 (mass observed, M +1 ═ 437).

Mal-C₂₀-acids

Use of commercially available C₂₀Starting Material instead of Compound 1, Mal-C was synthesized in the same manner as Mal-C18-acid₂₀Acid (mass observed, M +1 ═ 465).

Mal-C₁₇-PO₃

Step 1 DMP (1.3 equiv., 4.78mmol) and Compound 5(1 equiv., 3.68mmol) were combined in DMF (15 mL). After 2 hours, the reaction was complete as confirmed by TLC. Some solid precipitate formed. And (3) post-treatment: filter to remove solids and rinse with DCM. The product was concentrated in vacuo and purified using chromatography (Hex: EtOAC ═ 0% -20% containing 10% DCM), eluting at 5% -10%, (0.8136mmol, 22% yield) (observed mass, M +1 ═ 271).

Step 2 Compound 6(1 equiv., 0.8136mmol) and Compound 7(1.1 equiv., 0.8949mmol) were combined in DCM (5mL) and cooled to 0 ℃. EDC (1.1 equiv.) and DMAP (0.2 equiv.) were added sequentially. The reaction was warmed to room temperature. The reaction was stirred for 2 hours and monitored by TLC (hexanes: EtOAc 8: 2). The product is treated with NH₄Cl solution and DCM extraction. Passing the organic phase over Na₂SO₄Dried, concentrated and purified by chromatography (Hex: EtOAC ═ 0% to 10%). Product spotting occurred in 4% EtOAc (0.4438mmol, 54.5% yield). (mass observed, M +1 ═ 361).

Step 3 Compound 9(1.4 equiv.) is added to a solution of NaH (1.2 equiv.) in 1.5ml THF at 0 deg.C and at room temperatureStirred for 0.5 hour. A solution of compound 8(1 eq., 0.4438mmol) in 1ml THF was added dropwise to the mixture at 0 deg.C. The reaction was stirred at 0 ℃ for 0.5h and the solution was clear. The mixture was warmed to room temperature and the solution slowly slurried. After 5h, use NH₄The reaction was quenched with Cl and extracted with DCM. Column (Hex: EtOAc ═>0% to 50%) product was present in 35% EtOAc (0.2020mmol, 45.5% yield) (observed mass, M +1 ═ 496).

Step 4 Compound 10(1 equiv., 0.2020mmol) was dissolved in a 1:1:1 mixture of MeOH, THF, and 1M LiOH (3mL total solution). The mixture was stirred at 25 ℃ for 2 hours. The reaction was acidified with citric acid to pH 3 and extracted with DCM (3 × 10 mL). The organic phases were combined and passed over Na₂SO₄Dried, filtered and concentrated in vacuo. No further purification was necessary (mass observed, M +1 ═ 405).

Step 5 Compound 11(1 eq, 0.0938mmol) was dissolved in 1mL DMF. TBTU (1 equiv.) and DIPEA (2.5 equiv.) were added sequentially and the mixture was stirred for 5 minutes. Compound 2(1 equivalent) was added. The solution was stirred for 1 hour. The solution was diluted with 10mL of DCM and washed 3 times with water (5 mL each). The organic phase was evaporated and purified by chromatography (DCM: DCM 0% -30% with 20% MeOH) to give compound 12(0.0683, 73% yield) (observed mass, M +1 ═ 528).

Step 6. cool the solution of compound 12 in DCM to 0 ℃ and add TMS-Br dropwise. The reaction was stirred at 0 ℃ and monitored by LC-MS. The reaction was completed within 2.5 hours. The volatiles were completely removed (to completely remove the acid) by rotary evaporator and high vacuum. The residue was stirred with MeOH for 2 hours to remove TMS. The product was concentrated in vacuo to give the desired product (assuming 100% yield) (observed mass, M +1 ═ 471).

Mal-C₁₈Diacid (L-form)

Mal-C18-diacid (L-form) was synthesized in the same way as Mal-C18-acid Mal-C18-glu (L) -diacid, but using glu (d) instead of glu (L) (mass observed, M +1 ═ 567)

Synthesis of Mal-C6-C12-PEG2-C18 diacid and related compounds

Steps 1 and 2 Compound 4 was synthesized as described above in the synthesis of Mal-C18-diacid.

Step 3 Compound 5(1mmol,1 equiv.) is treated with 3mL of 20% piperidine in DMF for 20 minutes. The resin was then washed 3 times with DMF and used in the next step without further purification.

Step 4 to compound 6 was added a mixture of TBTU (2 equiv.), compound 7(2 equiv.), DIPEA (6 equiv.) in 3mL DMF and stirred for 1 hour. The solvent was removed under vacuum and the resin was washed 3 times with 3mL of DMF.

Step 5 Compound 8 was treated with 3ml of 20% piperidine in DMF for 20 min. The resin was then washed 3 times with DMF and used in the next step without further purification.

Step 6 to Compound 9 was added a mixture of Compound 10(2 equiv.) and DIPEA (6 equiv.) in 3mL DMF and stirred overnight. The solvent was removed under vacuum and the resin was washed 3 times with 3mL of DMF.

Step 7 Compound 11 was treated with 3ml of a 30% solution of HFIP in DCM for 30 min. The solution was filtered and the filtrate was collected and evaporated to give compound 12.

Step 8 to a solution of compound 10(1 eq) in DCM was added EDC (1 eq), followed by HOBt (1 eq) and stirring for 15 min. Compound 4 was then added and the reaction was further stirred for an additional 4 hours. The solvent was evaporated and the crude material was purified by chromatography in DCM and MeOH.

Step 9 Compound 13 was treated with 3ml of 50% TFA in DCM for 1 hour. The solvent was evaporated to give compound 14. Mal-C6-C12-Peg2-C18 diacid (mass observed, M +1 ═ 979).

Mal-C6-C12-C12-PEG 2-C18-diacid

Mal-C6-C12-C12-PEG 2-C18-diacid was synthesized using the same procedure as Mal-C6-C12-PEG 2-C18-diacid, but the reactions of steps 4 and 5 were performed on compound 9 before continuing with the other steps (mass observed, M +1 ═ 1204).

Mal-C6-C12-C12-C12-PEG2-C18 diacid

Mal-C6-C12-C12-C12-PEG2-C18 diacid was synthesized using the same procedure as Mal-C6-C12-PEG2-C18 diacid, but compound 9 was subjected to steps 4 and 5 reactions 2 times (mass observed, M +1 ═ 1429.) before continuing with the other steps

Mal-C6-C12-C12-C12-PEG2-C12 acid

Mal-C6-C12-C12-C12-PEG2-C12 acid was synthesized using the same procedure as Mal-C6-C12-PEG2-C18 diacid, but the compound 9 was subjected to the reactions of steps 4 and 5 2 times before continuing with the other steps, and then the commercially available C12 analogue of compound 4 was used (mass observed, M +1 ═ 1245).

