阅读说明：本技术 高三尖杉酯碱在制备抑制肿瘤细胞pd-l1制剂中的应用 (Application of homoharringtonine in preparation of tumor cell inhibiting PD-L1 preparation ) 是由 苏玲 刘相国 刘超 李晓鹏 王莹莹 于 2021-10-09 设计创作，主要内容包括：本发明公开了一种高三尖杉酯碱在制备抑制肿瘤细胞PD-L1制剂中的应用,其中有效下调肿瘤细胞PD-L1水平的高三尖杉酯碱的浓度为0.5～2μmol/L。此外,本发明证实TRIM13介导PD-L1的泛素化,且HHT增加肺癌细胞TRIM13的水平并增强TRIM13与PD-L1结合,表明HHT通过上调TRIM13蛋白水平并增强TRIM13与PD-L1结合,进而促进PD-L1通过泛素-蛋白酶体途径降解。同时小鼠实验证实HHT可抑制LLC荷瘤小鼠PD-L1的表达及增加杀伤性T细胞数量并抑制肿瘤生长。本发明的应用实现了通过下调肿瘤中的PD-L1水平抑制肿瘤的发展,预示HHT作为传统化疗药物可参与肿瘤免疫治疗,并具有良好的前景和实用价值。为传统药物在肿瘤治疗领域中的二次开发提供了一定的参考和启示,并为免疫治疗的联合用药提供了新思路。(The invention discloses an application of homoharringtonine in preparation of a preparation for inhibiting tumor cells PD-L1, wherein the concentration of homoharringtonine for effectively reducing the level of tumor cells PD-L1 is 0.5-2 mu mol/L. Furthermore, the present invention demonstrates that TRIM13 mediates ubiquitination of PD-L1 and that HHT increases the levels of TRIM13 in lung cancer cells and enhances the binding of TRIM13 to PD-L1, suggesting that HHT promotes the degradation of PD-L1 through the ubiquitin-proteasome pathway by up-regulating TRIM13 protein levels and enhancing the binding of TRIM13 to PD-L1. Meanwhile, the mouse experiment proves that HHT can inhibit the expression of LLC tumor-bearing mouse PD-L1, increase the number of killer T cells and inhibit the growth of tumors. The application of the invention realizes the inhibition of the development of the tumor by down-regulating the PD-L1 level in the tumor, indicates that HHT can participate in the tumor immunotherapy as the traditional chemotherapeutic drug, and has good prospect and practical value. Provides certain reference and inspiration for the secondary development of the traditional medicine in the field of tumor treatment, and provides a new idea for the combined medication of immunotherapy.)

1. Application of homoharringtonine in preparing preparation for inhibiting tumor cell PD-L1 is provided.

2. Use according to claim 1, characterized in that: the concentration of homoharringtonine which can effectively reduce the PD-L1 level of tumor cells is 0.5-2 mu mol/L; the tumor is a tumor with high expression of PD-L1 receptor naturally or with high expression of PD-L1 receptor caused by tumor treatment.

3. Use according to claim 2, characterized in that: the concentration of homoharringtonine which effectively down-regulates the PD-L1 level of tumor cells is 2 mu mol/L; the tumor is non-small cell lung cancer.

Technical Field

The invention relates to application of Homoharringtonine (HHT), which is a non-specific antitumor plant alkaloid in a Cell cycle, in particular to application of Homoharringtonine in preparation of a preparation for regulating the level of tumor cells PD-L1(Programmed Cell Death 1 Ligand 1, also called CD274 or B7-H1), and belongs to the technical field of biological medicine and molecular biology.

Background

PD-L1 is glycoprotein existing in tumor cell plasma membrane, and PD-L1 can induce T cell apoptosis, disability and exhaustion after being combined with PD1(Programmed Death Receptor 1) on T cell surface, thereby inhibiting tumor antigen specificity CD8⁺The activation, proliferation and anti-tumor functions of the T cells realize the immune escape of the tumor. To date, some monoclonal antibodies have been shown to be effective in treating cancer by targeting the PD1/PD-L1 signaling pathway, such as Nivolumab (nivaletuzumab) and pembrolizumab (palibrizumab), Atezolizumab (atizumab), avelumab and durvalumab, among others. However, antibody drugs also have disadvantages such as higher cost, difficulty in transportation, and potential immunogenic side effects, and there are many studies focused on the development of small molecule inhibitors designed for the PD1/PD-L1 signaling pathway. Tumor cells continuously activate the PD1/PD-L1 signaling pathway by highly expressing PD-L1, thereby triggering various immunosuppressive mechanisms, and then the binding of PD1 to PD-L1 can also be interrupted by inhibiting the expression of PD-L1 or promoting its degradation. Therefore, the small molecular compound capable of down-regulating the expression of PD-L1 in the tumor cells is searched, the molecular mechanism of the small molecular compound is researched, and the small molecular compound has important significance for improving the immunotherapy effect of the lung cancer.

Homoharringtonine (HHT) is natural effective cell cycle nonspecific antitumor plant alkali, is derived from a plant of Taxus genus of Taxaceae family, has molecular formula of C29H39NO9, and molecular weight of 545.631. Because of low price and remarkable effect, the compound has been clinically used for treating leukemia for more than 30 years, and mainly plays an anti-tumor role by inhibiting protein synthesis of eukaryotic cells, interfering early stage of multimer formation, influencing DNA synthesis of the eukaryotic cells and inducing apoptosis of leukemia cells. At present, the clinical application is mainly used for treating ALL (acute lymphoblastic leukemia) or CML (chronic myelogenous leukemia). Many researches have proved that the alkaloid has antitumor activity, however, the influence of HHT on PD-L1 is not reported at present.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide the application of homoharringtonine (HHT) in preparing the preparation for inhibiting tumor cells PD-L1

The invention relates to application of homoharringtonine (HHT) in preparing preparations for inhibiting tumor cells PD-L1.

Wherein: the concentration of homoharringtonine (HHT) which can effectively reduce the level of PD-L1 of tumor cells is 0.5-2 mu mol/L. The tumor is a tumor with high expression of PD-L1 receptor naturally or with high expression of PD-L1 receptor caused by tumor treatment.

Preferably, the concentration of homoharringtonine (HHT) effective to down-regulate the PD-L1 level in tumor cells is 2. mu. mol/L. The tumor is non-small cell lung cancer.

The invention provides a regulation and control mode aiming at PD-L1 ubiquitination, which is helpful for further understanding the molecular mechanism related to PD-L1 and provides a theoretical basis for designing related medicaments.

The invention discovers that homoharringtonine (HHT) can inhibit tumor growth by down-regulating the level of mouse tumor tissue PD-L1 and increasing the number of killer T cells, discloses the potential of homoharringtonine (HHT) in antitumor immune response, and provides certain reference and revelation for secondary development of traditional medicines in the field of tumor treatment.

In order to better understand the essence of the invention, the application of homoharringtonine (HHT) in preparing the tumor cell inhibiting PD-L1 preparation and related research is illustrated by the biochemical and cell experiments and results.

The following experiments were carried out using biochemical, cell biological and molecular biological methods:

1. HHT downregulation of lung cancer cell PD-L1 protein levels

Treating H460, H1792 and A549 cells with homoharringtonine (HHT) (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M and 2. mu.M), collecting cells, and detecting PD-L1 protein level by Western blot; in H460, H1792 and A549 cells, 1 μ M homoharringtonine (HHT) is used for treating for 6H, 12H and 24H respectively, the cells are collected, and the level of PD-L1 protein is detected by Western blot.

The results show that: high Harringtonine (HHT) was able to down-regulate the protein level of PD-L1 in lung cancer cells by treating the cells in three cell lines, H460, A549 and H1792, at different concentrations and at different times, respectively (FIGS. 1A-F).

2. Homoharringtonine (HHT) downregulation of PD-L1 protein levels via the ubiquitin-proteasome pathway

PD-L1 expression is regulated by a variety of pathways including gene transcription, post-transcription, translation, and post-translational modifications. HHT can reduce the protein expression content of PD-L1 of human lung cancer cells, and whether HHT influences the expression of PD-L1 through transcription level or protein level needs to be determined. After treating A549 cells and H1792 cells with 1. mu.M and 2. mu.M HHT for 20 hours, RNA was extracted and subjected to RT-PCR to detect changes in the mRNA level of PD-L1.

