阅读说明：本技术 血管生成素样3表达的调节 (Modulation of angiopoietin-like 3 expression ) 是由 R·M·克鲁克 M·J·格雷厄姆 R·李 K·W·多比 于 2011-01-07 设计创作，主要内容包括：本文提供的是用于减少动物中ANGPTL3 mRNA和蛋白的表达的方法、化合物和组合物。本文还提供的是用于在动物中减少血浆脂质、血浆葡萄糖和动脉粥样硬化斑块的方法、化合物和组合物。此类方法、化合物和组合物可用于治疗、预防、延缓或减轻任何一种或多种心血管疾病或代谢疾病或其症状。(Provided herein are methods, compounds, and compositions for reducing expression of ANGPTL3mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for reducing plasma lipids, plasma glucose, and atherosclerotic plaques in an animal. Such methods, compounds, and compositions are useful for treating, preventing, delaying, or ameliorating any one or more cardiovascular diseases or metabolic diseases or symptoms thereof.)

1. Use of a salt of a compound consisting of (a) a modified oligonucleotide or (b) a modified oligonucleotide conjugated to a conjugate group, wherein the modified oligonucleotide is 15 to 30 linked nucleosides in length, in the manufacture of a medicament for alleviating a metabolic disease or a cardiovascular disease in an animal, wherein the modified oligonucleotide has an amino acid sequence that is identical to a sequence of SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, modified sugar moiety and/or modified nucleobase, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the modified oligonucleotide is capable of reducing expression of ANGPTL3 in the animal by greater than or equal to 40%, wherein the metabolic or cardiovascular disease is associated with a change in cholesterol levels, triglyceride levels, and/or glucose levels in the animal.

2. Use of a salt of a compound consisting of (a) a modified oligonucleotide or (b) a modified oligonucleotide conjugated to a conjugate group, wherein the modified oligonucleotide is 15 to 30 linked nucleosides in length, in the manufacture of a medicament for reducing triglyceride levels in an animal, wherein the modified oligonucleotide has an amino acid sequence that is identical to the amino acid sequence of SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, modified sugar moiety and/or modified nucleobase, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the modified oligonucleotide is capable of reducing expression of ANGPTL3 in an animal by greater than or equal to 40%.

3. Use of a salt of a compound consisting of (a) a modified oligonucleotide or (b) a modified oligonucleotide conjugated to a conjugate group, wherein the modified oligonucleotide is 15 to 30 linked nucleosides in length, in the manufacture of a medicament for reducing cholesterol levels in an animal, wherein the modified oligonucleotide has an amino acid sequence that is complementary to a sequence of SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, modified sugar moiety and/or modified nucleobase, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the modified oligonucleotide is capable of reducing expression of ANGPTL3 in an animal by greater than or equal to 40%.

4. Use of a salt of a compound consisting of (a) a modified oligonucleotide or (b) a modified oligonucleotide conjugated to a conjugate group, wherein the modified oligonucleotide is 15 to 30 linked nucleosides in length, in the manufacture of a medicament for reducing Low Density Lipoprotein (LDL) levels in an animal, wherein the modified oligonucleotide has an amino acid sequence that is identical to SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, modified sugar moiety and/or modified nucleobase, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the modified oligonucleotide is capable of reducing expression of ANGPTL3 in an animal by greater than or equal to 40%.

5. Use of a salt of a compound consisting of (a) a modified oligonucleotide or a modified oligonucleotide conjugated to a (b) conjugate group, wherein the modified oligonucleotide is 15 to 30 linked nucleosides in length, in the manufacture of a medicament for reducing glucose levels in an animal, wherein the modified oligonucleotide has an amino acid sequence that is complementary to a sequence of SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, modified sugar moiety and/or modified nucleobase, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the modified oligonucleotide is capable of reducing expression of ANGPTL3 in an animal by greater than or equal to 40%.

6. The use of any one of claims 1-5, wherein the conjugate group is a carbohydrate conjugate group.

7. The use of any one of claims 1-5, wherein the animal is a human.

8. The use of any one of claims 1-5, wherein the salt of the modified oligonucleotide is a first active agent, and wherein a second active agent is administered to reduce a metabolic or cardiovascular disease, reduce triglyceride levels, reduce cholesterol levels, reduce Low Density Lipoprotein (LDL) levels, or reduce glucose levels.

9. The use of claim 8, wherein the first and second active agents are co-administered.

10. The use of any one of claims 8, wherein the second active agent is a glucose-lowering agent.

11. The use of claim 10, wherein the glucose-lowering agent is a PPAR agonist, a dipeptidyl peptidase IV inhibitor, a GLP-1 analog, an insulin or insulin analog, an insulin secretagogue, an SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof.

12. The use of claim 10, wherein the glucose-lowering agent is metformin, a sulfonylurea, rosiglitazone or a combination thereof.

13. The use of claim 10, wherein the glucose-lowering agent is a sulfonylurea selected from the group consisting of: acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, glipizide, glibenclamide or gliclazide.

14. The use of claim 10, wherein the glucose-lowering agent is metformin.

15. The use of claim 10, wherein the glucose-lowering agent is meglitinide (meglitinide) selected from nateglinide or repaglinide.

16. The use of claim 10, wherein the glucose-lowering agent is a thiazolidinedione selected from pioglitazone or rosiglitazone.

17. The use of claim 10, wherein the glucose-lowering agent is an alpha-glucosidase inhibitor selected from acarbose or miglitol.

18. The use of claim 8, wherein the second active agent is a lipid lowering agent.

19. The use of claim 18, wherein the lipid lowering agent is an HMG-CoA reductase inhibitor, a cholesterol absorption inhibitor, an MTP inhibitor, an antisense compound targeted to ApoB, or any combination thereof.

20. The use of claim 18, wherein the lipid lowering agent is an HMG-CoA reductase inhibitor selected from the group consisting of: atorvastatin, fluvastatin, lovastatin, pravastatin, rosuvastatin or simvastatin.

21. The use of claim 18, wherein the lipid lowering agent is the cholesterol absorption inhibitor ezetimibe.

22. The use of any one of claims 1-5, wherein the administration of the medicament comprises parenteral administration.

23. The use of any one of claims 1-5, wherein the modified oligonucleotide consists of a single-stranded modified oligonucleotide.

24. The use of any one of claims 1-5, wherein the modified oligonucleotide has an amino acid sequence identical to SEQ ID NO: 1-5, as measured on the integrity of the modified oligonucleotide.

25. The use of any one of claims 1-5, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

26. The use of claim 25, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

27. The use of any one of claims 1-5, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

28. The use of claim 27, comprising at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces the furanose ring.

29. The use of claim 28, wherein each of the at least one tetrahydropyran modified nucleoside has the structure:

wherein Bx is an optionally protected heterocyclic base moiety.

30. The use of claim 27, wherein at least one modified sugar is a bicyclic sugar.

31. The use of claim 27, wherein the at least one modified sugar comprises 2 '-O-methoxyethyl or 4' - (CH)₂)_n-an O-2' bridge, wherein n is1 or 2.

32. The use of any of claims 1-5, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

33. The use of claim 32, wherein the modified nucleobase is a 5-methylcytosine.

34. The use of any one of claims 1-5, wherein the modified oligonucleotide consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked nucleosides.

35. The use of any one of claims 1-5, wherein the modified oligonucleotide has a nucleotide sequence comprising the sequence set forth as SEQ ID NO: 41. 34-40 and 42-182, and a nucleobase sequence of at least 15 contiguous nucleobases of any one of the sequences.

36. The use of any one of claims 1-5, wherein the modified oligonucleotide consists of 20 linked nucleosides having a nucleotide sequence comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 41. 34-40 and 42-182, and comprises:

a. a gap segment consisting of 10 linked deoxynucleosides;

b. a 5' wing segment consisting of 5 linked nucleosides;

c. a 3' wing segment consisting of 5 linked nucleosides;

wherein the notch segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.

37. Use of a salt of a modified oligonucleotide in the manufacture of a medicament for treating an animal having a metabolic disease or a cardiovascular disease,

wherein said animal having a metabolic disease or a cardiovascular disease is identified,

wherein the medicament comprises a therapeutically effective amount of a salt of the modified oligonucleotide, wherein the modified oligonucleotide consists of 20 linked nucleosides and has a sequence that is identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 95% complementary, as measured on the integrity of a modified oligonucleotide, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, and wherein the metabolic or cardiovascular disease is associated with a change in cholesterol levels, triglyceride levels, and/or glucose levels in the animal.

38. The use of claim 37, wherein administering the medicament comprising a therapeutically effective amount of a salt of a modified oligonucleotide to the animal reduces metabolic or cardiovascular disease in the animal.

39. The use of claim 1 or 37, wherein the metabolic or cardiovascular disease is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, Non Alcoholic Fatty Liver Disease (NAFLD), high fatty acidemia, or metabolic syndrome, or a combination thereof.

40. The use of claim 39, wherein the dyslipidemia is hyperlipidemia.

41. The use of claim 40, wherein the hyperlipidemia is both hypercholesterolemia, hypertriglyceridemia, hypercholesterolemia, and hypertriglyceridemia.

42. The use of claim 39, wherein the NAFLD is hepatic steatosis or steatohepatitis.

43. The use of claim 39, wherein the diabetes is type 2 diabetes or type 2 diabetes with dyslipidemia.

44. The use of claim 2, wherein administration of the medicament results in a reduction in lipid levels, including triglyceride levels, cholesterol levels, insulin resistance, glucose levels, or a combination thereof.

45. The use of claim 44, wherein said level is independently reduced by 5%, 10%, 20%, 30%, 35% or 40%.

46. The use of any one of claims 1-5, wherein administration of the medicament results in increased insulin sensitivity.

47. The use of claim 46, wherein administration of the medicament results in increased hepatic insulin sensitivity.

48. Use of an ANGPTL3 inhibitor comprising a salt of a modified oligonucleotide consisting of 20 linked nucleosides and having an amino acid sequence that is identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 95% complementary, as measured on the integrity of the modified oligonucleotide, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar, wherein the metabolic or cardiovascular disease is associated with a change in cholesterol levels, triglyceride levels, and/or glucose levels in the animal.

49. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a reduction of atherosclerotic plaques.

50. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a reduction in the degree of obesity.

51. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a decrease in glucose.

52. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a lipid reduction.

53. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a decrease in glucose resistance.

54. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in a reduction in cholesterol.

55. The use of any one of claims 1-5 or 48, wherein administration of the medicament results in increased insulin sensitivity.

Technical Field

Provided herein are methods, compounds, and compositions for reducing expression of angiopoietin-like 3(ANGPTL3) mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions having an ANGPTL3 inhibitor for reducing an ANGPTL 3-associated disease or disorder in an animal. Such methods, compounds, and compositions are useful, for example, for treating, preventing, delaying, or ameliorating one or more cardiovascular diseases or metabolic syndrome or symptoms thereof in an animal.

Background

Diabetes and obesity (sometimes collectively referred to as "diabetes-obesity") are related in that obesity is known to exacerbate the pathology of diabetes and greater than 60% of diabetes are obese. Most people are obese in association with insulin resistance and leptin resistance. Indeed, it has been suggested that obesity may have a greater effect on insulin action than diabetes itself (Sindelka et al, Physiol Res., 2002, 51, 85-91). Furthermore, several compounds on the market for the treatment of diabetes are known to induce weight gain, which is a highly undesirable side effect for the treatment of the disease.