Example 2. an orthotopic clear cell renal cell carcinoma (ccRCC) tumor-bearing mouse model using human a-498 cells.

Clear cell renal cell carcinoma (ccRCC) a498 cells expressing SEAP a pcrr 3.1 expression vector expressing reporter-secreted alkaline phosphatase (SEAP) under CMV promoter was prepared by directional cloning of SEAP coding sequences PCR amplified from Clontech's pSEAP 2-basic vector. Convenient restriction sites were added to the primers used to amplify the SEAP coding sequences for cloning into the pcrr 3.1 vector (Invitrogen). The resulting construct pCR3-SEAP was used to generate a SEAP-expressing A498 ccRCC cell line. Briefly, pCR3-SEAP plasmids were transfected into a498 ccRCC cells by electroporation according to the manufacturer's recommendations. Stable transfectants were selected by G418 resistance. Selected A498-SEAP clones were evaluated for SEAP expression and integration stability.

Implantation of clear cell renal cell carcinoma expressing SEAP (ccRCC) a498 cells female athymic (immunodeficient) nude mice were anesthetized with approximately 3% isoflurane and placed in the right lateral decubitus position. A small abdominal longitudinal incision of 0.5-1cm was made in the left flank. The left kidney was raised extraperitoneally and gently stabilized using a moist cotton-tipped swab. Immediately prior to injection, a 1.0ml syringe was filled with the cell/matrigel mixture and a 27 gauge needle catheter was attached to the syringe tip. The filled syringe was then connected to a syringe pump (Harvard Apparatus, model PHD 2000) and prepared to remove air. The tip of a 27-gauge needle catheter connected to a syringe was inserted just below the renal capsule near the caudal pole, and then the tip of the needle was carefully advanced cephalad 3-4mm along the capsule. A10. mu.l aliquot of a 2:1 (vol.: vol.) cell/matrigel mixture containing about 300,000 cells was slowly injected into the renal parenchyma using a syringe pump. The needle was left in the kidney for 15-20 seconds to ensure that the injection was complete. The needle was then removed from the kidney and a cotton-tipped swab was placed on the injection site for 30 seconds to prevent cell leakage or bleeding. The kidney was then gently placed back into the abdominal cavity and the abdominal wall was closed. Sera were collected every 7-14 days post-implantation to monitor tumor growth using a commercially available SEAP assay kit. For most studies, tumor mice are used 5-6 weeks after implantation, at which time the tumor measurement is typically about 4-8 mm.

For the studies reported in the examples herein, mice were euthanized one day post-injection for determination and total RNA was isolated from renal tumors using Trizol reagent according to manufacturer's recommendations. Relative HiF2 α mRNA levels were determined by RT-qPCR as described below and compared to mice treated with delivery buffer only (isotonic glucose). In preparation for quantitative PCR, total RNA was isolated from tissue samples homogenized in TriReagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's protocol. Approximately 500ng of RNA was Reverse transcribed using the high Capacity cDNA Reverse Transcription Kit (Life Technologies). For human (tumor) Hif2 α (EPAS1) Expression, pre-manufactured TaqMan Gene Expression assays for human Hif2 α (catalog No. 4331182) and cyca (ppia) catalog No. 4326316E) were used in triplicate in duplicate reactions using TaqMan Gene Expression Master Mix (Life Technologies) or VeriQuest Probe Master Mix (Affymetrix). Quantitative PCR was performed using 7500Fast or StepOnePlus Real-Time PCR system (Life Technologies). Will be Δ Δ C_TThe method was used to calculate relative gene expression.

Example 3 in vivo administration of HIF-2 α RNAi agents in ccRCC tumor-bearing mice.

HIF-2. alpha. RNAi agents were evaluated in vivo using the tumor-bearing mouse model of example 2. On study day 1, mice were administered injections in volumes of approximately 300 microliters by tail vein (IV) injection according to the dosing groups including:

TABLE 8 quantification of tumor-bearing mice in example 3.

In groups 5 and 6, PK enhancers having the following structure were attached to the 3' terminal end of the sense strand by reducing the disulfide bond and performing a michael addition reaction to attach the maleimide reactive group of the PK enhancer compound:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3 (see also example 1).

In groups 4 and 6, a tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) was attached to the 5' terminal end of the sense strand by coupling to a functionalized amine linker (NH 2-C6):

three (3) mice were administered in each group. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 9 mean relative huHIF-2. alpha. mRNA expression at time of sacrifice (day 8) in example 3.

As shown in table 9 above, only minimal knockdown was observed for group 2(AD04545, showing approximately 0% knockdown (1.030) compared to vehicle control), which is a HIF-2 α RNAi agent not linked to a targeting ligand or PK enhancer. Groups 4 and 6 (each of which includes a tridentate targeting group) showed greater activity compared to constructs in the absence of targeting ligand, indicating targeting ligand dependence. In addition, additional inhibitory activity was observed in the group including the targeting ligand and PK enhancer (see, e.g., group 4 (showing approximately 70% knockdown (0.308) and group 6 (showing approximately 55% knockdown (0.456)).

Example 4 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 10 quantitative administration group of tumor-bearing mice in example 4.

In groups 3-9, various PK enhancers having the following structures were ligated to the 3' terminal end of the sense strand:

Group 3:

group 4:

group 5:

group 6:

group 7:

group 8:

group 9:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

In groups 2-9, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

Three (3) mice were administered in each group. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 11 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 4.

As shown in table 11 above, each HIF-2 α RNAi agent attached to a tridentate targeting group (groups 2 to 9) showed substantial inhibitory activity compared to the control.

Example 5 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

HIF-2. alpha. RNAi agents were evaluated in vivo using the tumor-bearing mouse model of example 2. On study day 1, mice in groups 1 to 6 listed herein were administered injections in a volume of about 300 microliters by tail vein (IV) injection according to the following dosing groups in table 12 below. In addition, mice in group 7 listed herein were administered by Subcutaneous (SQ) injection between skin and muscle into the flaccid skin on the neck and shoulder areas. The administration groups included the following:

TABLE 12 quantification of tumor-bearing mice in example 5.

In groups 2-5 and 7, there will be the same as in the previous examples with regard to Mal-C₁₈The PK enhancer of the structure indicated for the diacid linked to 3 of the sense strand' end of tip.