Intracellular protein degradation is mainly through the lysosomal and proteasomal pathways. Based on HHT reducing its protein stability by post-translational modification of PD-L1, it was next verified whether HHT-induced reduction of PD-L1 levels was via the lysosomal or proteasomal pathway. After the cells A549 and H1792 are treated with 1 or 2 mu M homoharringtonine (HHT) for 12H, 20 mu mol/L of proteasome inhibitor MG132 and 15 mu mol/L of lysosome inhibitor CQ are respectively added for 8H, and then the levels of PD-L1 and ACTB are detected by western blot. Detecting pathways on which homoharringtonine is dependent for down-regulation of PD-L1.

pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-HA-UB plasmids were transfected into H1792 cells and treated with 20nM HHT for 2H, CO-IP experiments were performed using FLAG antibodies, and the level of ubiquitination of PD-L1 was detected by Western blot.

The results show that: (1) the data show that the mRNA levels of PD-L1 were elevated after dosing compared to controls, whether in a549 or H1792 cells (fig. 3A, B). Although the mRNA level of PD-L1 is increased, the protein expression amount is reduced, so that HHT does not down-regulate the PD-L1 level in tumor cells at the transcription level, and may down-regulate PD-L1 at the protein posttranslational level. (2) Treatment with proteasome inhibitor MG132 inhibited the down-regulation of PD-L1 by homoharringtonine (HHT) (fig. 2C, D), whereas the combined use of lysosomal inhibitor CQ was not significantly altered from treatment with homoharringtonine (HHT) alone (fig. 2E, F), suggesting that the down-regulation of homoharringtonine (HHT) by PD-L1 depends on the proteasome pathway rather than the lysosomal pathway. (3) Co-IP experiments demonstrated that homoharringtonine (HHT) enhances ubiquitination levels of PD-L1 and thus promotes degradation of PD-L1 via the ubiquitin-proteasome pathway (FIG. 2G).

3. Homoharringtonine (HHT) regulated TRIM13 protein levels

Based on previous studies, HHT was found to enhance ubiquitination of PD-L1, further speculated that HHT might regulate PD-L1 levels by E3 ligase. TRIM13, SYVN1, CHIP are several E3 ligases localized on the endoplasmic reticulum. In A549 cells, homoharringtonine (HHT) was treated for 20h at various concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M), and the cells were collected for lysis and assayed for PD-L1, TRIM13, CHIP, SYVN1 and ACTB protein levels by western blot. In H460, H1792 cells, homoharringtonine (HHT) was treated for 20H at various concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M), and then the cells were collected for lysis and the PD-L1, TRIM13 and ACTB protein levels were measured by western blot.

After treatment with 1. mu.M and 2. mu.M homoharringtonine (HHT) for 20H in H1792 and H460 cells, the cells were harvested, RNA was extracted, and transcription of TRIM13 was detected using RT-PCR.

After siRNA transfected into TRIM13 in H1792 cells interfered the expression of TRIM13 for 24H, 1 mu M homoharringtonine (HHT) was added into the cells for further treatment for 20H, and the expression conditions of PD-L1, TRIM13 and ACTB were detected by Western blot.

The results show that: (1) the increase in protein levels of TRIM13 after HHT treatment (FIGS. 3A-C) and no trend in transcript levels of TRIM13 after HHT treatment (FIG. 3D, E) indicate that the effect of HHT on TRIM13 does not occur at the transcript level. (2) Knock-down of TRIM13 revealed that down-regulation of PD-L1 by HHT could be suppressed to some extent (FIG. 3F). TRIM13 belongs to a protein of the TRIM family, and is primarily localized to the endoplasmic reticulum, while the E3 ligase anchored to the endoplasmic reticulum membrane may be involved in the degradation of misfolded proteins via the ERAD pathway. Thus, it was speculated that TRIM13 might mediate ubiquitination of PD-L1.

4. The expression level of TRIM13 is negatively correlated with PD-L1

The GEPIA database was used to analyze the correlation of PD-L1 with TRIM13 expression. The protein expression levels of PD-L1 and TRIM13 in A549, Calu-1, H1299, H157, H1792 and H460 NSCLC cells are detected by Western blot. The Kaplan-Meier Plotter database was used to analyze the correlation of overall survival of lung cancer patients with TRIM13 expression. Finally, TRIM13 was overexpressed in H460 cells in a gradient manner, and the protein expression levels of PD-L1 and TRIM13 were detected by Western blot.

The results show that: (1) analysis of the database using the GEPIA data platform revealed that the expression level of TRIM13 was negatively correlated with PD-L1 (fig. 4A). Western blot analysis of protein expression levels of PD-L1 and TRIM13 in 6 NSCLC cells revealed that in Calu-1 and H1299, the protein level of PD-L1 was high while the protein level of TRIM13 was low, whereas in A549, H1792 and H157, the protein level of PD-L1 was low while that of TRIM13 was high (FIG. 4B). In addition, the expression level of TRIM13 in lung cancer cells was positively correlated with the overall survival of lung cancer patients as analyzed by the Kaplan-Meier Plotter database (FIG. 4C). And TRIM13 was overexpressed in the H460 cells, showing that the protein level of PD-L1 also decreased (fig. 4D), all confirming that TRIM13 may be associated with protein stability of PD-L1.

5. TRIM13 interacts with PD-L1 and HHT enhances binding of both

Since the glycosylation of PD-L1 is important for its protein stability, two plasmids for PD-L1 were constructed in this application, one being pcDNA3.1-FLAG-PD-L1, which expresses the normally glycosylated form of PD-L1; the other is pcDNA3.1-FLAG-PD-L1(3NQ), which mutates the three major glycosylation sites (N192, N200 and N219) of PD-L1, rendering it unable to be normally glycosylated and eventually present in the endoplasmic reticulum in an immature, non-glycosylated form. pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-TRIM13 plasmids were transfected in HEK293FT, H1792 cells for 24H, Co-IP experiments were performed using FLAG protein antibodies, and the binding of TRIM13 to PD-L1(WT) and PD-L1(3NQ) was detected by Western blot. pcDNA3.1-HA-TRIM13 plasmid was transfected into H460 cells, and binding of endogenous protein PD-L1 to TRIM13 was detected by Western blot using HA protein antibody for Co-IP experiments.

pcDNA3.1-HA-TRIM13 plasmid was transfected into H460 cells, treated with 20nM homoharringtonine (HHT) for 2H, Co-IP using HA protein antibodies, binding of endogenous proteins PD-L1 to TRIM13 by Western blot, and grey scale analysis was performed.

The results show that: (1) TRIM13 interacted with both glycosylated and non-glycosylated PD-L1 (fig. 5A, B). In addition, pcDNA3.1-HA-TRIM13 plasmid was overexpressed in H460, and it was confirmed by Co-IP experiments that TRIM13 binds to endogenous PD-L1 (FIG. 5C). (2) Binding of TRIM13 to endogenous non-glycosylated PD-L1 was significantly enhanced after HHT treatment (fig. 5D, E), suggesting that HHT may mediate down-regulation of PD-L1 by TRIM 13.

6. TRIM13 enhances ubiquitination of PD-L1

pcDNA3.1-FLAG-PD-L1, pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids were transfected into HEK293FT cells, and Co-IP experiments were performed to detect the ubiquitination level of PD-L1 by Western blot. pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids are transfected in HEK293FT cells, and a Co-IP experiment is carried out to detect the ubiquitination level of non-glycosylation of PD-L1. pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids are respectively transfected in H1792 and A549 cells, and a Co-IP experiment is carried out to detect the glycosylation and non-glycosylation ubiquitination levels of PD-L1.

The results show that: (1) Co-IP experiments found that TRIM13 promoted ubiquitination of both glycosylated and unglycosylated PD-L1 (FIGS. 6A-D).

7. Homoharringtonine (HHT) can down-regulate mouse tumor tissue PD-L1 level and increase killer T cell number, and inhibit tumor growth

In mouse lung carcinoma cells LLC cells, were treated with homoharringtonine (HHT) at 0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M for 20h, and then the Pd-l1 and Actb protein levels were detected by western blot.