Cardiovascular diseases are also associated with obesity and diabetes. Cardiovascular disease encompasses multiple etiologies and has as broad a range of causative agents and related stakeholders. Many causative agents contribute to symptoms such as elevated plasma levels of cholesterol (including non-HDL cholesterol) and other lipid-related disorders. Such lipid-related disorders (commonly referred to as dyslipidemia) include hyperlipidemia, hypercholesterolemia, and hypertriglyceridemia, among other indications. Elevated non-HDL cholesterol is associated with atherosclerosis and its sequelae (including cardiovascular diseases such as atherosclerosis, coronary heart disease, myocardial infarction, ischemic shock, and other forms of heart disease.

Epidemiological and experimental evidence has shown that high levels of circulating Triglycerides (TG) can contribute to cardiovascular disease and various metabolic disorders (Valldivielso et al, 2009, Atheroscleosis.207 (2): 573-8; Zhang et al, 2008, Circ Res.1; 102(2): 250-6). TG derived from exogenous or endogenous sources is incorporated and secreted in chylomicrons from the small intestine or in Very Low Density Lipoproteins (VLDL) from the liver. Once in the circulation, TG is hydrolyzed by lipoprotein lipase (LpL) and the resulting free fatty acids can then be absorbed by local tissues and used as an energy source. Since LpL generally has a very high effect on plasma TG and metabolism, it is of great interest to find and develop compounds that affect LpL activity.

Metabolic syndrome is a combination of medical conditions that increase the risk of individuals to develop cardiovascular disease and diabetes. Symptoms (including hypertension, high triglycerides, reduced HDL, and obesity) tend to occur together in some individuals. Which affects many people in a collective manner. In some studies, prevalence in the USA has been calculated to be up to 25% of the population. The metabolic syndrome is widely known under various other names, such as (metabolic) syndrome X, insulin resistance syndrome, Reaven syndrome or CHAOS. With the high prevalence of cardiovascular and metabolic disorders, there remains a need for improved methods of treating these disorders.

Angiogenin is a family of secreted growth factors. Together with their corresponding endothelial specific receptors, angiogenin plays an important role in angiogenesis. Angiopoietin-like 3, a family member (also known as ANGPT5, ANGPTL3 or angiogenin 5), is expressed predominantly in the liver and is thought to play a role in regulating lipid metabolism (Kaplan et al, j. lipid res., 2003, 44, 136-143).

As a result of searching the combined EST databases, human genes of angiopoietin-like 3 were identified and cloned. The full-length human cDNA encodes a 460 amino acid polypeptide having the characteristic structural features of angiogenin: signal peptide, extended helical domain, short linker peptide, and globular Fibrinogen Homology Domain (FHD). Mouse angiopoietin-like 3cDNA was found to encode a 455 amino acid polypeptide with 76% identity to human polypeptide. Alignment of angiogenin shows that angiopoietin-like 3, unlike other family members, does not contain a motif that determines the acidic residues of the calcium binding site. Northern blot analysis revealed expression mainly in the liver of adult human tissues, whereas Northern blots of murine embryos showed the presence of transcripts as early as day 15, indicating that angiopoietin-like 3 was expressed early during liver development and maintained expression in adult liver. The mouse gene maps to chromosome 4, while the human gene maps to the 1p31 region (Conklin et al, Genomics, 1999, 62, 477-482).

KK obese mice have a polygenic syndrome of moderate obesity and a diabetic phenotype resembling human hereditary type 2 diabetes. These mice showed signs of hyperinsulinemia, hyperglycemia, and hyperlipidemia. The KK mouse strain, designated KK/San, has significantly low plasma lipid levels despite the signs of hyperinsulinemia and hyperglycemia. The mutant phenotype is recessive and the locus is called hyperlipidemia (hypl). The locus mapped to the middle of chromosome 4 and the gene was identified by positional cloning as angiopoietin-like 3. Injection of recombinant adenovirus comprising full length mouse or human angiopoietin-like 3cDNA in mutant KK/San mice resulted in increased plasma levels of triglycerides, total cholesterol and non-esterified fatty acids (NEFA). Similarly, injection of recombinant angiopoietin-like 3 protein into mutant mice increased the levels of triglycerides and non-esterified fatty acids (Koishi et al, nat. gene., 2002, 30, 151-157).

In another study focused on the metabolic pathway of triglycerides in KK/San mice, overexpression of angiopoietin-like 3 resulted in a significant increase in triglyceride-rich Very Low Density Lipoprotein (VLDL). Differences in hepatic VLDL triglyceride secretion were not significant between wild type KK and KK/San mice. However, studies with labeled VLDL showed that low plasma triglyceride levels in KK/San mice were primarily due to increased lipolysis of VLDL triglycerides rather than increased whole particle uptake. Plasma apoB100 and apoB48 levels in KK/San mice were similar to wild-type KK mice. ApoCIII deficient mice have a similar phenotype to KK/San mice, and ApoCIII is thought to regulate VLDL triglyceride metabolism by inhibiting lipase-mediated hydrolysis of VLDL triglycerides. In vitro analysis of recombinant proteins revealed that angiopoietin-like 3 directly inhibits lipoprotein lipase (LPL) activity (Shimizugawa et al, j.biol.chem., 2002, 277, 33742-33748).

Consistent with a role in lipid metabolism, angiopoietin-like 3mRNA was found to be up-regulated in C57BL/6J mice fed normal feed diet and 4% cholesterol and in mice treated with the Liver X Receptor (LXR) agonist T0901317. LXRs are ligand-activated transcription factors that play a role in regulating genes that govern cholesterol homeostasis in the liver and peripheral tissues. In addition to cholesterol metabolism, LXRs may also play a role in regulating fatty acid metabolism. Treatment of HepG2 cells with natural or synthetic active agents that activate LXR resulted in increased angiopoietin-like 3 expression. The promoter of the human angiopoietin-like 3 gene was found to contain LXR response elements. In addition, for other transcription factors, including HNF-1, HNF-4, and C/EBP, the promoter contains several protein binding sites (Kaplan et al, J.Lipid Res., 2003, 44, 136-143).

Treatment of rodents with T0901317 was associated with triglyceride accumulation in the liver and plasma. Hepatic triglyceride accumulation is explained by increased expression of sterol regulatory element binding protein-1 c (SREBP1c) and Fatty Acid Synthase (FAS), both targets of LXR. T0901317 failed to increase plasma triglyceride concentrations in angiopoietin-like 3 deficient mice, while stimulated hepatic triglyceride accumulation was similar to that observed in treated wild type mice. The elevation of plasma triglycerides in wild type mice treated with T0901317 resembles the induction of angiopoietin-like 3mRNA in the liver and increased protein plasma concentrations (Inaba et al, j.biol.chem., 2003, 278, 21344-21351).

More studies have addressed the increase in plasma Free Fatty Acid (FFA) levels observed in KK/Snk mice treated with exogenous angiopoietin-like 3. Probes of human tissues fixed with fluorescently labeled angiopoietin-like 3 protein demonstrated strong binding only on adipose tissue. Furthermore, radiolabeled protein binding was examined in 3T3-L1 adipocytes and was found to be saturable and specific. Incubation of 3T3-L1 adipocytes with angiopoietin-like 3 resulted in increased FFA and glycerol release into the culture medium (Shimamura et al, biochem. biophysis. res. commun., 2003, 301, 604-609).

In a study in which mice treated with Streptozotocin (STZ) were used to mimic the insulin deficient state and db/db mice were used to mimic the insulin resistant diabetic state, a large amount of hepatic angiopoietin-like 3 was observed in diabetic mice compared to control animals. Both models of diabetes show hypertriglyceridemia and the observed hyperlipidemia may be at least partially explained by increased angiopoietin-like 3 expression. These results indicate that angiopoietin-like 3 is a link between diabetes and dyslipidemia, and elevated levels will promote hyperlipidemia (Inukai et al, biochem. biophysis. res. commun., 2004, 317, 1075-1079).

Subsequent studies examined the regulation of angiopoietin-like 3 by leptin and insulin, both key players of the metabolic syndrome. Angiopoietin-like 3 expression and plasma protein levels are increased in leptin resistant db/db and leptin deficient ob/ob mice compared to controls. Supplementation of ob/ob mice with leptin reduces angiopoietin-like 3 levels. Changes in expression are correlated with changes in plasma triglyceride and free fatty acid levels. Gene expression and plasma protein levels were also increased in insulin deficient STZ-treated mice (Shimamura et al Biochem biophysis Res Commun, 2004, 322, 1080-1085).

recombinant angiopoietin-like 3 proteins were found to be associated with alpha based on members of the angiopoietin family_Vβ₃integrin binding and induced integrin α_Vβ₃Dependent chemotactic endothelial cell adhesion and migration. It also stimulates signal transduction pathways characteristic of integrin activation. Angiopoietin-like 3 strongly induces angiogenesis in rat corneal angiogenesis assays (Camenisch et al, J.biol.chem., 2002, 277, 17281-17290).

Genome-wide association scans (GWAS) were performed by several groups to measure the genome's consensus variants associated with plasma concentrations of HDL, LDL and triglyceride. GWAS studies have found a link between triglycerides and Single Nucleotide Polymorphisms (SNPs) adjacent to ANGPTL3 (Willer et al, Nature Genetics, 2008, 40(2): 161-169).

U.S. patent 7,267,819, application USSN 12/128,545 and application USSN 12/001,012 generally describe angiopoietin-like 3 agonists and antagonists.

PCT publications WO/02101039(EP02733390) and WO/0142499(USSN 10/164,030) disclose nucleic acid sequences complementary to mouse angiopoietin-like 3 (Ryuta, 2002; Ryuta, 2001).

There is currently a lack of acceptable options for treating cardiovascular and metabolic disorders. It is therefore an object herein to provide compounds and methods for the treatment of such diseases and disorders.

The potential role of angiopoietin-like 3 in lipid metabolism makes it an attractive target for research. Antisense technology has emerged as an effective method for reducing the expression of certain gene products and thus can prove uniquely useful in a variety of therapeutic, diagnostic and research applications that modulate angiopoietin-like 3.

Summary of The Invention

Provided herein are antisense compounds useful for modulating gene expression and related pathways via the action of antisense mechanisms such as rnase H, RNAi and dsRNA enzymes, as well as other antisense mechanisms based on target degradation or target occupancy.

Provided herein are methods, compounds, and compositions for inhibiting expression of ANGPTL3 and treating, preventing, delaying, or ameliorating an ANGPTL 3-associated disease, disorder, or symptom thereof. In certain embodiments, the ANGPTL 3-associated disease or disorder is a cardiovascular disease or metabolic disease.