In groups 2 and 5-7, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above. In group 3, a tridentate integrin targeting group (which includes 3 integrin ligands of the structure 6.1-avb6 with affinity for α -v- β -6) was linked to the 5 'terminal end of the sense strand through a linker coupled to a functionalized amine reactive group (NH2-C6), and in group 4, a tridentate integrin targeting group (which includes 3 integrin ligands of the structure 14-avb6 with affinity for α -v- β -6) was linked to the 5' terminal end of the sense strand through a linker coupled to a functionalized amine reactive group (NH 2-C6). The structure of the tridentate targeting group comprising the integrin targeting ligand structure 6.1-avb6 and structure 14-avb6 is shown below:

The targeting group of structure 6.1-avb6,

the targeting group of structure 14-avb6,

whereinIndicating the point of attachment to the functionalized amine linker.

TABLE 13 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 5.

As shown in table 13 above, the preference for linking one or more targeting ligands and PK enhancers showed improved potency in silencing HIF-2 α expression (see, e.g., group 6 (without PK enhancer) achieved only about 25% knockdown (0.751). furthermore, the data shows that the preference for targeting groups of targeting ligands having affinity for integrin α -v- β -3 (approximately 31% knockdown using α -v- β -6 ligand (0.691)) and group 4 (approximately 42% knockdown using α -v- β -6 ligand (0.582)) compared to group 2 (approximately 56% knockdown using α -v- β -3 ligand (0.437)) and group 5 (approximately 58% knockdown using α -v- β -3 ligand (0.413)) for targeting groups having affinity for integrin α -v- β -6, as compared to targeting ligands having affinity for α -v- β -6 As shown in groups 7 and 2, IV and SQ dosing with PK enhancers of C18-diacid (C18 diacid) can achieve comparable efficacy.

Example 6 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 14. group of dosing of tumor-bearing mice in example 6.

In groups 2, 4-7, there will be information about Mal-C in the previous embodiment₁₈The PK enhancer of the structure indicated for the diacid is linked toThe 3' terminal end of the sense strand. Group 3 includes PK enhancers linked to the 3' terminal end of the sense strand of the structure:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

Group 10 includes a PK enhancer attached to the 3' terminal end of the sense strand of the structure:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

Group 11 includes PK enhancers linked to the 3' terminal end of the sense strand of the structure:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

In groups 5-7, PK enhancers were conjugated to internal nucleotides. The designated nucleotides include 2' -O-propargyl, and an azide-containing PK enhancer (C18-diacid-N) is added ₃) To form a triazole. Groups 5-7 include PK enhancers of the following structure:

whereinIndicating the point of attachment to the RNAi agent at the 2' position of the specified nucleotide.

In groups 2-11, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

TABLE 15 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 6.

As shown in table 15 above, each HIF-2 α RNAi agent attached to a tridentate targeting group (groups 2 to 11) showed substantial inhibitory activity compared to the control.

Example 7 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

HIF-2. alpha. RNAi agents were evaluated in vivo using the tumor-bearing mouse model of example 2. On study day 1, mice were administered injections in a volume of approximately 300 microliters by tail vein Intravenous (IV) injection, which included the following dosing groups:

TABLE 16 quantitative administration group of tumor-bearing mice in example 7.

In groups 2-4, 9 and 10, there will be the same as in the previous embodiment with regard to Mal-C₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

Group 6 includes PK enhancers with the following structure on the 3' end of the sense strand:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

Group 7 includes PK enhancers with the following structure on the 3' end of the sense strand:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

Group 8 included passage through Mal-C as shown in example 6₁₈-a PK enhancer formed by michael addition of a triacid to the 3' terminus of the sense strand comprising a disulfide.

In groups 2, 4-8 and 10, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above. Group 9 includes tridentate integrin targeting groups (integrin ligands comprising 3 structures of structure 10-avb6 with affinity for α -v- β -6) linked to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6), the structures of which are shown below:

Group 10 includes tridentate integrin targeting groups (integrin ligands comprising 3 structures of structure 26-avb6 with affinity for α -v- β -6) linked to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6), the structures of which are shown below:

TABLE 17 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 7.

As shown in Table 17 above, group 4, which included four (4) internally located structural 2a-avb3 ligands on the sense strand of the HIF-2 α RNAi agent, exhibited approximately 78% knockdown of huHIF-2 α mRNA (0.228).

Example 8 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 18 quantification of tumor-bearing mice in example 8.

In groups 2, 3 and 5-8, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same properties as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand. Groups 4 and 9 included PK enhancers with the structures indicated in example 6. Group 10 included PK enhancers with the structures indicated in example 7. Group 11 includes PK enhancers with the following structure on the 3' end of the sense strand:

whereinIndicates the point of attachment to the RNAi agent at the C6-S group shown in table 4.3.

In groups 2, 4-5 and 8-11, the tridentate integrin targeting group (which includes 3 integrin ligands with the structure of structure 2a-avb3 having affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above. In set 2, the single structure 2a-avb3 targeting ligand is attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH 2-C6). In set 7, the PK enhancer C18-diacid was ligated to the (C6-SS-C6) disulfide linker located at the 5 'terminal end of the sense strand as well as the 3' terminal end of the sense strand.

TABLE 19 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 8.

As shown in table 19 above, inclusion of an internal targeting ligand located on the sense strand of a HIF-2 α RNAi agent showed additional improvement in knockdown (see, e.g., group 2 (four (4) targeting ligands located inside showing approximately 82% knockdown (0.183)), and group 8 (targeting ligand not located inside showing approximately 49% knockdown (0.516)).

Example 9 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 20 quantification of tumor-bearing mice in example 9.

In groups 2-13, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

In groups 2-13, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

TABLE 21 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 9.

Each HIF-2 α RNAi agent examined in example 9 included at least 2 internal nucleotides comprising an avb3 integrin targeting ligand attached at the 2' position of the nucleotide, and each HIF-2 α RNAi agent tested exhibited approximately 50% or greater HIF-2 α knockdown compared to vehicle control, as shown in table 21 above. Groups 2 (with 4 internal ligands, approximately 74% knockdown) and 13 (with 8 internal ligands, approximately 86% knockdown) showed a particularly high reduction in huHIF-2. alpha. mRNA expression.

Example 10 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 22 quantification of tumor-bearing mice in example 10.

In groups 2-13, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have been previouslyExamples relating to Mal-C₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

TABLE 23 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 10.

Example 11 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 24 quantitative administration group of tumor-bearing mice in example 11.

In groups 2-9, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

Three (3) mice were administered in each group, except group 2, where only two (2) mice were administered. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 25 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 11.