10C 57BL/6 mice 6 weeks old were divided into two groups, one control group, and injected subcutaneously with 1X 10⁶After 7 days, 100 mul.LLC cells are injected into the abdominal cavity every other day, and the culture is continued for 20 days; the other group was experimental and injected subcutaneously at 1X 10⁶After 7 days per 100. mu.l LLC cells, every other day HHT was injected intraperitoneally at a rate of 1.25mg/kg, and the culture was continued for 20 days. During this period, the weight of the mice and the length and width of the tumor were measured every other day, the size of the tumor was calculated according to the formula V ═ pi × (length × width2)/6, the mice were sacrificed after the end of the experiment and the tumor was removed and the dissected tumor was weighed.

Taking the dissected tumor tissue to make paraffin sections, and then performing immunohistochemistry and immunofluorescence experiments on the sections respectively. CD8⁺T cells, one of the T cells, kill target cells expressing antigens, and are important effector cells in combating viral infections, acute allograft rejection, and killing of tumor cells. Thus, CD8⁺The number of T cells reflects to some extent the killing ability of the tumor. The level of PD-L1 in mouse tumor tissue was observed under a microscope, and mouse CD8 was observed under a fluorescent microscope⁺Distribution of T cells near LLC subcutaneous transplanted tumor tissue.

The results show that: (1) HHT had a downregulation of PD-L1 expression in mouse lung carcinoma cells LLC (FIG. 7A). (2) The growth of tumor tissue in the experimental mice slowed significantly with the increase in HHT injection time (FIG. 7E). The final anatomical results also showed that 2 neoplastic mice in the experimental group had a gradual reduction in tumor until disappearance after HHT injection (fig. 7C). The dissected tumor is weighed, the tumor weight in the experimental group is found to be obviously lower than that in the control group, and the statistical analysis shows that the tumor weight and the control group have obvious difference (p)<0.05) (fig. 7F). In the whole experiment process, the weight average of the two groups of mice is steadily increased, so that the influence of the growth condition of the mice on the experiment result can be eliminated(FIG. 7D). (3) The level of PD-L1 in the tumor tissue of the mice in the experimental group was found to be lower than that of the control group by immunohistochemical experiments (FIG. 8A). The results of immunofluorescence experiments on paraffin sections of two groups show that CD8 of the experimental group⁺T lymphocytes were more abundant than the control (FIG. 8B), suggesting that HHT treatment may enhance the killing ability of mouse T cells.

From the above experiments and the results thereof, the following conclusions can be drawn:

in non-small cell lung cancer, the expression level of PD-L1 protein can be down-regulated after High Harringtonine (HHT) treatment. Secondly, in vitro cell experiments are utilized to prove that HHT can promote the degradation of PD-L1 through ubiquitin-proteasome pathway by up-regulating the protein expression level of TRIM13 and enhancing the combination of TRIM13 and PD-L1. Finally, HHT treatment can inhibit the expression of LLC tumor-bearing mouse PD-L1, increase the number of killer T cells and inhibit tumor growth through mouse experiments.

The invention has the beneficial effects that:

the invention provides application of homoharringtonine (HHT) in preparing a preparation for inhibiting tumor cells PD-L1. Wherein: the concentration of the ubenioside capable of effectively reducing the level of tumor cells PD-L1 is 0.5-2 mu mol/L. And further proves that homoharringtonine can inhibit the development of tumors by regulating the PD-L1 level in the tumors and the application potential of homoharringtonine in antitumor immune response. Meanwhile, the homoharringtonine disclosed by the invention lays a foundation for researching and developing preparations for inhibiting tumor cells PD-L1, and also provides certain reference and inspiration for secondary development of traditional medicines in the field of tumor treatment.

The regulation and control mode aiming at the ubiquitination of PD-L1 is helpful for further understanding the molecular mechanism related to PD-L1, provides a theoretical basis for designing related medicaments, provides a theoretical basis for solving the basic mechanism of tumor escape, is expected to expand the application of HHT in the field of antitumor immunotherapy, and provides a new idea for the combined medication of immunotherapy.

Drawings

FIG. 1 shows that homoharringtonine (HHT) can reduce the protein level of PD-L1 in lung cancer cells

Wherein FIGS. 1A-C show the detection of PD-L1 protein levels by Western blot after 20H treatment with HHT (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) in H460, A549 and H1792 cells; FIGS. 1D-F show the detection of PD-L1 protein levels by Western blot after treatment with 1. mu.M HHT for 6H, 12H, and 24H in H460, A549, and H1792 cells, respectively.

FIG. 2 shows that homoharringtonine (HHT) down-regulates PD-L1 protein levels via the ubiquitin-proteasome pathway

Wherein, FIGS. 2A and 2B show that total RNA is extracted after the cells A549 and H1792 are treated for 20H by using HHT with the concentration of 1 mu M and 2 mu M, and 1 mu g of the total RNA is taken to carry out RT-PCR to detect the transcription level of PD-L1; FIGS. 2C and 2D show that 20. mu.M of the proteasome inhibitor MG132 blocks the proteasome-associated degradation pathway in A549 and H1792, 1. mu.M of HHT treatment is performed for 12H, MG132 is added for further culture for 8H, and the levels of PD-L1 and ACTB are detected by Western blot; FIGS. 2E, 2F show that 15. mu.M of the lysosomal inhibitor CQ was used to block the lysosomal-associated degradation pathway in A549 and H460, and that CQ was added 12H after 1. mu.M HHT treatment and incubation was continued for 8H, and the levels of PD-L1 and ACTB were measured by Western blot; FIG. 2G shows the ubiquitination of PD-L1 by Western blot by overexpressing pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-HA-UB plasmids in H1792 cells and treating for 2H with 20nM HHT for Co-IP experiments.

FIG. 3 shows that homoharringtonine (HHT) regulates TRIM13 protein levels

Wherein FIG. 3A shows the detection of PD-L1, TRIM13, CHIP and SYVN1 protein levels by Western blot after 20h of treatment with HHT gradient concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M) in A549; FIGS. 3B, 3C show the detection of PD-L1 and TRIM13 protein levels by Western blot after 20H treatment with HHT gradient concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) in H460 and H1792; FIGS. 3D and 3E show the transcript detection of TRIM13 by RT-PCR after 20H treatment with 1. mu.M and 2. mu.M HHT in H460 and H1792; FIG. 3F shows the detection of expression of PD-L1, TRIM13, and ACTB by Western blot after knocking down the expression of TRIM13 with siRNA of TRIM13 in H1792 and treating the cells with 1. mu.M HHT for 20H.

FIG. 4 shows that the expression level of TRIM13 is negatively correlated with PD-L1

Wherein, FIG. 4A is a graph of the correlation of PD-L1 with TRIM13 expression using the GEPIA database; FIG. 4B is the protein expression levels of PD-L1 and TRIM13 in different NSCLC cells (A549, Calu-1, H1299, H157, H1792, and H460); FIG. 4C is a graph of correlation of overall survival of lung cancer patients with TRIM13 expression using the Kaplan-Meier Plotter database; FIG. 4D shows that pcDNA3.1-HA-TRIM13 plasmid is over-expressed in H460, and the protein expression levels of PD-L1 and TRIM13 are detected by Western blot.

FIG. 5 shows TRIM13 interacting with PD-L1 and homoharringtonine (HHT) enhancing binding of both

FIGS. 5A and 5B show that pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-TRIM13 plasmids are overexpressed in HEK293FT and H1792 cells, and the binding condition of TRIM13 with PD-L1(WT) and PD-L1(3NQ) is detected through a Co-IP experiment; FIG. 5C shows the overexpression of pcDNA3.1-HA-TRIM13 plasmid in H460, and the detection of the binding of endogenous protein PD-L1 to TRIM13 by Co-IP assay using HA beads; FIGS. 5D, 5E show the overexpression of pcDNA3.1-HA-TRIM13 plasmid in H460 and treatment with 20nM HHT for 2H, Co-IP experiments using HA beads, detection of the binding of endogenous protein PD-L1 to TRIM13, and grey scale analysis, mean + -SEM, <0.05,. p < 0.01.