In certain embodiments, the compounds and compositions of the present invention comprise modified oligonucleotides 10 to 30 linked nucleosides in length targeted to ANGPTL 3. The ANGPTL3 target can have an amino acid sequence selected from SEQ ID NO: 1-5. A modified oligonucleotide targeting ANGPTL3 can have a sequence comprising a sequence identical to SEQ ID NO: 1-5, equal length portions complementary to at least 8 contiguous nucleobases. A modified oligonucleotide targeting ANGPTL3 can have a sequence comprising an amino acid sequence selected from SEQ id nos: 34-182 of at least 8 consecutive nucleobases of the nucleobase sequence of any one of the nucleobase sequences. The modified oligonucleotide may have a sequence comprising an amino acid sequence selected from SEQ ID NOs: 34-182 of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 consecutive nucleobases of the nucleobase sequence of any one of claims 34-182. The contiguous nucleobase portion of the modified oligonucleotide may be complementary to a nucleobase sequence selected from SEQ ID NO: 1-5 are complementary to equal lengths of the ANGPTL3 region. The ANGPTL3 region may be selected from one or more of the following regions: 22-52, 116-145, 637-720, 953-983, 1333-1469 and 1463-1489.

Certain embodiments provide methods of reducing expression of ANGPTL3 in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting ANGPTL3 described herein.

Certain embodiments provide a method of reducing apoC-III expression, triglyceride levels, cholesterol levels, Low Density Lipoprotein (LDL) or glucose levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting ANGPTL3 described herein, wherein the modified oligonucleotide reduces ANGPTL3 expression in the animal.

Certain embodiments provide a method of reducing cardiovascular or metabolic disease in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting ANGPTL3 described herein, wherein the modified oligonucleotide reduces ANGPTL3 expression in the animal.

Certain embodiments provide methods for treating an animal having a cardiovascular disease or a metabolic disease, comprising: 1) identifying the animal having a metabolic disease or a cardiovascular disease, and 2) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleotide sequence identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary (as measured to the integrity of the modified oligonucleotide), thereby treating an animal having a cardiovascular disease or a metabolic disease. In certain embodiments, the therapeutically effective amount of the compound administered to the animal reduces cardiovascular disease or metabolic disease in the animal.

Certain embodiments provide methods of reducing one or more of ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, fat pad weight, cardiovascular disease, and metabolic disease in a human by administering an ANGPTL3 inhibitor comprising a modified oligonucleotide.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. As used herein, the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless otherwise indicated. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included," is not limiting. Also, terms such as "element" or "component" encompass both elements and components, including one unit and element and components comprising more than one subunit, unless expressly specified otherwise.

The section headings described herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions thereof, cited in this application, including but not limited to patents, patent applications, articles, books, and books, are hereby expressly incorporated by reference (for the documents described herein and their entirety).

Definition of

Unless a clear definition is provided, nomenclature used in connection with, and methods and techniques of, analytical chemistry, synthetic organic chemistry, and pharmaceutical and pharmaceutic chemistry described herein are well known and commonly used in the art. Standard techniques are available for chemical synthesis as well as chemical analysis. All patents, applications, published applications and other publications, GENBANK accession numbers, and related sequence Information available through databases such as National Center for Biotechnology Information (NCBI) and other data mentioned throughout this disclosure are incorporated herein by reference, where permitted, for the parts of the documents discussed herein and in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

"2 ' -O-methoxyethyl" (also known as 2' -MOE and 2' -O (CH))₂)₂-OCH₃) Refers to an O-methoxy-ethyl modification at the 2' position of the furanosyl ring. The 2' -O-methoxyethyl modified sugar is a modified sugar.

"2 '-O-methoxyethyl nucleotide" means a nucleotide comprising a 2' -O-methoxyethyl modified sugar moiety.

"3 'target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3' most terminal nucleotide of a particular antisense compound.

"5 'target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5' most terminal nucleotide of a particular antisense compound.

"5-methylcytosine" means cytosine modified with a methyl group attached to the 5' position. 5-methyl cytosine is a modified nucleobase.

By "about" is meant within ± 10% of the value. For example, if reference to "a marker can be increased by about 50%", then it is implied that the marker can be increased by 45% -55%.

By "Active pharmaceutical agent" is meant a substance in a pharmaceutical composition that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, antisense oligonucleotides targeted to ANGPTL3 are active pharmaceutical agents.

By "active target region" or "target region" is meant a region that targets one or more active antisense compounds. By "active antisense compound" is meant an antisense compound that reduces the level of a target nucleic acid or protein.

By "adipogenesis" is meant the development of adipocytes from preadipocytes. "adipogenesis" means the production or formation of fat, steatosis or fatty infiltration.

"obesity" or "obesity" refers to a state of obesity or an excessively high amount of body fat or adipose tissue associated with a fat free body weight. The amount of body fat includes concerns about the distribution of fat throughout the body and the size and mass of the adipose tissue deposits. Body fat distribution can be assessed by skin fold measurements, waist-to-hip circumference ratios, or techniques such as ultrasound, computed tomography, or magnetic resonance imaging. Individuals with a Body Mass Index (BMI) of 30 or more are considered obese according to the centers for disease control and prevention. The term "obesity" as used herein includes conditions in which the increase in body fat exceeds the body's needs due to excessive accumulation of adipose tissue in the body. The term "obesity" includes, but is not limited to, the following conditions: adult-type obesity; nutritional obesity; endogenous or metabolic obesity; endocrine obesity; familial obesity; obesity with pancreatic islet hyperfunction; hyperplastic-hypertrophic obesity; gonadal hypofunction obesity; hypothyroidism obesity; lifelong obesity; morbid obesity and extrinsic obesity.

By "concomitant administration" is meant any manner of co-administration of two active agents in which the pharmacological effects of the two active agents occur simultaneously in a patient. Concomitant administration does not require that the two active agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of the two active agents need not manifest themselves simultaneously. The effects need only overlap for a certain period of time and need not coexist.

"administering" means providing an active agent to an animal and includes, but is not limited to, administration by a medical professional and self-administration.

By "active Agent" is meant an active substance that provides a therapeutic benefit when administered to an animal. By "first active agent" is meant a therapeutic compound of the present invention. For example, the first active agent can be an antisense oligonucleotide that targets ANGPTL 3. By "second active agent" is meant a second therapeutic compound of the invention (e.g., a second antisense oligonucleotide targeting ANGPTL3) and/or a non-ANGPTL 3 therapeutic compound.

"alleviating" refers to alleviating at least one indicator, symptom, or symptom of an associated disease, disorder, or condition. The severity of the indicator can be determined by subjective or objective measures known to those skilled in the art.

"ANGPTL 3" means any nucleic acid or protein of ANGPTL 3.

By "ANGPTL 3 expression" is meant the level of mRNA transcribed from a gene encoding ANGPTL3 or the level of protein translated from mRNA. ANGPTL3 expression can be determined by methods known in the art, such as Northern or Western blotting.

By "ANGPTL 3 nucleic acid" is meant any nucleic acid encoding ANGPTL 3. For example, in certain embodiments, an ANGPTL3 nucleic acid includes a DNA sequence encoding ANGPTL3, an RNA sequence transcribed from a DNA encoding ANGPTL3 (including genomic DNA comprising introns and exons), and an mRNA sequence encoding ANGPTL 3. "ANGPTL 3 mRNA" means mRNA encoding ANGPTL3 protein.

By "animal" is meant a human or non-human animal, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

By "antisense activity" is meant any detectable or measurable activity due to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a nucleic acid or protein encoded by such a target nucleic acid.

By "antisense compound" is meant an oligomeric compound capable of undergoing hybridization to a target nucleic acid by hydrogen bonding.

By "antisense inhibition" is meant a reduction in the level of a target nucleic acid or level of a target protein in the presence of an antisense compound complementary to the target nucleic acid as compared to the level of the target nucleic acid or level of the target protein in the presence of the antisense compound.

By "antisense oligonucleotide" is meant a single-stranded oligonucleotide having a nucleobase sequence which allows hybridization to a corresponding target nucleic acid region or segment. As used herein, the term "antisense oligonucleotide" includes pharmaceutically acceptable derivatives of the compounds described herein.

"ApoB-containing lipoprotein" means any lipoprotein having apolipoprotein B as its protein component, and is understood to include LDL, VLDL, IDL and lipoproteins, and may be targeted generally by lipid lowering agents and therapies. "ApoB-100 containing LDL" means an LDL containing ApoB-100 isoforms.

By "atherosclerosis" is meant sclerosis of the arteries that affects both large and medium arteries and is characterized by the presence of fatty deposits. Fatty deposits, known as "atheromas" or "plaques", are composed primarily of cholesterol and other fats, calcium and peliosis, and lesions of the arterial lining.

By "bicyclic sugar" is meant a furanosyl ring modified by the bridging of two non-geminal ring atoms. Bicyclic sugars are modified sugars.

"bicyclic nucleic acid" or "BNA" refers to a nucleoside or nucleotide wherein the furanose moiety of the nucleoside or nucleotide comprises a bridge connecting two carbon atoms of the furanose ring, thereby forming a bicyclic system.

"cap structure" or "end cap portion" means that has been incorporated at either end of the antisense compound chemical modification.

"cardiovascular disease" or "cardiovascular disorder" refers to a group of disorders involving the heart, blood vessels, or circulation. Examples of cardiovascular disease include, but are not limited to, aneurysm, angina, arrhythmia, atherosclerosis, cerebrovascular disease (stroke), coronary heart disease, hypertension, dyslipidemia, hyperlipidemia, and hypercholesterolemia.

"chemically distinct region" refers to a region of an antisense compound that is chemically distinct in some way from another region of the same antisense compound. For example, a region with a 2 '-O-methoxyethyl nucleotide is chemically different from a region with a nucleotide without a 2' -O-methoxyethyl modification.

By "chimeric antisense compound" is meant an antisense compound having at least two chemically distinct regions.

By "co-administration" is meant administration of two or more active agents to an individual. The two or more active agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more active agents may be administered by the same or different route of administration. Co-administration includes parallel or sequential administration.

"Cholesterol" is a sterol molecule present in the cell membrane of all animal tissues. Cholesterol must be transported in the plasma of animals via lipoproteins, including Very Low Density Lipoprotein (VLDL), Intermediate Density Lipoprotein (IDL), Low Density Lipoprotein (LDL), and High Density Lipoprotein (HDL). "plasma cholesterol" refers to the sum of all esterified and/or non-esterified cholesterol of lipoproteins (VDL, IDL, LDL, HDL) present in plasma or serum.

By "cholesterol absorption inhibitor" is meant an agent that inhibits the absorption of exogenous cholesterol obtained from a diet.

"complementarity" means the ability to pair between the nucleobases of a first nucleic acid and a second nucleic acid. In certain embodiments, the complementarity between the first nucleic acid and the second nucleic acid may be between two DNA strands, between two RNA strands, or between a DNA and an RNA strand. In certain embodiments, some nucleobases on one strand are matched to complementary hydrogen bonding based on the other strand. In certain embodiments, all nucleobases on one strand are matched to complementary hydrogen bonds based on the other strand. In certain embodiments, the first nucleic acid is an antisense compound and the second nucleic acid is a target nucleic acid. In certain such embodiments, the antisense oligonucleotide is a first nucleic acid and the target nucleic acid is a second nucleic acid.

"consecutive nucleobases" means nucleobases that are directly adjacent to each other.

"Coronary Heart Disease (CHD)" means a stenosis in the small blood vessels that supply blood and oxygen to the heart, which is often the result of atherosclerosis.

"deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar moiety of the nucleotide. Deoxyribonucleotides may be modified by any of a variety of substituents.