Example 12 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 26 quantification of tumor-bearing mice in example 12.

In groups 2-11, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

Three (3) mice were administered in each group, except group 6, where only two (2) mice were administered. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 27 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 12.

Example 13 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 28 quantification of tumor-bearing mice in example 13.

In groups 2-10, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

In groups 2-10, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

TABLE 29 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 13.

Example 14 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 30 quantification of tumor-bearing mice in example 14.

In groups 2-7, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

In groups 2-7, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

TABLE 31 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 14.

Each HIF-2 α RNAi agent in example 14 comprises a sense strand comprising: (i) a tridentate targeting group comprising three targeting ligands, located at the 5' terminal end of the sense strand; (ii) a total of four additional internal targeting ligands linked at the 2' position to each nucleotide at positions 2, 4, 6 and 8 starting from the first nucleotide that forms a base pair with the antisense strand; and (iii) a PK enhancer attached to the 3' terminal end of the sense strand. As shown in Table 31 above, each RNAi agent administered at 2.0mg/kg and 5.0mg/kg showed a substantial reduction in huHIF-2 α mRNA compared to vehicle control.

Example 15 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

TABLE 32 quantitative administration group of tumor-bearing mice in example 15.

In groups 2-4, attachment of the maleimide reactive group by reduction of the disulfide bond and Michael addition would have the same benefits as for Mal-C in the previous examples ₁₈The PK enhancer of the structure indicated for the diacid is attached to the 3' terminal end of the sense strand.

In groups 2-4, the tridentate integrin targeting group (which includes 3 integrin ligands of the structure 2a-avb3 with affinity for α -v- β -3) attached to the 5' terminal end of the sense strand by coupling to a functionalized amine reactive group linker (NH2-C6) has the structure described in example 3 above.

Three (3) mice were administered in each group, except for the vehicle control group (group 1) with only 2 mice. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 33 mean relative huHIF-2. alpha. mRNA expression at sacrifice (day 8) in example 15.

Example 16 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

HIF-2. alpha. RNAi agents were evaluated in vivo using the tumor-bearing mouse model of example 2. On study days 1, 2, 8, 9, 15, 22 and 29, mice were administered a volume of about 300 microliters of 5.0mg/kg tris-structure 2a-avb3-AD05971- (inner structure 2a-avb3) by tail vein (IV) injection ₄-injection of C18-diacid or isotonic glucose without RNAi agent.

Six (6) mice were administered per group. Mice were sacrificed on study day 36 and kidney tumors were harvested. Fig. 4A shows the kidneys of mice in the untreated control group, with the tumor kidneys shown on the right side of the image and the contralateral kidneys shown on the left side. Fig. 4B shows the kidneys of mice in the group treated with the RNAi agent, also showing the tumor kidney on the right side of the image and the contralateral kidney on the left side. As is evident from the images and confirmed by tumor weight, the HIF-2. alpha. RNAi agent group inhibited tumor growth. In addition, as shown in FIG. 5A, Immunohistochemical (IHC) staining of cells of tumor-bearing mice in the control group confirmed the presence of HIF-2 α protein, as indicated by the black dots, while no such black dots were evident on the image of FIG. 5B showing cells of tumor-bearing mice treated with HIF-2 α RNAi agents.

Example 17 in vivo administration of HIF-2 α RNAi Agents in ccRCC tumor-bearing mice.

HIF-2. alpha. RNAi agents were evaluated in vivo using the tumor-bearing mouse model of example 2. Mice were administered injections in a volume of approximately 300 microliters by tail vein (IV) injection according to the following dosing group:

TABLE 34 quantitative administration group of tumor-bearing mice in example 17.

Four (4) mice were administered per group. On the planned sacrifice date indicated in table 34 above, the renal tumors were harvested and total human HIF-2mRNA in the renal tumors was isolated after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 35 mean relative huHIF-2. alpha. mRNA expression at sacrifice in example 17.

Example 18 in vivo administration of HIF-2 α RNAi agents in ccRCC tumor-bearing mice.

TABLE 36 quantitative administration group of tumor-bearing mice in example 18.

Four (4) mice were administered per group. Mice were sacrificed on study day 8, renal tumors harvested, and total human HIF-2mRNA was isolated in the renal tumors after collection and homogenization. HIF-2 α (huHIF-2 α) mRNA expression was quantified by probe-based quantitative PCR, normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (geometric mean, ± 95% confidence interval).

TABLE 37 mean relative huHIF-2. alpha. mRNA expression at sacrifice in example 18.

Example 19 HIF-2. alpha.RIn vivo administration of NAi agents in ccRCC tumor-bearing mice.

TABLE 38 quantitative administration group of tumor-bearing mice in example 19.

Fifteen (15) mice were administered per group and body weight and tumor growth were monitored by weekly palpation and caliper estimation. One animal in group 4 was found dead on day 21. Figure 6 shows the effect on tumor growth until study day 34. As shown in figure 6, the data shows an overall improvement in tumor size reduction when HIF-2 α RNAi agents were administered compared to saline vehicle control.

Example 20 integrin targeting ligands conjugated to HIF-2 α targeting RNAi Agents in renal tumor bearing Small cells In vivo administration in mice.

As described in example 1 herein, RNAi agents comprising a sense strand and an antisense strand are synthesized on a solid phase according to phosphoramidite techniques according to general procedures known in the art and commonly used in oligonucleotide synthesis. The RNAi agents have various modified nucleotide sequences listed in example 2 herein and are designed to target Hif2 α (EPAS 1).

On study day 1, mice bearing renal tumors were administered by tail vein injection according to the following dosing groups:

TABLE 39 dosing groups of mice in example 20.

Three (3) tumor-bearing mice (n-3) were administered per group. Mice were sacrificed on study day 8 post injection and total RNA was isolated from renal tumors. Relative human HIF2 α mRNA expression was then quantified by probe-based quantitative PCR (RT-qPCR), normalized to human cyclophilin a (ppia) expression and expressed as a fraction of vehicle control group (isotonic glucose) (geometric mean, ± 95% confidence interval).

Table 40 average relative Hif2 a mRNA expression at sacrifice in example 20.

As shown in table 40 above, each of the Hif2 α RNAi agent-integrin targeting ligand conjugates showed a decrease in mRNA expression in mice compared to controls.

Example 21 integrin targeting ligands conjugated to HIF-2 α targeting RNAi Agents in renal tumor bearing Small cells In vivo administration in mice.

As described in example 1 herein, RNAi agents comprising a sense strand and an antisense strand are synthesized on a solid phase according to phosphoramidite techniques according to general procedures known in the art and commonly used in oligonucleotide synthesis. RNAi agents have various modified nucleotide sequences described herein and are designed to target Hif2 a (EPAS 1).