FIG. 6 is TRIM13 enhanced ubiquitination of PD-L1

Wherein, FIG. 6A shows that pcDNA3.1-FLAG-PD-L1, pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids are over-expressed in HEK293FT cell, and the ubiquitination level of PD-L1 is detected by Co-IP experiment; FIG. 6B shows the overexpression of pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13, and pcDNA3.1-HA-UB plasmids in HEK293FT cells, and the detection of the ubiquitination level of non-glycosylation of PD-L1 by Co-IP assay; FIGS. 6C and 6D show that pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids are overexpressed in H1792 and A549 cells, and the ubiquitination levels of glycosylation and non-glycosylation of PD-L1 are detected by Co-IP experiments.

FIG. 7 shows that homoharringtonine (HHT) inhibits LLC tumor growth in mice

Wherein, FIG. 7A shows the expression levels of Pd-l1 and Actb detected by WB after 20h of HHT gradient (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) treatment in mouse lung cancer cell LLC; FIGS. 7B and 7C show photographs of tumors taken 20 days after inoculation; figure 7D is a record of mouse body weight after inoculation, measured every other day; FIG. 7E shows the growth of LLC tumors with time after inoculation, with tumor volumes measured every other day, mean + -SEM,. p < 0.05; figure 7F is mouse tumor weight recordings, mean ± SEM,. p < 0.05.

FIG. 8 shows that homoharringtonine (HHT) down-regulates PD-L1 levels in mouse tumor tissues and increases the number of killer T cells

Wherein, FIG. 8A is a graph of the expression of mouse PD-L1 in LLC subcutaneous transplanted tumors analyzed by immunohistochemistry; FIG. 8B is a graph of immunofluorescence analysis of mouse CD8 using CD8 antibody⁺Distribution of T cells near LLC subcutaneous transplanted tumor tissue.

Detailed Description

The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.

In the following examples, materials, plasmids, reagents and the like used were obtained commercially unless otherwise specified.

Wherein: homoharringtonine (HHT) was purchased from MCE; human non-small cell type lung cancer cell lines (NSCLC): h460, H1792, A549, H157, H1299, Calu-1 were all purchased from ATCC in USA; human embryonic kidney cell line: HEK293FT, HEK293T were purchased from Invitrogen.

The plasmids referred to in the examples of the present invention are: the pcDNA3.1-FLAG-PD-L1, pcDNA3.1-HA-UB, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-HA-TRIM13 and pcDNA3.1-TRIM13 are all constructed by adopting a conventional molecular biology method, wherein the specific construction method taking the pcDNA3.1-FLAG-PD-L1 plasmid as an example is as follows:

1. tumor cell RNA extraction

(1) The cells were cultured in 6-well plates, and the medium solution in the plates was aspirated by a vacuum pump before RNA extraction, and then washed once with 1 XPBS phosphate buffer solution, and the residual liquid was aspirated.

(2) To each 6-well plate, 500. mu.L of TRIZOL solution was added for lysis, and the cells were completely disrupted by repeatedly pipetting using a pipette, after which the 6-well plate was left to stand at room temperature for 5 minutes.

(3) After standing, the lysate was placed in an autoclaved 1.5mL RNase-free centrifuge tube. Then, 100. mu.L of chloroform solution was added thereto, and the mixture was sufficiently shaken for about 15 seconds, and finally allowed to stand at room temperature for 2 minutes.

(4) After standing for 2 minutes, the centrifuge tube was placed in a 4 ℃ low temperature centrifuge and centrifuged for 15 minutes at 12000 g.

(5) After the centrifugation is finished, the solution is obviously divided into an upper layer, a middle layer and a lower layer, the liquid in the upper layer is sucked into a new centrifugal tube by using a liquid transfer machine, and 250 mu L of isopropanol solution is added. The mixture was left standing at room temperature for 10 minutes.

(6) After standing, the centrifuge tube is placed into a 4 ℃ centrifuge at 12000g for 10 minutes.

(7) After centrifugation, the supernatant was carefully removed using a pipette, and then 500. mu.L of a 75% ethanol solution prepared with DEPC water was added to the centrifuge tube, gently flicked, and then centrifuged at 7500g for 5 minutes in a 4 ℃ centrifuge. This process was repeated twice.

(8) And (4) completely discarding the supernatant by using a pipettor, and placing the centrifugal tube on sterile absorbent paper with the opening facing downwards for natural drying.

(9) In the air drying process, the white precipitate at the bottom of the centrifuge tube can be clearly seen to become more and more transparent, then 40 mu L of DEPC water is added, and the precipitate is flicked evenly to completely dissolve the RNA of the substrate.

(10) The purity and concentration of the extracted RNA was measured using a spectrophotometer.

2. Reverse transcription process

(1) The whole process of loading is carried out on the ice box. The reverse transcription kit was taken on ice.

(2) An autoclaved PCR vial was taken, and 1. mu.L of oligo (dT) and 1. mu.g of extracted RNA (the volume added to RNA was calculated) were added thereto, and the remaining volume was made up to 13. mu.L using sterile ultrapure water, gently mixed, and then subjected to short-cut centrifugation in a high-speed centrifuge for 10 seconds.

(3) After centrifugation, the PCR tube was placed in a PCR apparatus, and reaction was carried out at 65 ℃ for 10 minutes.

(4) After the Reaction, the PCR tube was taken out, and 4. mu.L of 5 × Reaction buffer, 0.5. mu.L of RNase inhibitor, 0.5. mu.L of reverse transcriptase and 2. mu.L of dNTP solution were added thereto, gently mixed, and subjected to instantaneous centrifugation.

(5) After centrifugation, the PCR tube is placed in the PCR instrument again, the set program is that the reaction is carried out for 30 minutes at 55 ℃, then the reaction is carried out for 5 minutes at 85 ℃, and finally the reaction is stored at-20 ℃ after the reaction is finished.

3. Cloning of the target Gene

(1) PCR system used for gene cloning:

reagent name addition volume

The sequences of upstream and downstream primers of the PD-L1 gene are as follows:

pcDNA3.1-PD-L1-FLAG FWD:

CGGTACCGCCGCCACCATGAGGATATTTGCTGTCTTTATATTC

pcDNA3.1-PD-L1-FLAG REV:

CCTCGAGTTACTTGTCGTCATCGTCTTTGTAGTCCGTCTCCTCCAAATGTGTATC

(2) PCR reaction time and temperature setting:

temperature setting time setting

98 ℃ for 2 minutes

98 deg.C for 10 seconds

53 deg.C for 15 seconds

72 deg.C for 30 seconds

72 ℃ for 7 minutes

Storing at 4 deg.C

Note: the number of PCR cycles was set to 35 cycles.

(3) Adding A for reaction: and (3) putting 30 mu L of PCR final product into a new PCR tube, adding 0.3 mu L of DNA Taq polymerase into the new PCR tube, gently mixing the mixture evenly, and putting the mixture into a PCR instrument for a reaction process of 20 minutes at 72 ℃.

(4) Connection of the target gene fragment to the T vector:

reagent name volume

T-vector ligation was performed overnight at 16 ℃ in a PCR instrument.

4. Plasmid expression vector construction

(1) 10. mu.L of E.coli competent cells were taken from a freezer at-80 ℃ and placed on an ice box.

(2) 3-5 mul of the product of the gene and T vector connection is added into the competent cells, mixed evenly and then placed on an ice box for 30 minutes.

(3) After completion of the standing on ice, the heat shock reaction was carried out in a constant temperature water bath at 42 ℃ for 90 seconds, followed by further standing on ice for 2 minutes.

(4) After standing, 500. mu.L of liquid LB medium was added to the centrifuge tube, and the mixture was shake-cultured on the bacterial culture medium bed at 37 ℃ for 1 hour.

(5) After 1h, 500. mu.L of the above-mentioned bacterial solution was added to LB solid medium containing antibiotics selected according to the resistance gene carried by the vector to which it was ligated, using a pipette.

(6) After bacterial plating, the bacterial plates were incubated in a 37 ℃ bacterial incubator overnight with inversion.

(7) An appropriate number of 1.5mL centrifuge tubes were taken, 15. mu.L of sterile water was added thereto, and then a certain number of individual strains were picked up and put in sterile water according to colonies growing on the plates.

(8) After completion of the picking, 15. mu.L of phenol chloroform isoamyl alcohol solution was added to the centrifuge tube and the bacteria were sufficiently lysed using a vortex shaker.

(9) And after the lysis is finished, centrifuging at normal temperature for 10 minutes at 12000g, dividing the solution into three layers after centrifugation, and taking the upper layer solution for agarose gel electrophoresis verification.