"Diabetes mellitus" or "Diabetes mellitus" is a syndrome characterized by disturbed metabolism and abnormally high blood sugar (hyperglycemia) caused by insufficient insulin levels or reduced insulin sensitivity. Characteristic symptoms are excessive urine production due to high blood glucose levels (polyuria), excessive thirst and increased fluid intake in an attempt to compensate for increased urination (polydipsia), blurred vision due to the effect of hyperglycemia on eye optics, unidentified weight loss and lethargy.

"diabetic dyslipidemia" or "type 2 diabetes with dyslipidemia" means a condition characterized by type 2 diabetes, reduced HDL-C, elevated triglycerides and elevated small and dense LDL particles.

By "diluent" is meant an ingredient in the composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in the injectable composition may be a liquid, such as a saline solution.

"dyslipidemia" refers to a disorder of lipid and/or lipoprotein metabolism, including overproduction or deficiency of lipids and/or lipoproteins. Dyslipidemia can be manifested as an increase in lipids such as cholesterol and triglycerides and lipoproteins such as Low Density Lipoprotein (LDL) cholesterol.

By "dosage unit" is meant a form that provides a pharmaceutical agent, such as a pill, tablet, or other dosage unit known in the art. In certain embodiments, the dosage unit is a vial containing lyophilized antisense oligonucleotide. In certain embodiments, the dosage unit is a vial containing reconstituted antisense oligonucleotide.

By "dose" is meant a specified amount of a pharmaceutical agent provided in a single administration or over a specified time. In certain embodiments, the dose may be administered in one, two or more boluses (bolus), tablets, or injections. For example, in certain embodiments, when subcutaneous administration is desired, the desired dose requires a volume that is not easily adjusted by a single injection, and thus, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. The dose may be stated as the amount of the pharmaceutical agent per hour, day, week or month. The dosage may be expressed in mg/kg or g/kg.

By "effective amount" or "therapeutically effective amount" is meant an amount of active pharmaceutical agent sufficient to achieve a desired physiological result in an individual in need of the agent. The effective amount may vary from individual to individual, depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, the assessment of the medical condition of the individual, and other relevant factors.

"completely complementary" or "100% complementary" means that each nucleobase of the nucleobase sequence of the first nucleic acid has a complementary nucleobase in the second nucleobase sequence of the second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the target nucleic acid is a second nucleic acid.

By "Gapmer" is meant a chimeric antisense compound in which an inner region having a plurality of nucleosides supporting rnase H cleavage is located in an outer region having one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from the nucleosides comprising the outer region. The inner region may be referred to as a "notch section" and the outer region may be referred to as a "wing section".

By "notch-widened" is meant that the position of the chimeric antisense compound having 12 or more contiguous 2' -deoxyribonucleoside notch segments is between and directly adjacent to 5' and 3' wing segments having 1 to 6 nucleosides.

"glucose" is a monosaccharide used by cells as a source of energy and metabolic intermediates. "plasma glucose" refers to glucose present in plasma.

"high density lipoprotein-C (HDL-C)" means cholesterol associated with high density lipoprotein particles. HDL-C concentrations in serum (or plasma) are typically quantified in mg/dL or nmol/L. "HDL-C" and "plasma HDL-C" refer to HDL-C in serum and plasma, respectively.

By "HMG-CoA reductase inhibitor" is meant an active agent that acts by inhibiting the enzyme HMG-CoA reductase, such as atorvastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin and simvastatin.

"hybridization" means annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include antisense compounds and target nucleic acids.

"hypercholesterolemia" means a condition characterized by elevated Cholesterol or circulating (plasma) Cholesterol, LDL-Cholesterol and VLDL-Cholesterol, as per the guidelines of the National Cholesterol Equivalent Program (NCEP) of Detection, Evaluation of Treatment of high Cholesterol in adults (see, arch. int. med. (1988)148, 36-39).

"hyperlipidemia" or "hyperlipidemia (hyperlipemia)" is a condition characterized by elevated serum lipids or circulating (plasma) lipids. This disorder shows abnormally high fat concentrations. The lipid fraction in circulating blood is cholesterol, low density lipoproteins, very low density lipoproteins and triglycerides.

By "hypertriglyceridemia" is meant a condition characterized by elevated triglyceride levels.

By "identifying" or "selecting a subject having a metabolic disease or a cardiovascular disease" is meant identifying or selecting a subject who has been diagnosed with a metabolic disease, a cardiovascular disease, or a metabolic syndrome; or, identifying or selecting a subject having a metabolic disease, cardiovascular disease, or metabolic syndrome includes, but is not limited to, hypercholesterolemia, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hypertension, increased insulin resistance, decreased insulin sensitivity, above normal body weight, and/or above normal body fat content, or any combination thereof. Such identification can be accomplished by any method, including but not limited to, standard clinical trials or evaluations, such as measuring serum or circulating (plasma) cholesterol, measuring serum or circulating (plasma) blood-glucose, measuring serum or circulating (plasma) triglycerides, measuring blood pressure, measuring body fat content, measuring body weight, and the like.

By "identifying" or "selecting a diabetic subject" is meant identifying or selecting a subject who has been identified as diabetic or identifying or selecting a subject who has any symptom of diabetes (type 1 or type 2), such as, but not limited to, fasting glucose of at least 110mg/dL, diabetes, polyuria, polydipsia, increased insulin resistance, and/or decreased insulin sensitivity.

By "identifying" or "selecting an obese subject" is meant identifying or selecting a subject that has been diagnosed as obese or identifying or selecting a subject with a BMI of greater than 30 and/or a waist circumference of greater than 102cm for men or greater than 88cm for women.

By "identifying" or "selecting a subject having dyslipidemia" is meant identifying or selecting a disorder diagnosed with lipid and/or lipoprotein metabolism, including overproduction or deficiency of lipid and/or lipoprotein. Dyslipidemia can be manifested as an increase in lipids such as cholesterol and triglycerides and lipoproteins such as Low Density Lipoprotein (LDL) cholesterol.

By "identifying" or "selecting" a subject with increased adiposity "is meant identifying or selecting a subject with an increased amount of body fat (or adiposity), including concerns about one or both of the distribution of fat throughout the body and the size and mass of adipose tissue deposits. Body fat distribution can be assessed by skin fold measurements, waist-to-hip circumference ratios, or techniques such as ultrasound, computed tomography, or magnetic resonance imaging. Individuals with a Body Mass Index (BMI) of 30 or more are considered obese according to the centers for disease control and prevention.

By "increased cardiovascular outcome" is meant a reduction in the occurrence of an adverse cardiovascular event or risk thereof. Examples of adverse cardiovascular events include, but are not limited to, death, re-infarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial arrhythmia.

"directly adjacent" means that there are no intervening elements between directly adjacent elements.

By "individual" or "subject" or "animal" is meant a human or non-human animal selected for treatment or therapy.

"inhibiting expression or activity" refers to a reduction or blocking of expression or activity and does not necessarily indicate complete elimination of expression or activity.

"insulin resistance" is defined as a condition in which normal amounts of insulin are insufficient to produce a normal insulin response from cells such as adipocytes, muscle cells and/or hepatocytes. Insulin resistance in adipocytes leads to hydrolysis of stored triglycerides, which raises free fatty acids in plasma. Insulin resistance in the muscle reduces glucose uptake and insulin resistance in the liver reduces glucose storage, both effects being used to raise blood glucose. High plasma levels of insulin and glucose often cause metabolic syndrome and type 2 diabetes due to insulin resistance.

"insulin sensitivity" is a measure of how effectively an individual processes glucose. Individuals with high insulin sensitivity process glucose efficiently, while individuals with low insulin sensitivity do not.

"internucleoside linkage" refers to a chemical bond between nucleosides.

By "intravenous administration" is meant administration into a vein.

"linking nucleosides" means adjacent nucleosides bonded together.

By "lipid lowering" is meant a reduction in one or more lipids in a subject. Lipid lowering may occur over time with one or more doses.

By "lipid lowering agent" is meant an active agent, such as an ANGPTL 3-specific modulator, provided to a subject to effect a reduction in lipid in the subject. For example, in certain embodiments, providing the subject with a lipid lowering agent reduces one or more of apoB, apoC3, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small and dense LDL particles, and Lp (a) in the subject. By "lipid lowering therapy" is meant a therapeutic regimen provided to a subject to reduce one or more lipids in the subject. In certain embodiments, lipid lowering therapy is provided to reduce one or more of apoB, apoC3, total cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small and dense LDL particles, and Lp (a) in a subject.

"lipoproteins" such as VLDL, LDL and HDL refer to a group of proteins which exist in serum, plasma and lymph and are important for lipid transport. The chemical composition of each lipoprotein is different because HDL has a higher protein to lipid ratio, while VLDL has a lower protein to lipid ratio.

"Low-density lipoprotein-cholesterol (LDL-C)" means cholesterol carried in low-density lipoprotein particles. The concentration of LDL-C in serum (or plasma) is usually quantified in mg/dL or nmol/L. "serum LDL-C" and "plasma LDL-C" refer to LDL-C in serum and plasma, respectively.

"major risk factor" refers to a factor that is attributed to a high risk of a particular disease or condition. In certain embodiments, major risk factors for coronary heart disease include, but are not limited to, smoking, hypertension, low HDL-C, family history of coronary heart disease, age, and other factors disclosed herein.

"metabolic disorder" or "metabolic disease" refers to a condition characterized by altered or disturbed metabolic function. "metabolism" and "metabolism" are terms well known in the art and generally include a series of biological processes that occur within a living organ. Metabolic disorders include, but are not limited to, hyperglycemia, pre-diabetes, diabetes (type I and type 2), obesity, insulin resistance, metabolic syndrome, and dyslipidemia due to type 2 diabetes.

By "metabolic syndrome" is meant a disease characterized by clusters of metabolic-derived lipid and non-lipid cardiovascular risk factors. In certain embodiments, the metabolic syndrome is identified by the presence of any 3 of the following factors: the waist circumference of the male is larger than 102cm or the female is larger than 88 cm; serum triglycerides at least 150 mg/dL; HDL-C less than 40mg/dL in men or less than 50mg/dL in women; blood pressure of at least 130/85 mmHg; and a fasting glucose of at least 110 mg/dL. These determinants can be readily measured in clinical practice (JAMA, 2001, 285: 2486-2497).

"mismatch" or "non-complementary nucleobases" refers to the situation when a nucleobase of a first nucleic acid cannot be paired with a corresponding nucleobase of a second, target nucleic acid.

By "mixed dyslipidemia" is meant a disorder characterized by elevated cholesterol and elevated triglycerides.

"modified internucleoside linkage" refers to a substitution or any variation from a naturally occurring internucleoside linkage (i.e., a phosphodiester internucleoside linkage).

"modified nucleobase" refers to any nucleobase that is not adenine, cytosine, guanine, thymidine or uracil. "unmodified nucleobase" means the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"modified nucleoside" means a nucleoside independently having one or more modified sugar moieties or modified nucleobases.

"modified nucleotide" means a nucleotide that does not independently have one or more modified sugar moieties, modified internucleoside linkages, or modified nucleobases. "modified nucleoside" means a nucleoside independently having one or more modified sugar moieties or modified nucleobases.

By "modified oligonucleotide" is meant an oligonucleotide comprising at least one modified nucleotide.

"modified sugar" refers to a substitution or variation of a natural sugar.

"motif" means a model of a chemically distinct region in an antisense compound.

By "MTP inhibitor" is meant an agent that inhibits the enzyme, microsomal triglyceride transfer protein.