On study day 1, mice bearing renal tumors were administered by tail vein injection according to the following dosing groups (see example 4):

TABLE 41 dosing group of mice in example 21.

Table 42 mean relative Hif2 a mRNA expression at sacrifice in example 21.

As shown in table 42 above, each of the Hif2 α RNAi agent-integrin targeting ligand conjugates showed a decrease in mRNA expression in mice compared to controls.

Example 22 integrin targeting ligands conjugated to HIF-2 α targeting RNAi Agents in renal tumor bearing Small cells In vivo administration in mice.

As described in example 1 herein, RNAi agents comprising a sense strand and an antisense strand are synthesized on a solid phase according to phosphoramidite techniques according to general procedures known in the art and commonly used in oligonucleotide synthesis. RNAi agents have various modified nucleotide sequences described herein and are designed to target Hif2 a (EPAS 1).

On study day 1, mice bearing renal tumors were administered by tail vein injection according to the following dosing groups:

TABLE 43 quantitative administration group of mice in example 22.

Three (3) tumor-bearing mice (n-3) were administered per group. Mice were sacrificed at study day 8 post injection and total RNA was isolated from renal tumors according to the protocol described in example 4. Relative human HIF2 α mRNA expression was then quantified by probe-based quantitative PCR (RT-qPCR), normalized to human cyclophilin a (ppia) expression and expressed as a fraction (geometric mean, ± 95% confidence interval) of the vehicle control group (isotonic glucose).

Table 44 mean relative Hif2 a mRNA expression at sacrifice in example 22.

As shown in table 44 above, each of the Hif2 α RNAi agent-integrin targeting ligand conjugates showed a decrease in mRNA expression in mice compared to controls.

Example 23 integrin targeting ligands conjugated to HIF-2 α targeting RNAi Agents in renal tumor bearing Small tumors In vivo administration in mice.

As described in example 1 herein, RNAi agents comprising a sense strand and an antisense strand are synthesized on a solid phase according to phosphoramidite techniques according to general procedures known in the art and commonly used in oligonucleotide synthesis. RNAi agents have various modified nucleotide sequences described in example 2 herein and are designed to target Hif2 α (EPAS 1).

On study day 1, mice bearing renal tumors were administered by tail vein injection according to the following dosing groups:

TABLE 45 quantitative administration group of mice in example 23.

Four (4) tumor-bearing mice (n-4) were administered per group, except for group 4, which had only three (3) mice (since one mouse was considered to have an erroneous injection). Mice were sacrificed at study day 8 post injection and total RNA was isolated from renal tumors according to the protocol described in example 4. Relative human HIF2 α mRNA expression was then quantified by probe-based quantitative PCR (RT-qPCR), normalized to human cyclophilin a (ppia) expression and expressed as a fraction (geometric mean, ± 95% confidence interval) of the vehicle control group (isotonic glucose).

Table 46 mean relative Hif2 a mRNA expression at sacrifice in example 23.

As shown in table 46 above, each of the Hif2 α RNAi agent-integrin targeting ligand conjugates showed a decrease in mRNA expression in mice compared to controls.

Example 24 integrin targeting ligands conjugated to HIF-2 α targeting RNAi Agents in renal tumor bearing Small cells In vivo administration in mice.

As described in example 2 herein, RNAi agents comprising a sense strand and an antisense strand are synthesized on a solid phase according to phosphoramidite techniques according to general procedures known in the art and commonly used in oligonucleotide synthesis. RNAi agents have various modified nucleotide sequences described in example 2 herein and are designed to target Hif2 α (EPAS 1).

On study day 1, mice bearing renal tumors were administered by tail vein injection according to the following dosing groups:

TABLE 47 quantitative administration group of mice in example 24.

RNAi agents are synthesized having a nucleotide sequence intended to target the human Hif2 alpha gene and comprising a functionalized amine reactive group (NH) at the 5' terminal end of the sense strand₂-C₆) To facilitate conjugation with integrin targeting ligands.

Table 48 mean relative Hif2 a mRNA expression at sacrifice in example 24.

As shown in table 48 above, each of the Hif2 α RNAi agent-integrin targeting ligand conjugates exhibited a decrease in mRNA expression compared to the control.

Detailed description of the preferred embodiments

Embodiment 1. RNAi agents for inhibiting expression of the HIF-2 α (EPAS1) gene, comprising:

(i) An antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3;

(ii) a sense strand comprising a nucleotide sequence at least partially complementary to said antisense strand; and

(iii) one or more targeting ligands.

Embodiment 2. the RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in table 3.

Embodiment 3. the RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sense strand sequences provided in tables 4, 4.1, 4.2 or 4.3, and wherein said sense strand contains a region of at least 85% complementarity to the antisense strand over said 17 contiguous nucleotides.

Embodiment 4. the RNAi agent of any one of embodiments 1-3, wherein all or substantially all of the nucleotides of the sense strand of the RNAi agent, the antisense strand of the RNAi agent, or both the sense and antisense strands of the RNAi agent are modified nucleotides.

Embodiment 5 the RNAi agent of embodiment 4, wherein at least one modified nucleotide is selected from the group consisting of: 2 '-O-methyl nucleotides, 2' -fluoro nucleotides, 2 '-deoxy nucleotides, 2', 3 '-ring-opening nucleotide mimics, locked nucleotides, 2' -F-arabino nucleotides, 2 '-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2' -O-methyl nucleotides, inverted 2 '-deoxy nucleotides, 2' -amino-modified nucleotides, 2 '-alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, 2' -O-propargyl-modified nucleotides, 2 '-O-triazole-modified nucleotides, and 3' -O-methyl nucleotides.

Embodiment 6 the RNAi agent of embodiment 5, wherein each modified nucleotide is independently selected from: 2 ' -O-methyl nucleotides, 2 ' -fluoro nucleotides and 2 ' -O-triazole-modified nucleotides.

Embodiment 7. the RNAi agent of any one of embodiments 1-6, wherein said antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in table 3.

Embodiment 8. the RNAi agent of any one of embodiments 1-7, wherein said sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in table 4.

Embodiment 9. the RNAi agent of any one of embodiments 1-8, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in table 4, table 4.1, table 4.2, or table 4.3.

Embodiment 10. the RNAi agent of any one of embodiments 1-9, wherein the antisense strand comprises nucleotides 2-18 of usufusCfaUfgAfaAfuCfgUfcGcGfuUfsg (SEQ ID NO:30), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively.