(10) And selecting the successfully connected colonies according to the electrophoresis result, and carrying out a bacteria shaking step. Firstly, adding a liquid LB culture medium and 1 per mill of antibiotics into a 5mL bacteria shaking tube, and then picking out a selected single colony to be placed into a bacteria incubator to be subjected to shake culture for 16 h.

(11) And extracting plasmids by using a small-extraction medium-amount plasmid extraction kit.

(12) The extracted plasmid is sent to a biological company to test the gene sequence, and whether the gene sequence is consistent with the target gene sequence or not is compared.

(13) Carrying out the same restriction enzyme KpnI and XhoI enzyme digestion on the T vector connected with the PD-L1 gene fragment and the plasmid expression vector pcDNA3.1, and carrying out agarose gel electrophoresis verification after the enzyme digestion is finished. The enzyme digestion system is as follows:

reagent name volume

(14) After the verification is successful, cutting the band on the agarose gel electrophoresis, recovering the gel, and purifying the DNA.

(15) The PD-L1 gene fragment recovered from the glue is connected with a plasmid expression vector according to the following system:

reagent name volume

5. Protein validation

Selecting plasmid transfection cells with correct construction sequencing, collecting the cells, making a western blot, and verifying whether the protein is over-expressed.

In addition to the construction of the pcDNA3.1-FLAG-PD-L1 plasmid, the construction of the other plasmids was performed as above, except that the sequences of the upstream and downstream primers required for each plasmid were as follows:

pcDNA3.1-HA-TRIM13 FWD:

CAAGCTTGCCGCCACCATGGATGTGATGGAGCTGCTTG

pcDNA3.1-HA-TRIM13 REV:

CTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTATAATAGTTTATATTTGCACAC AAAT

pcDNA3.1-TRIM13 FWD:

CAAGCTTGCCGCCACCATGGATGTGATGGAGCTGCTTG

pcDNA3.1-TRIM13 REV:

CTCTAGATTATAATAGTTTATATTTGCACACAAAT。

example 1: homoharringtonine (HHT) down-regulated lung cancer cell PD-L1 protein level

H460, H1792 and A549 cells were seeded in 12-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h incubation in an incubator, the plates (dishes) with the cells were placed on ice and the medium was aspirated off after treatment with homoharringtonine (HHT) (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) for 20 h; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of cell lysate (PIC) containing 1% mixed protease inhibitor, performing ice lysis for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, and collecting supernatant. Then, a standard curve is made and the protein concentration is measured, 5 EP tubes with the volume of 1.5mL are taken firstly, 10 mu L of deionized water is added respectively, and then (0, 1, 2, 4, 8) mu L of BSA (the concentration is 2mg/mL) is added respectively, and the group is used for making the standard curve; taking a 0.5mL EP tube, adding 10 mu L deionized water, and then adding 2 mu L protein sample lysate; preparing a proper amount of 1 x protein dye solution (which is prepared by diluting 5 x protein dye solution and is prepared in situ), adding 500 mu L dye solution into an experimental group, adding 1mL dye solution into a standard yeast group, and uniformly mixing; respectively taking 200 mu L of each tube of liquid, adding the liquid into a 96-well plate, measuring an OD value under the wavelength of 595nm by using an enzyme-labeling instrument, drawing a standard curve according to the OD value of a standard curve group, and calculating the concentration of a sample according to the OD value of the sample; calculating the required protein lysate according to the concentration and the sample loading amount, 3Sequentially adding the volumes of xSDS and 1 xSDS into a 0.5mL EP tube to prepare a protein sample; performing metal bath at 95 deg.C, denaturing for 5min, and loading on SDS-PAGE gel. Separating glue and concentrated glue are prepared according to the formula. And (4) carrying out short-time centrifugation on the protein sample after the metal bath heating denaturation, and then carrying out loading. The rubber hole comb is pulled out, and the diluted 1 XRunning Buffer solution is added into the electrophoresis tank and the rubber plate. The standard protein Marker is added into the loading pore channel according to the experimental sequence of the protein sample and is added among different experimental groups to indicate the molecular weight of different proteins. And (3) glue running is carried out after the sample loading is finished, glue pressing is carried out at a voltage of 90V, and glue running is finished when bromophenol blue runs to the position near the bottom of the glue by using a voltage of 120V after the protein Marker is separated. Then, the membrane is transferred, the PVDF membrane is activated by methanol for 1min, the Transfer buffer is precooled in advance, and the proteins on the gel are transferred to the PVDF membrane by a wet Transfer method for 150V for 2-3 h. After the membrane transfer is finished, 5% of skimmed milk powder (in a configuration of 1 xPBST) is sealed for 1 h; washing with 1 × PBST for 5 min; primary antibody incubation, 3% BSA preparation primary antibody, and 4 ℃ incubation overnight; recovering primary antibody in the next day, washing with 1 × PBST twice for 8 min; incubating the secondary antibody (prepared by 3% skimmed milk powder) for 1h at room temperature; washing with 1 × PBST for 10 min; ECL color development, mixing the film with the substrate, placing in a dark room, exposing with a developing sheet, and analyzing the result. The PD-L1 protein level was detected after the above western blot procedure.

H460, H1792 and A549 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h of incubation in an incubator, the plates were treated with 1. mu.M homoharringtonine (HHT) for 6h, 12h, 24h, respectively, and then the plates (dishes) with the cells were placed on ice, and the medium was aspirated away; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of cell lysate (PIC) containing 1% mixed protease inhibitor, lysing on ice for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, collecting supernatant, and detecting the level of PD-L1 protein by the above western blot procedure.

The results show that: high Harringtonine (HHT) was able to down-regulate the protein level of PD-L1 in lung cancer cells by treating the cells in three cell lines, H460, A549 and H1792, at different concentrations and at different times, respectively (FIGS. 1A-F).

Example 2: homoharringtonine (HHT) downregulation of PD-L1 protein levels via the ubiquitin-proteasome pathway

A549 and H1792 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h of incubation in an incubator, treating the cells for 20h by using 1 mu M and 2 mu M HHT, extracting total RNA, sucking out a culture medium solution in a culture plate by using a vacuum suction pump before extracting the RNA, then adding 1 XPBS phosphoric acid buffer solution for cleaning once, and sucking out residual liquid; adding 500 mu L of TRIZOL solution into each 6-well plate for cracking, repeatedly blowing and beating the 6-well plate by using a pipette during cracking so as to completely crack the cells, and standing the 6-well plate for 5 minutes at room temperature; after standing, the lysate was placed in an autoclaved 1.5mL RNase-free centrifuge tube. Then adding 100 mu L of chloroform solution for fully shaking for about 15s, and finally standing for 2 minutes at room temperature; standing for 2 minutes, and then placing the centrifugal tube into a low-temperature centrifugal machine at 4 ℃ for centrifuging for 15 minutes at the rotating speed of 12000 g; after the centrifugation is finished, the solution is obviously divided into an upper layer, a middle layer and a lower layer, the liquid in the upper layer is sucked into a new centrifugal tube by using a liquid transfer machine, and 250 mu L of isopropanol solution is added. After being uniformly mixed, the system is placed at room temperature and stands for 10 minutes; after standing, putting the centrifuge tube into a 4 ℃ centrifuge at the rotating speed of 12000g for 10 minutes; after centrifugation, the supernatant was carefully removed using a pipette, and then 500. mu.L of a 75% ethanol solution prepared with DEPC water was added to the centrifuge tube, gently flicked, and then centrifuged at 7500g for 5 minutes in a 4 ℃ centrifuge. This process was repeated twice; completely discarding the supernatant by using a pipettor, and placing the opening of the centrifugal tube downwards on sterile absorbent paper for natural drying; in the air drying process, the white precipitate at the bottom of the centrifuge tube can be clearly seen to become more and more transparent, then 40 mu L of DEPC water is added, and the precipitate is flicked evenly to completely dissolve the RNA of the substrate; the purity and concentration of the extracted RNA was measured using a spectrophotometer. Taking the reverse transcription kit on ice; mu.L of oligo (dT) and 1. mu.g of the extracted RNA (the volume added to the RNA was calculated) were added to an autoclaved PCR vial, and the remaining volume was made up to 13. mu.L with sterile ultrapure water, gently mixed,short-separating for 10 seconds in a high-speed centrifuge; after centrifugation, putting the PCR tubule into a PCR instrument, and reacting at 65 ℃ for 10 minutes; after the Reaction is finished, taking out the PCR tube, adding 4 mu L of 5 × Reaction buffer, 0.5 mu L of RNase inhibitor, 0.5 mu L of reverse transcriptase and 2 mu L of dNTP solution, gently mixing uniformly, and carrying out instantaneous centrifugation; after centrifugation, the PCR tube is placed in the PCR instrument again, the set program is that the reaction is carried out for 30 minutes at 55 ℃, then the reaction is carried out for 5 minutes at 85 ℃, and finally the reaction is stored at-20 ℃ after the reaction is finished. Using the obtained cDNA as a template, a 10. mu.L PCR system (2 XPrimeSTAR Max Premix 5. mu.L, 10. mu. mol/L PD-L1 gene upstream primer 0.4. mu.L, 10. mu. mol/L PD-L1 gene downstream primer 0.4. mu.L, template cDNA 0.4. mu.L, double distilled water 3.8. mu.L, total volume 10. mu.L) was used to perform PCR amplification of the gene sequence of PD-L1 using upstream and downstream primers designed from TRIM13 gene (shown in SEQ ID NO. 1), and then 1% agarose gel electrophoresis was performed to detect the transcription of PD-L1.