By "naturally occurring internucleoside linkage" is meant a 3 'to 5' phosphodiester linkage.

By "native sugar moiety" is meant a sugar found in DNA (2 '-H) or RNA (2' -OH).

"non-alcoholic fatty liver disease" or "NAFLD" means a condition characterized by fatty inflammation of the liver that is not due to excessive alcohol use (e.g., alcohol consumption of more than 20 g/day). In certain embodiments, NAFLD is associated with insulin resistance and metabolic syndrome. NAFLD includes a spectrum of disease ranging from single triglyceride accumulation in hepatocytes (hepatic steatosis) to hepatic steatosis with inflammation (steatohepatitis), fibrosis, and cirrhosis.

The progression of "nonalcoholic steatohepatitis" (NASH) from NAFLD occurs later than deposition of triglycerides. A "second hit" capable of inducing necrosis, inflammation and fibrosis is essential for the development of NASH. Candidates for the second hit may be classified into the following broad categories: factors that cause an increase in oxidative stress and factors that promote the expression of proinflammatory cytokines. It has been proposed that increased hepatic triglycerides lead to increased oxidative stress in liver cells of animals and humans, suggesting a potential causal relationship between hepatic triglyceride accumulation, oxidative stress and progression of hepatic steatosis to NASH (Browning and Horton, JClin Invest, 2004, 114, 147-152). Hypertriglyceridemia and high fatty acid acidemia can cause triglyceride accumulation in peripheral tissues (Shimamura et al, Biochem Biophys Res Commun, 2004, 322, 1080-1085).

"nucleic acid" refers to a molecule consisting of monomeric nucleotides. Nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microrna (miRNA). The nucleic acid may also comprise a combination of these elements in a single molecule.

"nucleobase" means a heterocyclic moiety capable of base pairing with another nucleic acid.

"nucleobase sequence" means the order of consecutive nucleobases independent of any sugar, linkage or nucleobase modification.

"nucleoside" means a nucleobase linked to a sugar.

"nucleoside mimetics" include those structures that are used to replace a sugar or sugar and base and are not necessarily linked at one or more positions in an oligomeric compound; for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydrofuranyl, bicyclic or tricyclic sugar mimetics such as non-furanose units.

By "nucleotide" is meant a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

"nucleotide mimetics" include those structures that are used in place of nucleosides and are linked at one or more positions of an oligomeric compound, such as peptide nucleic acids or morpholinos (morpholinos linked by-N (H) -C (═ O) -O-or other non-phosphodiester linkages).

"oligomeric compound" or "oligomer" refers to a polymeric structure comprising two or more substructures and capable of hybridizing to regions of a nucleic acid molecule. In certain embodiments, the oligomeric compound is an oligonucleoside. In certain embodiments, the oligomeric compound is an oligonucleotide. In certain embodiments, the oligomeric compound is an antisense compound. In certain embodiments, the oligomeric compound is an antisense oligonucleotide. In certain embodiments, the oligomeric compound is a chimeric oligonucleotide.

"oligonucleotide" means a polymer of linked nucleosides, each of which may or may not be modified, independently of the other.

By "parenteral administration" is meant administration in a manner other than in the digestive tract. Parenteral administration includes topical administration, subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration. Administration may be continuous, or chronic, or short term or intermittent.

"peptide" means a molecule formed by linking at least two amino acids via an amide bond. Peptides refer to polypeptides and proteins.

By "pharmaceutical agent" is meant a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, antisense oligonucleotides targeted to ANGPTL3 are pharmaceutical agents.

By "pharmaceutical composition" is meant a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise one or more active agents and a sterile aqueous solution.

By "pharmaceutically acceptable carrier" is meant a medium or diluent that does not interfere with the structure or function of the oligonucleotide. Certain such carriers enable the pharmaceutical compositions to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and lozenges for oral ingestion by a subject. Certain such carriers enable the pharmaceutical compositions to be formulated for injection or infusion. For example, the pharmaceutically acceptable carrier may be a sterile aqueous solution.

By "pharmaceutically acceptable salt" is meant a physiologically and pharmaceutically acceptable salt of the antisense compound, i.e., a salt that retains the desired biological activity of the parent oligonucleotide and does not impart unwanted toxicological effects thereto.

"phosphorothioate linkage" means a linkage between nucleosides in which the phosphodiester linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. Phosphorothioate linkages are modified internucleoside linkages.

"portion" means a defined number of consecutive (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of consecutive nucleobases of a target nucleic acid. In certain embodiments, a moiety is a defined number of contiguous nucleobases of an antisense compound.

"preventing" refers to delaying or arresting the onset or progression of a disease, disorder or condition for a period of time ranging from minutes to indefinite. Prevention also means reducing the risk of development of a disease, disorder, or condition.

By "prodrug" is meant a therapeutic agent prepared in an inactive form that is converted to the active form in vivo or within its cells by the action of endogenous enzymes or other chemicals or conditions.

By "side effects" is meant physiological responses attributable to therapy rather than the desired effect. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, myopathy, and discomfort. For example, increased serum aminotransferase levels may indicate liver toxicity or liver function abnormalities. For example, increased bilirubin may include liver toxicity or liver function abnormalities.

By "single-stranded oligonucleotide" is meant an oligonucleotide that does not hybridize to a complementary strand.

"specific hybridization" refers to antisense compounds that have a sufficient degree of complementarity with a target nucleic acid to induce a desired effect while exhibiting minimal or no effect on a non-target nucleic acid under conditions requiring specific binding, i.e., physiological conditions, under in vivo assays and therapeutic treatments

"Statin" means an agent that inhibits HMG-CoA reductase activity.

By "subcutaneous administration" is meant administration directly under the skin.

"targeting" or "targeted" means the design and selection of antisense compounds that specifically hybridize to a target nucleic acid and induce a desired effect.

"target nucleic acid," "target RNA," and "target RNA transcript" all refer to a nucleic acid capable of being targeted by an antisense compound.

A "target region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or characteristic.

By "target segment" is meant the sequence of nucleotides of the target nucleic acid targeted by the antisense compound. "5 'target site" refers to the 5' endmost nucleotide of the target segment. "3 'target site" refers to the 3' endmost nucleotide of the target segment.

By "therapeutically effective amount" is meant an amount of an active agent that provides a therapeutic benefit to an individual.

By "therapeutic lifestyle change" is meant dietary and lifestyle changes aimed at reducing fat/adipose tissue mass and/or cholesterol. Such changes may reduce the risk of developing heart disease, and may include daily recommendations for total calories, total fat, saturated fat, polyunsaturated fat, monounsaturated fat, carbohydrates, protein, cholesterol, dietary intake of insoluble fiber, and physical activity.

"triglyceride" means a lipid or neutral fat composed of glycerol combined with three fatty acid molecules.

"type 2 diabetes" (also referred to as "type 2 diabetes" or "diabetes, type 2", and previously referred to as "diabetes type 2", "non-insulin dependent diabetes (NIDDM)", "obesity-related diabetes" or "adult diabetes") is a metabolic disorder primarily characterized by insulin resistance, relative insulin deficiency, and hyperglycemia.

"treating" refers to administering a pharmaceutical composition to effect alteration or enhancement of a disease, disorder, or condition.

"unmodified nucleotide" means a nucleotide consisting of a naturally occurring nucleobase, a sugar moiety, and an internucleoside linkage. In certain embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., a β -D-ribonucleoside) or a DNA nucleotide (i.e., a β -D-deoxyribonucleoside).

Certain embodiments

In certain embodiments, the compounds and compositions of the present invention comprise modified oligonucleotides 10 to 30 linked nucleosides in length targeted to ANGPTL 3. The ANGPTL3 target can have an amino acid sequence selected from SEQ ID NO: 1-5.

In certain embodiments, the compounds and compositions of the invention comprise a modified oligonucleotide consisting of 10 to 30 nucleosides and having a nucleotide sequence comprising a nucleotide sequence identical to SEQ ID NO: 1-5, equal length portions complementary to at least 8 contiguous nucleobases.

The compounds and compositions of the invention comprise modified oligonucleotides consisting of 10 to 30 nucleosides and having a nucleotide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 34-182 of at least 8 consecutive nucleobases of the nucleobase sequence of any one of the nucleobase sequences.

The compounds and compositions of the invention comprise modified oligonucleotides consisting of 10 to 30 nucleosides and having a nucleotide sequence comprising a nucleotide sequence selected from SEQ ID NOs: 34-182 of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of the nucleobase sequence of any one of the nucleobase sequences.

In certain embodiments, the compounds and compositions of the invention comprise a salt of a modified oligonucleotide.

In certain embodiments, the compounds and compositions of the present invention further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the nucleobase sequence of the modified oligonucleotide has a sequence that is complementary to the nucleobase sequence of SEQ ID NO: 1-5 is at least 70%, 80%, 90%, 95%, or 100% complementary as measured on the integrity of the modified oligonucleotide.

In certain embodiments, the compounds of the invention consist of a single-stranded modified oligonucleotide.

In certain embodiments, the modified oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified oligonucleotide comprises at least one tetrahydropyran modified nucleoside wherein a tetrahydropyran ring replaces the furanose ring. In certain embodiments, each tetrahydropyran modified nucleoside has the following structure:

wherein Bx is an optionally protected heterocyclic base moiety. In certain embodiments, the at least one modified sugar is a bicyclic sugar. In certain embodiments, the at least one modified sugar comprises 2 '-O-methoxyethyl or 4' - (CH)₂)_n-an O-2' bridge, wherein n is1 or 2.

In certain embodiments, at least one nucleoside in the modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5' wing segment consisting of linked nucleosides; and c) a 3' wing segment consisting of linked nucleosides. The gap segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides, the gap segment consists of 10 linked deoxynucleosides, the 5' wing segment consists of 5 linked nucleosides, the 3' wing segment consists of 5 linked nucleosides, each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar and each internucleoside linkage is a phosphorothioate linkage,

in certain embodiments, the compounds and compositions of the invention comprise a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleotide sequence comprising a nucleotide sequence identical to SEQ ID NO: 1-5, wherein the modified oligonucleotide comprises a nucleobase sequence of at least 8 contiguous nucleobases that are complementary to equal length portions thereof, wherein the modified oligonucleotide comprises: a) a gap segment consisting of 10 linked deoxynucleosides; b) a 5' wing segment consisting of 5 linked nucleosides; and c) a 3' wing segment consisting of 5 linked nucleosides. The gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

In certain embodiments, the compounds and compositions of the invention comprise a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleotide sequence comprising a nucleotide sequence identical to SEQ ID NO: 34-182, wherein the modified oligonucleotide comprises: a) a gap segment consisting of 10 linked deoxynucleosides; b) a 5' wing segment consisting of 5 linked nucleosides; and c) a 3' wing segment consisting of 5 linked nucleosides. The gap segment is located between the 5' wing segment and the 3' wing segment, each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, each internucleoside linkage is a phosphorothioate linkage and each cytosine residue is a 5-methylcytosine.

Certain embodiments provide methods, compounds, and compositions for inhibiting expression of ANGPTL 3.

Certain embodiments provide methods of reducing expression of ANGPTL3 in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL 3.

Certain embodiments provide methods of reducing ApoC-III expression in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing ApoC-III expression in the animal.