Embodiment 11 embodiment 10 of the RNAi agent, wherein the antisense strand comprises the sequence usUfsusCfaUfgAfaAffCfUfGfuUfcGuFcGfuUfsg (SEQ ID NO:30), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively.

Embodiment 12. the RNAi agent of embodiment 1, wherein the sense strand comprises nucleotides 2-18 of the sequence of CAACGUAACGAUUUCAUGAAA (SEQ ID NO: 428).

Embodiment 13 the RNAi agent of embodiment 1, wherein the sense strand comprises Y- (NH-C6) scsacaguacfgfaffuuu^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and each Z independently represents a pharmacological moiety, Y- (NH-C6) s represents:(invAb) represents:and (6-S) represents:

embodiment 14 the RNAi agent of any one of embodiments 12 or 13, wherein said antisense strand is at least substantially complementary to said sense strand.

Embodiment 15 the RNAi agent of any one of embodiments 1-14, wherein the nucleotide of the sense strand consists of Y- (NH-C6) scsaacgua cfgfaffuuu ^Zca^Zug^Zaa^Zsa (invAb) (6-S) -X (SEQ ID NO:761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively, and each Z independently represents a pharmacological moiety, Y- (NH-C6) s represents:(invAb) represents:and (6-S) represents:

embodiment 16 embodiment 15 of the RNAi agent, wherein the antisense strand of nucleotides consisting of usUfsusCfaUfgAfaAfuCfgUfuAfcGcGcGfuUfcGfuFg (SEQ ID NO:30) sequence, wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively.

Embodiment 17 the RNAi agent of any one of embodiments 1-16, wherein the sense strand of the RNAi agent is linked to at least one targeting ligand.

Embodiment 18 the RNAi agent of embodiment 17, wherein the targeting ligand comprises a compound with affinity for integrin.

Embodiment 19. the RNAi agent of embodiment 18, wherein the targeting ligand comprises a compound with affinity for integrin α -v- β -3, α -v- β -5, or both α -v- β -3 and α -v- β -5.

Embodiment 20 the RNAi agent of embodiment 19, wherein the targeting ligand is a compound of the formula:

wherein the content of the first and second substances,

x is-C (R)³)₂-、-NR³-、

Y is an optionally substituted alkylene group having 1 to 8 carbon atoms in the alkylene chain;

z is O, NR³Or S;

R¹is optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocyclyl, optionally substituted cycloalkyl, or R¹Comprising an RNAi agent;

R²is H, optionally substituted alkyl, or R²Comprising an RNAi agent;

R³each instance of (A) is independently selected from H and optionally substituted alkyl, or R³Comprising an RNAi agent;

R⁴is H or optionally substituted alkyl; and is

Y, R therein¹、R²At least one of R³Any examples of (2) and R⁴Comprising an RNAi agent.

Embodiment 21 the RNAi agent of embodiment 20, wherein the targeting ligand is selected from the group consisting of:

whereinIndicating the point of attachment to the HIF-2 α RNAi agent.

Embodiment 22 the RNAi agent of any one of embodiments 1-21, wherein said targeting ligand has the structure:

embodiment 23. the RNAi agent of any one of embodiments 1-22, further comprising a Pharmacokinetic (PK) enhancer.

Embodiment 24 the RNAi agent of embodiment 23, wherein said PK enhancer comprises the formula:

Wherein Y is an optionally substituted saturated or unsaturated aliphatic chain and n is an integer from 5 to 25.

Embodiment 25 the RNAi agent of embodiment 24, wherein said PK enhancer comprises

Embodiment 26 the RNAi agent of embodiment 23, wherein said PK enhancer is selected from:

whereinIndicating the point of attachment to the RNAi agent.

Embodiment 27. the RNAi agent of any one of embodiments 1-26, wherein said targeting ligand is linked to said sense strand.

Embodiment 28 the RNAi agent of any one of embodiments 23-27, wherein said PK enhancer is linked to said sense strand.

Embodiment 29 the RNAi agent of any one of embodiments 1-28, wherein said RNAi agent is linked to 2-10 targeting ligands.

Embodiment 30 the RNAi agent of any one of embodiments 1-29, wherein said RNAi agent is linked at the 5' terminal end of said sense strand to a targeting group comprising 2 or more targeting ligands.

Embodiment 31 the RNAi agent of any one of embodiments 1-30, wherein at least one targeting ligand is attached to the 5' terminal end of the sense strand and at least one targeting ligand is attached to the non-terminal nucleotide of the sense strand.

Embodiment 32. the RNAi agent of any one of embodiments 1-31 linked to two or more targeting ligands, wherein the 2 or more targeting ligands are linked at a branching point to form a targeting group.

Embodiment 33 the RNAi agent of embodiment 32, wherein said targeting group comprises three targeting ligands and said targeting group has the formula:

wherein the content of the first and second substances,

L¹、L²and L³Each independently is a linker comprising an optionally substituted alkylene;

L⁴is composed ofA linker of an optionally substituted alkylene, an optionally substituted aryl, or an optionally substituted cycloalkyl;

R⁵is H or optionally substituted alkyl;

TL is a targeting ligand; and is

Y is O or S.

Embodiment 34 the RNAi agent of embodiment 33, wherein said targeting group has the formula:

embodiment 35 the RNAi agent of any one of embodiments 1-34, wherein a tridentate targeting group is linked to the 5' terminal end of the sense strand, and wherein at least two additional targeting ligands are linked to one or more nucleotides of the sense strand.

Embodiment 36 the RNAi agent of embodiment 31 or 35, wherein at least 10 nucleotides are positioned between a targeting group located on the 5' terminus of the sense strand and a targeting ligand located on the sense strand.

Embodiment 37 the RNAi agent of any one of embodiments 1-36, wherein at least one targeting ligand is attached to the 2' position of the nucleotide of the sense strand of the RNAi agent.

Embodiment 38 the RNAi agent of any one of embodiments 23-37, wherein said PK enhancer is linked to the 3' terminal end of said sense strand.

Embodiment 39. the RNAi agent of any one of embodiments 1-38, wherein 5-8 targeting ligands are attached to the sense strand.

Embodiment 40 the RNAi agent of embodiment 39, wherein the sense strand of the RNAi agent is linked to at least one tridentate targeting group, and at least two targeting ligands are linked to one or more nucleotides of the sense strand.

Embodiment 41 the RNAi agent of embodiment 40, wherein the sense strand of said RNAi agent is linked to (i) a tridentate targeting group at the 5 'terminal end of said sense strand, and (ii) 2-4 targeting ligands linked to nucleotides of said sense strand other than the 5' terminal nucleotide.