The sequences of the upstream and downstream primers of the PD-L1 gene are as follows:

FWD:GCTGCACTAATTGTCTATTGGGA

REV:GCTGCACTAATTGTCTATTGGGA

a549 and H1792 cells were seeded in 12-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h of incubation in an incubator, 1. mu.M homoharringtonine (HHT) was added for 12h, then 20. mu. mol/L proteasome inhibitor MG132 and 15. mu. mol/L lysosomal inhibitor CQ were added for 8h, respectively, and then the cells were collected for lysis (see example 1 for specific procedures) and tested for the levels of PD-L1 and ACTB by western blot (see example 1 for procedures).

H1792 cells were seeded in 10cm cell culture dishes at 37 ℃ CO₂After 24H of incubation in an incubator, pcDNA3.1-FLAG-PD-L1 and pcDNA3.1-HA-UB plasmids are transfected in H1792 cells, 2 EP tubes with the volume of 1.5mL are taken for each treatment, 200 mu L of culture medium is respectively added, after calculation according to experimental requirements, transfection reagents with the mass of 2 times of that of the plasmids and the plasmids are respectively added, the transfection reagents are respectively blown and beaten for five times by a pipette, and the mixture is kept stand for 5 min; mixing 2 liquids in 1.5mL EP tubes, blowing and beating for five times to fully mix the liquids, and standing for 20 min; will be originallySucking away a part of the culture medium, dripping the uniformly mixed and standing liquid, and shaking to uniformly distribute the liquid; after 6h of transfection, fresh medium with 5% serum was replaced and culture was continued for 24 h. One treatment was performed by adding homoharringtonine (HHT) at 20nM for 2h before collecting cells for 2h, and MG132 at 20. mu. mol/L was added for 6h before collecting cells for both treatments, and then the cell-grown plates (dishes) were placed on ice and the medium was aspirated away; washing the cells once with pre-chilled 1 × PBS, and then sucking away the liquid in the plate; adding appropriate volume of IP lysate containing 1% mixed Protease Inhibitor (PIC), lysing on ice for 30min, collecting cell lysate, centrifuging at 13200r/min at 4 deg.C for 15min, and collecting supernatant. To avoid non-specific binding of beads to Protein, 10. mu.L of Protein A beads or Protein G beads were placed in a 1.5mLEP tube, 900. mu.L of 1 XPBS was added, centrifugation was carried out at 9000G for 1min in a 4 ℃ centrifuge, the supernatant was carefully aspirated away, care was taken not to aspirate the beads, 900. mu.L of IP lysate was added, the above procedure was repeated, and finally the Protein sample lysate was added, incubated for 2-4h at 4 ℃ with slow shaking; add 15. mu.L of Protein A beads or Protein G beads to a new 1.5mLEP tube, add 900. mu.L of 1 XPBS, centrifuge 9000G for 1min at 4 ℃, carefully aspirate the supernatant, take care not to aspirate the beads, add 900. mu.L of IP lysate, repeat the above operations; centrifuging the protein sample containing the beads, collecting the supernatant, calculating the volume of the protein sample required by a Co-IP (Co-immunoprecipitation) experiment with a Western blot experiment (step shown in example 1) according to the experiment requirement, adding the protein sample into the newly washed beads, filling the volume with an IP lysate (containing 1% PIC) to 500 mu L, and preparing an input protein sample; adding the antibody into a 500 mu L system IP sample according to the ratio of the antibody to the protein of 1:1000, and incubating for 4-6h at 4 ℃ by a shaking table; after incubation, taking out the centrifuge tube for 1 minute at 4 ℃, centrifuging at 9000g, sucking out the supernatant by using a pipettor, then adding 900 mu L of an IP lysate containing 1% PIC, putting the lysate on a shaking table at 4 ℃ for washing beads for 5 minutes, finally centrifuging at 9000g for 1 minute, and sucking out the supernatant by using a pipette gun; adding 900 μ L of 1% PIC-containing IP lysate repeatedly, washing the beads on a shaking table at 4 deg.C for 5min, centrifuging at 9000g for 1min, and sucking out the supernatant with a pipette; finally, 20-25 μ L of 2 SDS was added, and the mixture was centrifuged briefly and then taken up at 100 daysDenaturation for 10 minutes on a Bridgman metal bath; 13200r/min, centrifuging for 5min, sucking the supernatant, running SDS-PAGE gel, performing the following operations like Western blot experiment (see example 1), and detecting the ubiquitination level of PD-L1 by Western blot.

The results show that: (1) the data show that the mRNA levels of PD-L1 were elevated after dosing compared to controls, whether in a549 or H1792 cells (fig. 2A, B). Although the mRNA level of PD-L1 is increased, the protein expression amount is reduced, so that HHT does not down-regulate the PD-L1 level in tumor cells at the transcription level, and may down-regulate PD-L1 at the protein posttranslational level. (2) Treatment with proteasome inhibitor MG132 inhibited the down-regulation of PD-L1 by homoharringtonine (HHT) (fig. 2C, D), whereas the combined use of lysosomal inhibitor CQ was not significantly altered from treatment with homoharringtonine (HHT) alone (fig. 2E, F), suggesting that the down-regulation of homoharringtonine (HHT) by PD-L1 depends on the proteasome pathway rather than the lysosomal pathway. (3) Co-IP experiments demonstrated that homoharringtonine (HHT) enhances ubiquitination levels of PD-L1 and thus promotes degradation of PD-L1 via the ubiquitin-proteasome pathway (FIG. 2G).

Example 3: homoharringtonine (HHT) up-regulates TRIM13 protein levels.

A549 cells were seeded in 12-well plates (cell culture dishes) at 37 ℃ in CO₂After 24h incubation in an incubator, homoharringtonine (HHT) was treated for 20h at various concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M) and the cells were collected for lysis (see example 1 for specific steps). The PD-L1, TRIM13, CHIP, SYVN1 and ACTB protein levels were then determined after Western blot (see example 1 for procedure). The H460 and H1792 cells were seeded in 12-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h incubation in an incubator, homoharringtonine (HHT) was treated for 20h at various concentrations (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) and the cells were collected for lysis (see example 1 for specific steps). The PD-L1, TRIM13 and ACTB protein levels were then detected after Western blot (see example 1).

H1792 and H460 cells were seeded separately in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24h incubation in an incubator, 1. mu.M and 2. mu.M of GaoSan were usedAfter 20h of treatment with harringtonine (HHT), RNA was extracted and transcription of TRIM13 was detected using RT-PCR (see example 2 for details).

The sequences of the primers upstream and downstream of TRIM13 gene are as follows:

FWD:GTTTTGCCTTGCTCCCACAAC

REV:TCCTTACGGCATGTAGGACAC

the H1792 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24H of incubation in an incubator, after the expression of TRIM13 is interfered by siRNA transfected by TRIM13 in H1792 cells (see example 2 in specific steps), 1 mu M homoharringtonine (HHT) is added into the cells for further treatment for 20H before the cells are collected for 20H, and the expression of PD-L1, TRIM13 and ACTB is detected by Western blot (see example 1 in steps).