Certain embodiments provide a method of reducing triglyceride levels in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing triglyceride levels in the animal.

Certain embodiments provide a method of reducing cholesterol levels in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing cholesterol levels in the animal.

Certain embodiments provide a method of reducing Low Density Lipoprotein (LDL) levels in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing Low Density Lipoprotein (LDL) levels in the animal.

Certain embodiments provide a method of reducing glucose levels in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing glucose levels in the animal.

Certain embodiments provide a method of reducing metabolic or cardiovascular disease in an animal comprising administering to the animal a modified oligonucleotide comprising 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing metabolic or cardiovascular disease in the animal.

Certain embodiments provide methods for treating an animal having a disease or disorder associated with ANGPTL3, comprising: a) identifying the animal having an ANGPTL 3-associated disease or disorder, and b) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL 3. In certain embodiments, a therapeutically effective amount of a compound administered to an animal reduces an ANGPTL 3-related disease or disorder in the animal.

Certain embodiments provide methods for treating an animal having a metabolic disease or a cardiovascular disease, comprising: a) identifying the animal having a metabolic disease or a cardiovascular disease, and b) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a sequence identical to SEQ id no: 1-5 nucleobase sequences that are at least 90% complementary (as measured by the entirety of the modified oligonucleotide), thereby treating an animal having a metabolic disease or a cardiovascular disease. In certain embodiments, a therapeutically effective amount of a compound administered to an animal reduces metabolic or cardiovascular disease in the animal.

Certain embodiments provide methods of reducing one or more of ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, fat pad weight, cardiovascular disease, and metabolic disease in a human by administering an ANGPTL3 inhibitor comprising a modified oligonucleotide consisting of 20 linked nucleosides and having an amino acid sequence that is identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide.

Certain embodiments provide for the use of compounds and compositions described herein to inhibit the expression of ANGPTL 3.

Certain embodiments provide compounds and compositions described herein for reducing ANGPTL3 expression in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL 3.

Certain embodiments provide for the use of the compounds and compositions described herein to reduce ApoC-III expression in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing ApoC-III expression in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein to reduce triglyceride levels in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing triglyceride levels in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein to reduce cholesterol levels in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing cholesterol levels in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein to reduce Low Density Lipoprotein (LDL) levels in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing Low Density Lipoprotein (LDL) levels in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein to reduce glucose levels in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby reducing glucose levels in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein to ameliorate metabolic or cardiovascular disease in an animal. Certain embodiments include administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, thereby alleviating the metabolic or cardiovascular disease in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein for therapy. Certain embodiments provide for the use of compounds and compositions described herein for treating animals having a disease or disorder associated with ANGPTL 3. In certain embodiments, the ANGPTL 3-associated disease or disorder is a metabolic disease or a cardiovascular disease. Certain embodiments include: a) identifying the animal having an ANGPTL 3-associated disease or disorder, and b) administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL 3. In certain embodiments, a therapeutically effective amount of a compound administered to an animal reduces an ANGPTL 3-related disease or disorder in the animal.

Certain embodiments provide for the use of the compounds and compositions described herein for treating an animal having a metabolic disease or a cardiovascular disease. The method comprises the following steps: a) identifying the animal having a metabolic or cardiovascular disease, and b) administering to the animal a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a sequence identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide. In certain embodiments, a therapeutically effective amount of a compound administered to an animal reduces metabolic or cardiovascular disease in the animal.

Certain embodiments provide for the use of compounds and compositions described herein to reduce one or more of ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, fat pad weight, cardiovascular disease, and metabolic disease in a human by administering an ANGPTL3 inhibitor comprising a modified oligonucleotide consisting of 20 linked nucleosides and having an amino acid sequence that is identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide.

In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession number BG400407.1 (incorporated herein as SEQ ID NO: 1). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession number BG562555.1 (incorporated herein as SEQ ID NO: 2). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession number BG562798.1 (incorporated herein as SEQ ID NO: 3). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession No. NM _014495.1 (incorporated herein as SEQ ID NO: 4). In certain embodiments, ANGPTL3 has the sequence as described in nucleotides 15511702 to 15521082 of GenBank accession No. NT _032977.5 (incorporated herein as SEQ ID NO: 5). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession No. AF162224.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession No. AI195524.1 (incorporated herein as SEQ ID NO: 7). In certain embodiments, ANGPTL3 has the mRNA sequence as described in GenBank accession No. BB717501.1 (incorporated herein as SEQ ID NO: 8).

TABLE 1 Gene target names and sequences

Target name	Species (II)	Genbank#	SEQ ID NO
				Angiopoietin-like 3	Human being	BG400407.1	1
Angiopoietin-like 3	Human being	BG562555.1	2
				Angiopoietin-like 3	Human being	BG562798.1	3
Angiopoietin-like 3	Human being	NM_014495.1	4
				Angiopoietin-like 3	Human being	NT _032977.5 nucleotides 15511702 to 15521082	5
Angiopoietin-like 3	Mouse	AF162224.1	6
				Angiopoietin-like 3	Mouse	AI195524.1	7
Angiopoietin-like 3	Mouse	BB717501.1	8

In certain embodiments, the animal is a human.

In certain embodiments, the compounds and compositions of the present invention are referred to as a first active agent, and the methods or uses of the present invention further comprise administering a second active agent. In certain embodiments, the first active agent and the second active agent are co-administered. In certain embodiments, the first active agent and the second active agent are co-administered sequentially or concomitantly.

In certain embodiments, the second active agent is a glucose-lowering agent. Glucose lowering agents may include, but are not limited to, therapeutic lifestyle changes, PPAR agonists, dipeptidyl peptidase (IV) inhibitors, GLP-1 analogs, insulin or insulin analogs, insulin secretagogues, SGLT2 inhibitors, human amylin analogs, biguanides, α -glucosidase inhibitors, or combinations thereof. The glucose-lowering agent may include, but is not limited to, metformin, sulfonylureas, rosiglitazones, meglitinides, thiazolidinediones, alpha-glucosidase inhibitors, or combinations thereof. The sulfonylurea can be acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, glipizide, glyburide or gliclazide. The meglitinide may be nateglinide or repaglinide. The thiazolidinedione may be pioglitazone or rosiglitazone. The alpha-glucosidase may be acarbose or miglitol.

In certain embodiments, the second active agent is a lipid lowering therapy. In certain embodiments, lipid lowering therapy may include, but is not limited to, therapeutic lifestyle changes, HMG-CoA reductase inhibitors, cholesterol absorption inhibitors, MTP inhibitors, antisense compounds targeted to ApoB, or any combination thereof. The cholesterol absorption inhibitor may be ezetimibe.

In certain embodiments, administering comprises parenteral administration.

In certain embodiments, the metabolic or cardiovascular disease includes, but is not limited to, obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, nonalcoholic fatty liver disease (NAFLD), high fatty acidemia, or metabolic syndrome, or a combination thereof. The dyslipidemia may be hyperlipidemia. Hyperlipidemia may be hypercholesterolemia, hypertriglyceridemia or both hypercholesterolemia and hypertriglyceridemia. NAFLD may be hepatic steatosis or steatohepatitis. The diabetes may be type 2 diabetes with type 2 diabetes or dyslipidemia.

In certain embodiments, administration of the compounds of the invention results in a reduction in lipid levels, including triglyceride levels, cholesterol levels, insulin resistance, glucose levels, or a combination thereof. One or more levels may be independently reduced by 5%, 10%, 20%, 30%, 35% or 40%. Administration of the compounds of the present invention may result in increased insulin sensitivity or hepatic insulin sensitivity. Administration of a compound of the invention may result in atherosclerotic plaques, obesity, glucose, lipids, glucose resistance, a reduction in cholesterol or an increase in insulin sensitivity or any combination thereof.

Certain embodiments provide the use of a compound described herein in the manufacture of a medicament for the treatment, alleviation, delay or prevention of one or more metabolic or cardiovascular diseases.

Certain embodiments provide a kit for treating, preventing, or ameliorating one or more metabolic or cardiovascular diseases described herein, wherein the kit comprises: a) a compound described herein; and optionally b) other active agents or treatments described herein. The kit may further comprise instructions or labeling for using the kit to treat, prevent, or ameliorate one or more metabolic or cardiovascular diseases.

Antisense compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNA. The oligomeric compound may be "antisense" to the target nucleic acid, meaning capable of undergoing hybridization to the target nucleic acid by hydrogen bonding.

In certain embodiments, antisense compounds have a nucleobase sequence that, when written in the 5 'to 3' direction, comprises the reverse complement sequence of the target segment of the target nucleic acid to which it is targeted. In certain such embodiments, the antisense oligonucleotide has a nucleobase sequence that, when written in the 5 'to 3' direction, comprises the reverse complement sequence of the target segment of the target nucleic acid to which it is targeted.

In certain embodiments, the antisense compound targeted to an ANGPTL3 nucleic acid is 10 to 30 nucleotides in length. In other words, antisense compounds are 10 to 30 connecting nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 50, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the foregoing values.

In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. A shortened or truncated modified oligonucleotide may have a single nucleoside deleted from the 5 'end (5' truncation), or alternatively from the 3 'end (3' truncation). The shortened or truncated oligonucleotide may have two or more nucleosides deleted from the 5 'end, or alternatively may have two or more nucleosides deleted from the 3' end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example in an antisense compound having one or more nucleosides deleted from the 5 'end and one or more nucleosides deleted from the 3' end.

When a single additional nucleoside is present in the extended oligonucleotide, the additional nucleoside can be located at the 5', 3' end or central portion of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example in an oligonucleotide having two nucleosides added to the 5 'end (5' addition) or alternatively to the 3 'end (3' addition) or central portion of the oligonucleotide. Alternatively, the added nucleosides can be dispersed throughout the antisense compound, for example in an oligonucleotide having one or more nucleosides added to the 5 'end, one or more nucleosides added to the 3' end, and/or one or more nucleosides added to the central portion.

The length of antisense compounds, such as antisense oligonucleotides, may be increased or decreased, and/or mismatched bases may be introduced to eliminate activity. For example, Woolf et al (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested the ability of a series of antisense oligonucleotides 13-25 nucleobases in length to induce cleavage of target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases adjacent to the end of the antisense oligonucleotide are capable of directing specific cleavage of the target mRNA, albeit to a lesser extent than antisense oligonucleotides that do not contain mismatches. Likewise, target-specific cleavage was achieved using 13 nucleobase antisense oligonucleotides (including those with 1 or 3 mismatches).

Gautschi et al (J.Natl.cancer Inst.93:463-471, 3 months 2001) demonstrated the ability of oligonucleotides with 100% complementarity to bcl-2mRNA and 3 mismatches to bcl-xL mRNA to reduce expression of both bcl-2 and bcl-xL in vitro and in vivo. Moreover, the oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (nuc. acid. res.16:3341-3358, 1988) tested a series of 14 nucleobase antisense oligonucleotides in tandem and 28 and 42 nucleobase antisense oligonucleotides consisting of sequences of 2 or 3 tandem antisense oligonucleotides, respectively, for their ability to prevent translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides individually was able to inhibit translation, although at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Antisense compound motifs

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids have chemically modified subunits arranged in a model or motif to confer antisense compound properties such as enhanced inhibitory activity, increased binding affinity to a target nucleic acid, or resistance to degradation by nucleases in vivo.