Embodiment 42 the RNAi agent of any one of embodiments 29-41, wherein said targeting ligand is linked to said sense strand as follows: (i) a tridentate targeting group comprising 3 individual targeting ligands is located at the 5' terminal end of the sense strand; and (ii) the additional targeting ligand is a single targeting ligand attached to a single nucleotide of the sense strand that is at least 10 nucleotides from the 5' terminal end of the sense strand.

Embodiment 43 the RNAi agent of embodiment 42, wherein the targeting ligand is linked to a sense strand nucleotide at positions 2, 4, 6 and 8(3 '→ 5') starting from a 3 'terminal nucleobase which forms a base pair with the 5' terminal nucleotide of the antisense strand.

Embodiment 44 the RNAi agent of embodiment 43, wherein at least one targeting ligand is linked to a single nucleotide at the 2 ' position of the ribose ring, the 3 ' position of the ribose ring, the 1 ' position of the ribose ring or the nucleobase of the nucleotide, the 4 ' position of the ribose ring or the 5 ' position of the nucleotide.

Embodiment 45 the RNAi agent of embodiment 44, wherein at least one targeting ligand is linked to the 2' position of the ribose ring of a single nucleotide.

Embodiment 46. the RNAi agent of any one of embodiments 1-45, wherein said sense strand is between 18-49 nucleotides in length and said antisense strand is between 18-49 nucleotides in length.

Embodiment 47 the RNAi agent of embodiment 46, wherein said sense strand and said antisense strand each have a length of between 18-27 nucleotides.

Embodiment 48 the RNAi agent of embodiment 47, wherein said sense strand and said antisense strand each have a length of between 18-24 nucleotides.

Embodiment 49 the RNAi agent of embodiment 48, wherein said sense strand and said antisense strand are each 21 nucleotides in length.

Embodiment 50 the RNAi agent of any one of embodiments 46-49, wherein said RNAi agent has two blunt ends.

Embodiment 51 the RNAi agent of any one of embodiments 1-50, wherein the sense strand comprises 1 or 2 terminal caps.

Embodiment 52 the RNAi agent of any one of embodiments 1-51, wherein said sense strand comprises 1 or 2 inverted abasic residues.

Embodiment 53 the RNAi agent of any one of embodiments 1-52, wherein said RNAi agent comprises a sense strand and an antisense strand forming a duplex having the structure of any one of the duplexes in table 5.

Embodiment 54 the RNAi agent of any one of embodiments 51-53, wherein the sense strand further comprises an inverted abasic residue at the 3 'terminus of the nucleotide sequence, at the 5' terminus of the nucleotide sequence, or at both the 3 'terminus and the 5' terminus of the nucleotide sequence.

Embodiment 55 a HIF-2 α RNAi agent, comprising:

(i) an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotide from any one of the sequences provided in table 3; and

(ii) A sense strand comprising a nucleotide sequence that is at least partially complementary to said antisense strand.

Embodiment 56. an RNAi agent capable of inhibiting expression of the HIF-2 α (EPAS1) gene, comprising:

(i) an antisense strand having a length of between 18-49 nucleotides that is at least partially complementary to the HIF-2 α (EPAS1) gene (SEQ ID NO: 1);

(ii) a sense strand at least partially complementary to the antisense strand;

(iii) a targeting ligand attached to the sense strand; and

(iv) a PK enhancer attached to the sense strand.

Embodiment 57 the RNAi agent of embodiment 56, wherein said targeting ligand is linked to the 5' terminal end of said sense strand.

Embodiment 58 the RNAi agent of embodiment 56 or 57, wherein the PK enhancer is linked to the 3' terminal end of the sense strand.

Embodiment 59 the RNAi agent of any one of embodiments 56-58, wherein one or more targeting ligands are attached to one or more nucleotides of the sense strand.

Embodiment 60 the RNAi agent of embodiment 59, wherein 2-12 targeting ligands are linked to the nucleotides of the sense strand.

Embodiment 61 the RNAi agent of any one of embodiments 56-60, wherein a tridentate targeting group comprising three targeting ligands is attached to the 5' terminal end of the sense strand; a PK enhancer is attached to the 3' terminal end of the sense strand; and 2-12 targeting ligands are attached to a single nucleotide of the sense strand.

Embodiment 62 the RNAi agent of embodiment 61, wherein a targeting ligand attached to the single nucleotide of the sense strand is attached at the 2' position of each respective nucleotide.

Embodiment 63 the RNAi agent of any one of embodiments 56-62, wherein the targeting ligand is linked to the nucleotides at positions 2, 6, 15 and 19(3 '→ 5') starting from the first nucleotide that forms a base pair with the antisense strand.

Embodiment 64 the RNAi agent of any one of embodiments 56-62, wherein the targeting ligand is linked to the nucleotides at positions 2, 4, 6 and 8(3 '→ 5') starting from the first nucleotide that forms a base pair with the antisense strand.

Embodiment 65 the RNAi agent of any one of embodiments 56-62, wherein the targeting ligand is linked to the nucleotide of the sense strand opposite nucleotides 2, 4, 6 and 8(5 '→ 3') of the antisense strand.

Embodiment 66. the RNAi agent of any one of embodiments 56-65, wherein a tridentate targeting group comprising three targeting ligands is located at the 5 'terminal end of the sense strand, said sense strand further comprising 2-4 targeting ligands linked to the nucleotides of the sense strand, and there being at least 10 nucleotides separating the tridentate targeting group at the 5' terminal end of the sense strand from the next nearest targeting ligand attached to the nucleotides.

Embodiment 67 the RNAi agent of embodiment 66, wherein four targeting ligands are linked to a single nucleotide of the sense strand.

Embodiment 68 the RNAi agent of any one of embodiments 56-67, wherein said targeting ligand is an integrin targeting ligand comprising a compound having affinity for integrin α -v- β -3.

Embodiment 69 the RNAi agent of any one of embodiments 56-68, wherein the PK enhancer has the formula:

wherein Y is an optionally substituted saturated or unsaturated aliphatic chain and n is an integer from 5 to 25.