The results show that: (1) the increase in protein levels of TRIM13 after HHT treatment (FIGS. 3A-C) and no trend in transcript levels of TRIM13 after HHT treatment (FIG. 3D, E) indicate that the effect of HHT on TRIM13 does not occur at the transcript level. (2) Knock-down of TRIM13 revealed that down-regulation of PD-L1 by HHT could be suppressed to some extent (FIG. 3F). TRIM13 belongs to a protein of the TRIM family, and is primarily localized to the endoplasmic reticulum, while the E3 ligase anchored to the endoplasmic reticulum membrane may be involved in the degradation of misfolded proteins via the ERAD pathway. Thus, it was speculated that TRIM13 might mediate ubiquitination of PD-L1.

Example 4: the expression level of TRIM13 is negatively correlated with PD-L1

The GEPIA database was used to analyze the correlation of PD-L1 with TRIM13 expression. 6 different NSCLC cells A549, Calu-1, H1299, H157, H1792 and H460 were inoculated into 6cm cell culture dishes at 37 deg.C and CO₂After 24h incubation in the incubator, expression of PD-L1, TRIM13 and ACTB was examined by Western blot (see example 1 for procedure). The Kaplan-Meier Plotter database was used to analyze the correlation of overall survival of lung cancer patients with TRIM13 expression. H460 cells were seeded in 6-well plates (cell culture dishes) at 37 ℃ with CO₂After 24H of incubation in an incubator, the pcDNA3.1-HA-TRIM25 plasmid was transfected into H460 cells (see example 3 for specific steps) at different doses for 24H, and the detection of PD-L1, pK-T was performed by Western blot (see example 1 for steps),Expression of TRIM13 and ACTB.

The results show that: (1) analysis of the database using the GEPIA data platform revealed that the expression level of TRIM13 was negatively correlated with PD-L1 (fig. 4A). Western blot analysis of protein expression levels of PD-L1 and TRIM13 in 6 NSCLC cells revealed that in Calu-1 and H1299, the protein level of PD-L1 was high while the protein level of TRIM13 was low, whereas in A549, H1792 and H157, the protein level of PD-L1 was low while that of TRIM13 was high (FIG. 4B). In addition, the expression level of TRIM13 in lung cancer cells was positively correlated with the overall survival of lung cancer patients as analyzed by the Kaplan-Meier Plotter database (FIG. 4C). And TRIM13 was overexpressed in the H460 cells, showing that the protein level of PD-L1 also decreased (fig. 4D), all confirming that TRIM13 may be associated with protein stability of PD-L1.

Example 5: TRIM13 interacts with PD-L1 and homoharringtonine (HHT) enhances binding of both

HEK293FT and H1792 cells were inoculated in 6cm and 10cm cell culture dishes, respectively, at 37 deg.C and CO₂After 24H of incubation in an incubator, pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ) and pcDNA3.1-HA-TRIM13 plasmids are transfected in HEK293FT and H1792 cells (the specific steps are shown in example 2) for 24H, MG132 with the concentration of 20 mu mol/L is added for treatment before the cells are collected for 6H, the cells are collected for Co-IP experiment (the steps are shown in example 2), and the combination of TRIM13 with PD-L1(WT) and PD-L1(3NQ) is detected. Inoculating H460 cells into 10cm cell culture dish at 37 deg.C and CO₂After 24H of incubation in an incubator, pcDNA3.1-HA-TRIM13 plasmid was transfected into H460 cells (see example 2 for specific steps) for 24H, and 20. mu. mol/L MG132 was added for treatment 6H before the cells were harvested, and the cells were harvested for Co-IP assay (see example 2 for steps) to detect the binding of the endogenous protein PD-L1 to TRIM 13.

Inoculating H460 cells into 10cm cell culture dish at 37 deg.C and CO₂After 24H incubation in an incubator, pcDNA3.1-HA-TRIM13 plasmid was transfected into H460 cells (see example 2 for details) for 24H, homoharringtonine (HHT) was added at 20nM for 2H before collection of cells 2H, MG132 was added at 20. mu. mol/L for 6H before collection of cells 6H, and cells were collected for CIn an o-IP experiment (see example 2 for steps), binding of the endogenous protein PD-L1 to TRIM13 was detected and subjected to gray scale analysis.

The results show that: (1) TRIM13 interacted with both glycosylated and non-glycosylated PD-L1 (fig. 5A, B). In addition, pcDNA3.1-HA-TRIM13 plasmid was overexpressed in H460, and it was confirmed by Co-IP experiments that TRIM13 binds to endogenous PD-L1 (FIG. 5C). (2) Binding of TRIM13 to endogenous non-glycosylated PD-L1 was significantly enhanced after HHT treatment (fig. 5D, E), suggesting that HHT may mediate down-regulation of PD-L1 by TRIM 13.

Example 6: TRIM13 enhances ubiquitination of PD-L1

HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ with CO₂After 24h of incubation in an incubator, pcDNA3.1-FLAG-PD-L1, pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmid 24h are transfected in HEK293FT cells (see example 2 in the specific steps), MG132 with the concentration of 20 mu mol/L is added for treatment 6h before the cells are collected, the cells are collected for Co-IP experiment (see example 2 in the steps), and the ubiquitination level of PD-L1 is detected. HEK293FT cells were seeded in 6cm cell culture dishes at 37 ℃ with CO₂After 24h of incubation in an incubator, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmids are transfected in HEK293FT cells (the specific steps are shown in example 2) for 24h, MG132 with the concentration of 20 mu mol/L is added for treatment 6h before the cells are collected, the cells are collected for Co-IP experiment (the steps are shown in example 2), and the ubiquitination level of non-glycosylation of PD-L1 is detected. Inoculating H1792 and A549 cells in 10cm cell culture dish, respectively, at 37 deg.C and CO₂After 24H of incubation in an incubator, pcDNA3.1-FLAG-PD-L1, pcDNA3.1-FLAG-PD-L1(3NQ), pcDNA3.1-TRIM13 and pcDNA3.1-HA-UB plasmid 24H are transfected in H1792 and A549 cells respectively (the specific steps are shown in example 2), MG132 with the concentration of 20 mu mol/L is added for treatment 6H before the cells are collected, the cells are collected for Co-IP experiment (the steps are shown in example 2), and the ubiquitination levels of glycosylation and non-glycosylation of PD-L1 are detected.

The results show that: (1) Co-IP experiments found that TRIM13 promoted ubiquitination of both glycosylated and unglycosylated PD-L1 (FIGS. 6A-D).

Example 7: homoharringtonine (HHT) can down-regulate mouse tumor tissue PD-L1 level and increase killer T cell number, and inhibit tumor growth

Inoculating mouse lung cancer cell LLC cell into 6-well plate (cell culture dish) at 37 deg.C and CO₂After 24h incubation in an incubator, cells were treated with homoharringtonine (HHT) (0, 0.125. mu.M, 0.25. mu.M, 0.5. mu.M, 1. mu.M, 2. mu.M) for 20h and then harvested for lysis (see example 1 for specific steps). Pd-l1 and Actb protein levels were then detected after passage through a western blot (see example 1 for procedure).

10C 57BL/6 mice 6 weeks old were divided into two groups, one control group, and injected subcutaneously with 1X 10⁶After 7 days, 100 mul.LLC cells are injected into the abdominal cavity every other day, and the culture is continued for 20 days; the other group was experimental and injected subcutaneously at 1X 10⁶After 7 days per 100. mu.l LLC cells, every other day HHT was injected intraperitoneally at a rate of 1.25mg/kg, and the culture was continued for 20 days. During this period, the weight of the mice and the length and width of the tumor were measured every other day, the size of the tumor was calculated according to the formula V ═ pi × (length × width2)/6, the mice were sacrificed after the end of the experiment and the tumor was removed and the dissected tumor was weighed.