Chimeric antisense compounds typically comprise at least one modified region to confer increased resistance to nuclease degradation, increased uptake in cells, increased binding affinity to a target nucleic acid, and/or increased inhibitory activity. The second region of the chimeric antisense compound can optionally serve as a substrate for cellular endonuclease rnase H, which cleaves the RNA strand of the RNA: DNA duplex.

in the case of antisense oligonucleotides having a gapped base motif, the gap segment typically serves as a substrate for endonuclease cleavage, although the wing segment comprises a modified nucleoside, in certain embodiments, the regions of the gapped base are distinguished by the type of sugar moiety comprising each distinct region₃) And bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'- (CH2) n-O-2' bridge, where n ═ 1 or n ═ 2). Preferably, each distinct region comprises a uniform sugar moiety. The wing-notch-wing motif is often referred to as "X-Y-Z," where "X" represents the length of the 5 'wing region, "Y" represents the length of the notch region, and "Z" represents the length of the 3' wing region. As used herein, a notched matrix, referred to as "X-Y-Z," has a configuration such that the notched segment is located directly adjacent to each of the 5 'wing segment and the 3' wing segment. Thus, no intervening nucleotides are present between the 5 'wing and notch segments, or the notch and 3' wing segments. Any of the antisense compounds described herein can have a notch matrix motif. In some embodiments, X and Z are the same, and in other embodiments, they are different. In a preferred embodiment, Y is 8 to 15 nucleotides. X, Y or Z can be any one of 1, 2, 3, 4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. Thus, the notch matrix includes, but is not limited to, for example, 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 1-8-1, 2-6-2, 2-13-2, 1-8-2, 2-8-3, 3-10-2, 1-18-2, or 2-18-2.

In certain embodiments, antisense compounds that are "wingmer" motifs have a winged-notch or notch-winged configuration, i.e., the X-Y or Y-Z configuration described herein for the notch matrix configuration. Thus, the tab substrate configuration includes, but is not limited to, for example, 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.

In certain embodiments, antisense compounds targeted to an ANGPTL3 nucleic acid have a 5-10-5 notch matrix motif.

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids have a motif with widened gaps.

Target nucleic acids, target regions and nucleotide sequences

Nucleotide sequences encoding ANGPTL3 include, but are not limited to, the following: human sequence as set forth in GenBank accession number BG400407.1 (incorporated herein by reference to SEQ ID NO: 1), GenBank accession number BG562555.1 (incorporated herein by reference to SEQ ID NO: 2), GenBank accession number BG562798.1 (incorporated herein by reference to SEQ ID NO: 3), GenBank accession number NM-014495.1 (incorporated herein by reference to SEQ ID NO: 4), GenBank accession number NT-032977.5 nucleotides 15511702 to 15521082 (incorporated herein by reference to SEQ ID NO: 5), GenBank accession number AF162224.1 (incorporated herein by reference to SEQ ID NO: 6), GenBank accession number AI195524.1 (incorporated herein by reference to SEQ ID NO: 7), and GenBank accession number BB717501.1 (incorporated herein by reference to SEQ ID NO: 8). It is understood that the sequences set forth in each of the SEQ ID NOs of the examples contained herein are not associated with sugar moieties, internucleoside linkages, or any modifications of nucleobases. As such, the antisense compound defined by SEQ ID NO may independently comprise one or more modifications of a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis No. (Isis No) indicate combinations of nucleobase sequences and motifs.

In certain embodiments, the target region is a structurally defined region of the target nucleic acid. For example, the target region may comprise a 3 'UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, a translation termination region, or other defined nucleic acid region. The structurally defined regions of ANGPTL3 are available through sequence databases such as the accession numbers of NCBI and such information is incorporated herein by reference. In certain embodiments, the target region may comprise the sequence of the 5 'target site of one target segment within the target region to the 3' target site of another target segment within the target region.

In certain embodiments, a "target segment" is a smaller, sub-portion of a target region within a nucleic acid. For example, the target segment can be a sequence of nucleotides of a target nucleic acid targeted by one or more antisense compounds. "5 'target site" refers to the 5' endmost nucleotide of the target segment. "3 'target site" refers to the 3' endmost nucleotide of the target segment.

Targeting includes determining at least one target segment to which an antisense compound hybridizes to cause a desired effect to occur. In certain embodiments, the desired effect is a decrease in the level of the mRN target nucleic acid. In certain embodiments, the desired effect is a reduction in the level of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

The target region may comprise one or more target segments. Multiple target segments within the target region may overlap. Alternatively, they may be non-overlapping. In certain embodiments, the target segments within the target region are separated by up to about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a plurality of nucleotides (being, about, up to 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid), or a range defined by any two of the foregoing values. In certain embodiments, the target segments within the target region are separated by up to or up to about 5 nucleotides on the target nucleic acid. In certain embodiments, the target segment is continuous. Contemplated is a target region defined by a range having a starting nucleic acid (either of the 5 'target sites or the 3' target sites listed herein).

Suitable target segments can be found within the 5 'UTR, coding region, 3' UTR, intron, exon or exon/intron junction. Target segments comprising an initiation codon or a stop codon are also suitable target segments. Suitable target segments may specifically exclude certain structurally defined regions such as start codons or stop codons.

Determination of suitable target segments can include comparison of the target nucleic acid sequence to other sequences across the genome. For example, the BLAST algorithm can be used to identify regions of similarity among different nucleic acids. Such comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than the selected target nucleic acid (i.e., non-target or off-target sequences).

There can be a change in the activity of the antisense compound in the active target region (e.g., as defined by a percentage reduction in target nucleic acid levels). In certain embodiments, a decrease in ANGPTL3mRNA levels is indicative of an inhibition of ANGPTL3 protein expression. A decrease in ANGPTL3 protein levels is also indicative of inhibition of target mRNA expression. In addition, a decrease in a phenotypic change, such as a level of cholesterol, LDL, triglyceride or glucose, may indicate inhibition of ANGPTL3mRNA and/or protein expression.

Hybridization of

In some embodiments, hybridization occurs between an antisense compound disclosed herein and an ANGPTL3 nucleic acid. The most common hybridization mechanisms include hydrogen bonding (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding) between complementary nucleobases of a nucleic acid molecule.

Hybridization can occur under different conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods for determining whether a sequence hybridizes specifically to a target nucleic acid are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd edition, 2001). In certain embodiments, antisense compounds provided herein can specifically hybridize to an ANGPTL3 nucleic acid.

Complementarity

When a sufficient amount of the nucleobase of the antisense compound can hydrogen bond with the corresponding nucleobase of the target nucleic acid, the antisense compound and the target nucleic acid are complementary to each other such that the desired effect occurs (e.g., antisense inhibition of a target nucleic acid such as an ANGPTL3 nucleic acid).

Antisense compounds can hybridize over one or more segments of an ANGPTL3 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).

In certain embodiments, an antisense compound, or a specific portion thereof, provided herein has, or at least has, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% with an ANGPTL3 nucleic acid, target region, target segment, or specific portion thereof. In certain embodiments, the antisense compounds provided herein, or specific portions thereof, are substantially identical to SEQ ID NO: 1-5 has or at least has 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The percent complementarity of an antisense compound having a target nucleic acid can be determined using conventional methods.

For example, 18 to 20 nucleobases of an antisense compound are complementary to a target region and an antisense compound that will specifically hybridize therewith represents 90% complementarity. In this example, the remaining non-complementary nucleobases can cluster or scatter with complementary nucleobases and need not be contiguous with each other or with complementary nucleobases. In this way, a length of 18 nuclear base with 4(4) non-complementary nuclear base (which through the complete complementarity of two regions and target nucleic acid flanking connected) antisense compounds with target nucleic acid with 77.8% full complementarity and therefore in the scope of the present invention. The percent complementarity of an antisense compound to a target nucleic acid region can be determined conventionally using the BLAST program (basic site-directed alignment research tool) and PowerBLAST program (Altschul et al, J.Mol.biol., 1990, 215, 403410; Zhang and Madden, Genome Res., 1997, 7, 649656) known in the art. The percentage of homology, sequence identity or complementarity can be determined, for example, by the Gap program (Wisconsin package for sequence analysis, Version 8for Unix, Genetics Computer Group, University research press, Madison wires.), using the default settings of the algorithm using Smith and Waterman (adv.appl.math., 1981, 2, 482489).

In certain embodiments, an antisense compound provided herein, or a specified portion thereof, is fully complementary (i.e., 100% complementary) to a target nucleic acid, or a specified portion thereof. For example, the antisense compound can be fully complementary to an ANGPTL3 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means that each nucleobase of an antisense compound is capable of precise base pairing with a corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully (100%) complementary to a target sequence that is 400 nucleobases long, provided that there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Where reference is made to a particular portion of the first and/or second nucleic acid, complete complementarity may also be used. For example, the 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is "fully complementary" to the target sequence if the target sequence has a corresponding 20 nucleobase portion, wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The non-complementary nucleobases can be located at the 5 'end or the 3' end of the antisense compound. Alternatively, the non-complementary nucleobases or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, the non-complementary nucleobases are located in the wing segment of the gapped base antisense oligonucleotide.

In certain embodiments, antisense compounds that are 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length or at most comprise at most 4, at most 3, at most 2, or at most 1 non-complementary nucleobases relative to a target nucleic acid, e.g., an ANGPTL3 nucleic acid or a specified portion thereof.

In certain embodiments, antisense compounds that are 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length or at most comprise at most 6, at most 5, at most 4, at most 3, at most 2, or at most 1 non-complementary nucleobases relative to a target nucleic acid, e.g., an ANGPTL3 nucleic acid, or a specified portion thereof.

Antisense compounds provided herein also include those that are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of consecutive (i.e., linked) nucleobases within a region or segment of a target nucleic acid. "portion" can also refer to antisense compounds in a defined number of consecutive nucleobases. In certain embodiments, the antisense compound is complementary to at least 8 nucleobase moieties of the target segment. In certain embodiments, the antisense compound is complementary to at least 10 nucleobase moieties of the target segment. In certain embodiments, is complementary to at least 15 nucleobase moieties of the target segment. Also contemplated are antisense compounds that are complementary to at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase moieties of a target segment, or a range defined by any two of these values.

Identity of each other

Antisense compounds provided herein can also have a defined percentage of identity to a particular nucleotide sequence, SEQ ID NO, or the sequence of a compound represented by a particular Isis number, or portion thereof. As used herein, an antisense compound has identity to a sequence disclosed herein if it has the same nucleobase pairing capabilities. For example, an RNA that includes uracil in place of thymidine in a disclosed DNA sequence will be considered to have identity to the DNA sequence because both uracil and thymidine pair with adenine. Also contemplated are shortened and extended forms of the antisense compounds described herein and compounds having non-identical bases associated with the antisense compounds provided herein. Non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. The percent identity of an antisense compound is calculated based on the number of bases having the same base pairing associated with the sequence to which it is compared.

In certain embodiments, the antisense compound or portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compound or SEQ ID NOs or portions thereof disclosed herein.

Decoration

Nucleosides are base-sugar combinations. The nucleobase (also referred to as base) portion of a nucleoside is typically a heterocyclic base portion. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be attached to the 2', 3', or 5' hydroxyl moiety of the sugar. The oligonucleotides are formed by covalent bonding of adjacent nucleosides to each other to form a linear polymeric oligonucleotide. Within the structure of an oligonucleotide, the phosphate group is often referred to as an internucleoside linkage that forms the oligonucleotide.