Embodiment 70 an RNAi agent comprising an antisense strand comprising the sequence usUfsusCfaUfgAfaAffGuFcGfGfAffUfsg (SEQ ID NO:30), a antisense strand comprising the sequence Y- (NH-C6) scsaacguaaCfGfAfuuu^Zca^Zug^Zaa^ZThe sense strand of sa (invAb) (6-S) -X (SEQ ID NO:761), wherein a, c, g and u represent 2' -O-methyladenosine, cytidine, guanosine and uridine, respectively; af. Cf, Gf and Uf represent 2' -fluoroadenosine, cytidine, guanosine and uridine, respectively; u. of^Z、a^Z、g^ZAnd c^ZRespectively represent uridine, adenosine, guanosine and cytidine, wherein a pharmacological moiety comprising Z is attached at the 2' position of the nucleotide; y- (NH-C6) s represents:(invAb) represents:(6-S) represents:and each X, Y and Z independently represents:

(i) A targeting group comprising one or more targeting ligands, wherein said targeting ligand is selected from the group consisting of: structure 2a, structure 2.11a, structure 29a and structure 32 a;

(ii) a targeting ligand having a structure selected from the group consisting of: structure 2a, structure 2.11a, structure 29a and structure 32 a; or

(iii) A PK enhancer having a structure selected from: c-18 diacid, C-18 triacid, Mal-C₁₇-vinyl-PO₃And C20 acid.

Embodiment 71 the RNAi agent of embodiment 70, wherein each Z is a targeting ligand having the structure of structure 2 a:whereinIndicating the connection point.

Embodiment 72 the RNAi agent of embodiment 70, wherein each Z is a targeting ligand having the structure of structure 2.11 a:whereinIndicating the connection point.

Embodiment 73 the RNAi agent of embodiment 70, wherein each Z is a targeting ligand having the structure of structure 29 a:whereinIndicating the connection point.

Embodiment 74 the RNAi agent of embodiment 70, wherein each Z is a targeting ligand having the structure of structure 32 a:whereinIndicating the connection point.

Embodiment 75 the RNAi agent of any one of embodiments 70-74, wherein XIs a PK enhancer having the structure of C-18 diacid:whereinIndicating the connection point.

Embodiment 76 the RNAi agent of any one of embodiments 70-74, wherein X is a PK enhancer having the structure of Mal-C-18 triacid: WhereinIndicating the connection point.

Embodiment 77 the RNAi agent of any one of embodiments 70-74, wherein X is a PK enhancer having the structure Mal-C17-vinyl PO 3:whereinIndicating the connection point.

Embodiment 78 the RNAi agent of any one of embodiments 70-74, wherein X is a PK enhancer having the structure of Mal-C20 acid:whereinIndicating the connection point.

Embodiment 79 the RNAi agent of any one of embodiments 70-78, wherein the RNAi agent comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 targeting ligands.

Embodiment 80 the RNAi agent of embodiment 79, wherein the RNAi agent comprises 7 targeting ligands.

Embodiment 81, the RNAi agent of embodiment 80,wherein Y is a targeting group having the structure: TriAlk 14:or TriAlk 14s:wherein TL comprises a targeting ligand selected from: structure 2a, structure 2.11a, structure 29a and structure 32 a.

Embodiment 82 the RNAi agent of embodiment 81, wherein each TL comprises the structure 2a:whereinIndicating the connection point.

Embodiment 83 the RNAi agent of embodiment 81, wherein each TL comprises the structure 2.11a:whereinIndicating the connection point.

Embodiment 84 the RNAi agent of embodiment 81, wherein each TL comprises structure 29a: WhereinIndicating the connection point.

Embodiment 85 the RNAi agent of embodiment 81, wherein each TL comprises the structure 32a:whereinIndicating the connection point.

Embodiment 86. the RNAi agent of any one of embodiments 70-81, wherein the nucleotides of the antisense strand consist of the nucleotides of SEQ ID NO: 30.

Embodiment 87. the RNAi agent of any one of embodiments 70-82, wherein the nucleotides of the sense strand consist of the nucleotides of SEQ ID NO: 761.

Embodiment 88. a composition comprising the RNAi agent of any one of embodiments 1-88, wherein the composition comprises a pharmaceutically acceptable excipient.

Embodiment 89 the composition of embodiment 88, further comprising a second RNAi agent for inhibiting expression of HIF-2 α.

Embodiment 90 the composition of embodiment 88 or 89, further comprising one or more additional therapeutic agents.

Embodiment 91 a method for inhibiting expression of a HIF-2 α (EPAS1) gene in a cell, the method comprising introducing into the cell an effective amount of the RNAi agent of any one of embodiments 1-88 or the composition of any one of embodiments 88-90.

Embodiment 92 the method of embodiment 91, wherein the cell is in a subject.

Embodiment 93 the method of embodiment 92, wherein the subject is a human subject.

Embodiment 94 the method of any one of embodiments 91 to 94, wherein HIF2- α gene expression is inhibited by at least about 30%.

Embodiment 95. a method of treating a HIF2- α associated disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of embodiments 88-90.

Embodiment 96 the method of embodiment 95, wherein the disease or disorder is cancer, kidney cancer, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, neovascular disease, or rheumatoid arthritis.

Embodiment 97 the method of embodiment 95 or 96, wherein the disease is clear cell renal cell carcinoma (ccRCC).

Embodiment 98 the method of any one of embodiments 91-97, wherein the RNAi agent is administered at a dose of about 3mg/kg to about 80mg/kg body weight of the human subject.

Embodiment 99 the method of embodiment 98, wherein the RNAi agent is administered at a dose of about 5mg/kg to about 20mg/kg body weight of the human subject.

Embodiment 100 the method of embodiments 98 or 99, wherein the RNAi agent is administered in a divided dose, wherein about half of the desired daily amount is administered in the initial administration and the remaining about half of the desired daily amount is administered about 4 hours after the initial administration.

Embodiment 101 the method of any one of embodiments 98-100, wherein one or more doses of the RNAi agent are administered 1 time per week.

Embodiment 102 the method of any one of embodiments 99-101, wherein a dose or divided dose of the RNAi agent is administered 1 time every 2 weeks (once every other week).

Embodiment 103. use of an RNAi agent of any one of embodiments 1-88 or a composition according to any one of embodiments 88-90 for treating a disease, disorder or condition mediated at least in part by HIF-2 α (EPAS1) gene expression.

Embodiment 104 the use of embodiment 103, wherein the disease is ccRCC.

Embodiment 105. use of the RNAi agent of any one of embodiments 1-88 or the composition according to any one of embodiments 88-90 for the preparation of a pharmaceutical composition for treating a disease, disorder or condition mediated at least in part by HIF-2 α (EPAS1) gene expression.

Embodiment 106 the use of embodiment 105, wherein the disease is ccRCC.

Other embodiments

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to be illustrative only and is not intended to limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

518页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：用羧基麦芽糖铁治疗铁缺乏

RNAi agents for inhibiting expression of HIF-2 alpha (EPAS1), compositions thereof, and methods of use

相关技术

网友询问留言