Taking the dissected tumor tissue to carry out paraffin section preparation, firstly fixing the tumor tissue with 4% paraformaldehyde overnight, and washing the tumor tissue with 1 × PBS once before putting the tumor tissue into ethanol; adding 75% ethanol, and storing for a long time (4 deg.C) or at room temperature for 4 hr; treating with 85% ethanol for 2 h; treating with 95% ethanol for 1.5 hr; treating with 100% ethanol I for 40min, and treating with 100% ethanol II for 40 min; treating with ethanol xylene (1:1) for 10 min; treating xylene I for 15min and xylene II for 15min (different samples, the treatment time is not more than 30min as much as possible; treating xylene paraffin wax (1:1) for 30 min; dipping wax (selecting 56 ℃ melting point wax, and putting in an oven at 63 ℃ in advance), treating paraffin wax I for 1h, treating paraffin wax II for 1h, treating paraffin wax III for 2h, adjusting a heating pad to 75 ℃ in advance, putting the paraffin wax III, fresh paraffin wax and an embedding box on the heating pad, pouring the fresh paraffin wax into the embedding box, burning a pair of tweezers on an alcohol lamp, cooling in the paraffin wax, quickly putting the tissue into the embedding box with the paraffin wax, adjusting the position, moving the embedding box to a laboratory bench, adding label paper, after solidification, putting in a refrigerator at 4 ℃ for icing, then slicing, and using a slicing by using a slicing machineSlicing at 5 μm, and spreading in 40 deg.C water bath; and (3) placing the slide on a glass slide, baking in an oven at 63 ℃ for at least 4h, and storing at normal temperature for later use. Then, performing an immunohistochemical experiment on the paraffin section, and heating the section for 30min by using a former oven at 63 ℃ so as to facilitate dewaxing; the xylene I, II and III are respectively processed for 10min for dewaxing, and then 100%, 95%, 80%, 70% ethanol and ddH are added₂And O is hydrated for 5 min. The platelets were then antigen repaired: heating water to boil with an electromagnetic oven, placing the antigen retrieval box in the water, heating for 30min, keeping the slightly boiling state, and cooling at room temperature for at least 40 min; washing with 1 × PBS for three times, 5min each time; treating at room temperature for 10min to remove endogenous peroxidase and 3% H2O 2; washing with 1 × PBS for three times, 5min each time; treating with 0.2% Triton-X (PBS) for 15min, washing with 1 × PBS for three times, each for 5 min; adding normal goat serum confining liquid (5%, 1 × PBS), sealing at room temperature for 0.5 hr, and discarding the excess liquid; dripping 50ul-100ul of PD-L1 primary antibody, wetting the box at 4 ℃ overnight, and rewarming at room temperature for 30min the next day; washing with 1 × PBS for three times, 5min each time; dripping 50ul of secondary antibody (diluted by normal goat serum confining liquid in a ratio of 1:200), and standing at room temperature for 1 h; washing with 1 × PBS for three times, 5min each time; staining for 2-10min with DAB, grasping staining degree under microscope, and washing with tap water for 10 min; pulling haematoxylin for three times, flowing water for 2min, differentiating by hydrochloric acid ethanol, pulling for one time, and flowing water for 2 min; gradient ethanol dehydration for 3min each, xylene × 2 for 3min each; drying for 30min, adding 20ul of mounting solution (neutral gum: xylene: 2:1) and mounting. The level of PD-L1 in mouse tumor tissue was observed under a microscope. Then, performing immunofluorescence experiments on the paraffin sections, wherein the sections are heated for 30min in a former oven at 63 ℃ so as to be convenient for dewaxing; the xylene I, II and III are respectively processed for 15min to dewax, and then are respectively processed for 5min to hydrate by 100%, 95%, 80% and 70% ethanol and ddH 2O. And then performing antigen retrieval on the sheet: heating water to boil with an electromagnetic oven, placing the antigen retrieval box in the water, heating for 30min, keeping the slightly boiling state, and cooling at room temperature for at least 40 min; washing with 1 × PBS for three times, 5min each time; treating with 0.2% Triton-X for 12min, washing with 1 × PBS for three times, each for 5 min; adding normal goat serum confining liquid (5%, 1 × PBS), sealing at room temperature for 0.5 hr, and discarding the excess liquid; dripping CD8 to resist 50ul-100ul moisture at 4 DEG CThe box is kept overnight, and the room temperature is rewarmed for 30min on the next day; washing with 1 × PBS for three times, 5min each time; dripping 50ul of fluorescent secondary antibody (diluted by normal goat serum confining liquid in a ratio of 1:500), and standing for 1.5h (in a dark place) at room temperature; washing with 1 × PBS for three times, 5min each time; DAPI (1ug/ml) was stained for 10min, washed three times with 1 XPBS for 5min each; and sealing the anti-fluorescence quencher. Observation of mouse CD8 under fluorescent microscope⁺Distribution of T cells near LLC subcutaneous transplanted tumor tissue.

The results show that: (1) HHT had a downregulation of PD-L1 expression in mouse lung carcinoma cells LLC (FIG. 7A). (2) The growth of tumor tissue in the experimental mice slowed significantly with the increase in HHT injection time (FIG. 7E). The final anatomical results also showed that 2 neoplastic mice in the experimental group had a gradual reduction in tumor until disappearance after HHT injection (fig. 7C). The dissected tumor is weighed, the tumor weight in the experimental group is found to be obviously lower than that in the control group, and the statistical analysis shows that the tumor weight and the control group have obvious difference (p)<0.05) (fig. 7F). The weight average of the bodies of the two groups of mice steadily increased throughout the experiment, so that the influence of the growth conditions of the mice on the experiment results can be eliminated (fig. 7D). (3) The level of PD-L1 in the tumor tissue of the mice in the experimental group was found to be lower than that of the control group by immunohistochemical experiments (FIG. 8A). The results of immunofluorescence experiments on paraffin sections of two groups show that CD8 of the experimental group⁺T lymphocytes were more abundant than the control (FIG. 8B), suggesting that HHT treatment may enhance the killing ability of mouse T cells.

Sequence listing

<110> Shandong university

Application of homoharringtonine in preparation of tumor cell inhibiting PD-L1 preparation

<141> 2021-10-07

<160> 1

<210> 1

<211> 1233

<212> DNA

<213> Homo sapiens(human)

<221> nucleotide sequence of TRIM13 Gene

<222>（1）…（1233）

<400> 1

atggatgtga tggagctgct tgaagaagat ctcacatgcc ctatttgttg tagtctgttt 60

gatgatccac gggttttgcc ttgctcccac aacttctgca aaaaatgctt agaaggtatc 120

ttagaaggga gtgtgcggaa ttccttgtgg agaccagctc cattcaagtg tcctacatgc 180

cgtaaggaaa cttcagctac tggaattaat agcctgcagg ttaattactc cctgaagggt 240

attgtggaaa agtataacaa gatcaagatc tctcccaaaa tgccagtatg caaaggacac 300

ttggggcagc ctctcaacat tttctgcctg actgatatgc agctgatttg tgggatctgt 360

gctactcgtg gggagcacac caaacatgtc ttctgttcta ttgaagatgc ctatgctcag 420

gaaagggatg cctttgagtc cctcttccag agctttgaga cctggcgtcg gggagatgct 480

ctttctcgct tggatacctt ggaaactagt aagaggaaat ccctacagtt actgactaaa 540

gattcagata aagtgaagga attttttgag aagttacaac acacactgga tcaaaagaag 600

aatgaaattc tgtctgactt tgagaccatg aaacttgctg ttatgcaagc atatgaccca 660

gagatcaaca aactcaacac catcttgcag gagcaacgga tggcctttaa cattgctgag 720

gctttcaaag atgtgtcaga acccattgta tttctgcaac agatgcagga gtttagagag 780

aaaatcaaag taatcaagga aactccttta cctccctcta atttgcctgc aagcccttta 840

atgaagaact ttgataccag tcagtgggaa gacataaaac tagtcgatgt ggataaactt 900

tctttgcctc aagacactgg cacattcatt agcaagattc cctggagctt ttataagtta 960

tttttgctaa tccttctgct tggccttgtc attgtctttg gtcctaccat gttcctagaa 1020

tggtcattat ttgatgacct ggcaacttgg aaaggctgtc tttcaaactt cagttcctat 1080

ctgactaaaa cagccgattt catagaacaa tcagtttttt actgggaaca ggtgacagat 1140

gggtttttca ttttcaatga aagattcaag aattttactt tggtggtact gaacaatgtg 1200

gcagaatttg tgtgcaaata taaactatta taa 1233