Modifications to antisense compounds include substitutions or alterations to internucleoside linkages, sugar moieties or nucleobases. Modified antisense compounds are generally preferred over the native form because of desirable properties such as, for example, increased cellular uptake, increased affinity for the nucleic acid target, and increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides can also be compared to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Thus, similar results can generally be obtained with shorter antisense compounds having such chemically modified nucleosides.

Modified internucleoside linkages

The naturally occurring internucleoside linkage of RNA and DNA is a 3 'to 5' phosphodiester linkage. Because of desirable properties such as, for example, increased cellular uptake, increased affinity for a target nucleic acid, and increased stability in the presence of nucleases, antisense compounds having one or more modifications, i.e., non-naturally occurring internucleoside linkages, are generally selected as compared to antisense compounds having naturally occurring internucleoside linkages.

Oligonucleotides have modified internucleoside linkages, including internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

Modified sugar moieties

The antisense compound can optionally comprise one or more nucleosides wherein the sugar moiety has been modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranosyl ring moiety. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituent groups (including 5 'and 2' substituent groups, bridging non-twin ring atoms to form Bicyclic Nucleic Acids (BNAs), the use of S, N (R) or C (R1) (R)2(R ═ H, C)₁-C₁₂Alkyl or protecting group) in place of the ribosyl epoxy atom and combinations thereof. Examples of chemically modified sugars include 2'-F-5' -methyl substituted nucleosides (see, PCT international application WO 2008/101157 published on 8/21 of 2008 for other disclosed 5', 2' -disubstituted nucleosides) or ribosyl epoxy atoms replaced with S and further substituted at the 2 '-position (see, published U.S. patent application US20050130923 published on 6/16 of 2005) or alternatively 5' -substituted BNA (see, PCT international application WO2007/134181 published on 11/22 of 2007 for LNAs substituted with, for example, a5 '-methyl or 5' -vinyl group).

Examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising a 5' -vinyl group, a 5' -methyl (R or S), a 4' -S, a 2' -F, a 2' -OCH₃And 2' -O (CH)₂)2OCH₃Nucleosides of substituent groups. The substituent at the 2' position may also be selected from the group consisting of alkyl, amino, azido, thio, O-alkyl, O-C1-C10 alkyl, OCF₃、O(CH₂)2SCH₃、O(CH₂)2-O-N (Rm) (Rn) and O-CH₂-C (═ O) -N (Rm) (Rn), wherein each Rm and Rn is independently H or substituted or unsubstituted C1-C10 alkyl.

Examples of Bicyclic Nucleic Acids (BNAs) include, without limitation, nucleosides comprising a bridge between 4 'and 2' ribose ring atoms. In some instancesin embodiments, provided herein are antisense compounds comprising one or more BNA nucleosides, wherein the bridge comprises one of the following formulae 4'- (CH2) -O-2' (LNA), 4'- (CH2) -S-2'; 4'- (CH2) 2-O-2' (ENA), 4'-C (CH3) 2-O-2' (see PCT/US2008/068922), 4'-CH (CH3) -O-2' and 4'-CH (CH2OCH3) -O-2' (see u.s. patent 7,399,845, granted on 15 days 7/2008), 4'-CH 2-N (OCH3) -2' (see PCT/US2008/064591), 4'-CH 2-O-N (CH3) -2' (see published u.s. patent application US2004-0171570, published on 9 days 2004), 4'-CH 2-N (R) -O-2' (see U.s. patent application US 2004-57324, 7,427,672, see published on 9 days 9, WO-WO 9-WO 134), and each of the aforementioned patents nos. (see PCT/US 97-WO patent publication No. WO 9-WO 9-WO 52) (see, WO patent publication, WO-WO 9-WO-99, WO-134, WO-99, WO-99, WO-99, WO-3, WO-99, WO-3, WO-₂O-2 ') BNA's have also been incorporated into antisense oligonucleotides that exhibit antisense activity (Frieden et al, Nucleic acids research, 2003, 21, 6365-6372).

Further reports relating to bicyclic nucleosides may be found in published literature (see, e.g., Srivastava et al, J.Am.Chem.Soc., 2007, 129, 8362-8379; U.S. patent No.7,053,207; 6,268,490; 6,770,748; 6,794,499; 7,034,133; and 6,525,191; Elayadi et al, curr.Opinion Invens.drugs, 2001, 2, 558-561; Braasch et al, chem.biol., 2001, 8, 1-7; and Orum et al, curr.Opinion mol.The. Ther., 2001, 3, 239-243; and U.S.6,670,461; International application WO 2004/106356; WO 94/14226; WO 2005/021570; U.S. patent application No. 2004-0171570; US-0287831; US-862007, U.S. 066154,844, US patent application No. 2004/3526; PCT/369826; PCT U.S. Ser. No. 200369826/068922; PCT/369861; PCT application No. Ser. 8/369861; PCT application No. Ser. No. 8/3668; PCT/36567; PCT/365630/3661; PCT/365660; PCT/3561; PCT application No. Ser. No. 3/365660; PCT/365630/365660; PCT/365631/3661; US.

In certain embodiments, of BNA nucleosidesBicyclic sugar moieties include, but are not limited to, compounds having at least one bridge between the 4 'and 2' positions of the pentofuranosyl sugar moiety, wherein such bridge independently comprises 1 or 2 to 4 linking groups independently selected from: - [ C (R)_a)(R_b)]_n-、-C(R_a)＝C(R_b)-、-C(R_a)＝N-、-C(＝O)-、-C(＝NR_a)-、-C(＝S)-、-O-、-Si(R_a)₂-、-S(＝O)_x-and-N (R)_a)-；

Wherein:

x is 0, 1 or 2;

n is1, 2, 3 or 4;

R_aand R_bEach independently is H, a protecting group, hydroxy, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C₅-C₇Alicyclic radical, substituted C₅-C₇Alicyclic free radical, halogen, OJ₁、NJ₁J₂、SJ₁、N₃、COOJ₁Acyl (C ═ O) -H), substituted acyl, CN, sulfonyl (S ═ O)₂-J₁) Or sulfonyloxy (S (═ O) -J₁) (ii) a And is

J₁And J₂Each independently is H, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, acyl (C (═ O) -H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C₁-C₁₂Aminoalkyl, substituted C₁-C₁₂Aminoalkyl groups or protecting groups.

In certain embodiments, the bridge of the bicyclic sugar moiety is- [ C (R)_a)(R_b)]_n-、-[C(R_a)(R_b)]_n-O-、-C(R_aR_b) -N (R) -O-or-C (R)_aR_b) -O-N (R) -. In certain embodiments, the bridge is 4' -CH₂-2'、4'-(CH₂)₂-2'、4'-(CH₂)₃-2'、4'-CH₂-O-2'、4'-(CH₂)₂-O-2'、4'-CH₂-O-N (R) -2 'and 4' -CH₂-N (R) -O-2' -, wherein each R is independently H, a protecting group, or C₁-C₁₂An alkyl group.

in certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α -L-methyleneoxy (4' -CH)₂-O-2 ') BNA, (B) β -D-methyleneoxy (4' -CH)₂-O-2 ') BNA, (C) ethyleneoxy (4' - (CH)₂)₂-O-2 ') BNA, (D) aminooxy (4' -CH)₂-O-N (R) -2 ') BNA, (E) oxyamino (4' -CH)₂-N (R) -O-2 ') BNA and (F) methyl (methyleneoxy) (4' -CH (CH)₃) -O-2 ') BNA, (G) methylene-thio (4' -CH)₂-S-2 ') BNA, (H) methylene-amino (4' -CH2-N (R) -2 ') BNA, (I) methylcarbocyclic (4' -CH)₂-CH(CH₃) -2 ') BNA and (J) propylidene carbocycle (4' - (CH)₂)₃-2') BNA, as described below.

Wherein Bx is a base moiety and R is independently H, a protecting group or C₁-C₁₂An alkyl group.

In certain embodiments, bicyclic nucleosides having formula I:

wherein:

bx is a heterocyclic base moiety;

-Q_a-Q_b-Q_cis-CH₂-N(R_c)-CH₂-、-C(＝O)-N(R_c)-CH₂-、-CH₂-O-N(R_c)-、-CH₂-N(R_c) -O-or-N (R)_c)-O-CH₂；

R_cIs C₁-C₁₂An alkyl or amino protecting group; and is

T_aAnd T_bEach independently is a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a support medium.

In certain embodiments, bicyclic nucleosides having formula II:

wherein:

bx is a heterocyclic base moiety;

T_aand T_bEach independently is a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a support medium;

Z_ais C₁-C₆Alkyl radical, C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, substituted C₁-C₆Alkyl, substituted C₂-C₆Alkenyl, substituted C₂-C₆Alkynyl, acyl, substituted amide, mercapto, or substituted thio.

In one embodiment, each of the substituted groups is independently mono-or poly-substituted with a substituent group selected from: halogen, oxo, hydroxy, OJ_c、NJ_cJ_d、SJ_c、N₃、OC(＝X)J_cAnd NJ_eC(＝X)NJ_cJ_dEach of which is J_c、J_dAnd J_eIndependently is H, C₁-C₆Alkyl or substituted C₁-C₆Alkyl and X is O or NJ_c。

In certain embodiments, bicyclic nucleosides having formula III:

wherein:

bx is a heterocyclic base moiety;

ta and Tb are each independently a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a supporting medium;

zb is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, or substituted acyl (C (═ O) -).

In certain embodiments, a bicyclic nucleoside having formula IV:

wherein:

bx is a heterocyclic base moiety;

T_aand T_bEach independently is a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a support medium;

R_dis that_C1-C₆Alkyl, substituted C₁-C₆Alkyl radical, C₂-C₆Alkenyl, substituted C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, or substituted C₂-C₆An alkynyl group;

q_a、q_b、q_cand q is_dEach independently of the others being H, halogen, C₁-C₆Alkyl, substituted C₁-C₆Alkyl radical, C₂-C₆Alkenyl, substituted C₂-C₆Alkenyl radical, C₂-C₆Alkynyl, or substituted C₂-C₆Alkynyl, C₁-C₆Alkoxy, substituted C₁-C₆Alkoxy, acyl, substituted acyl, C₁-C₆Aminoalkyl, or substituted C₁-C₆An aminoalkyl group;

in certain embodiments, a bicyclic nucleoside having formula V:

wherein:

bx is a heterocyclic base moiety;

T_aand T_bEach independently is a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a support medium;

q_a、q_b、q_eand q is_fEach independently of the others is hydrogen, halogen, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₁-C₁₂Alkoxy, substituted C₁-C₁₂Alkoxy radical, OJ_j、SJ_j、SOJ_j、SO₂J_j、NJ_jJ_k、N₃、CN、C(＝O)OJ_j、C(＝O)NJ_jJ_k、C(＝O)J_j、O-C(＝O)NJ_jJ_k、N(H)C(＝NH)NJ_jJ_k、N(H)C(＝O)NJ_jJ_kOr N (H) C (═ S) NJ_jJ_k；

Or q_eAnd q is_fTogether ═ C (q)_g)(q_h)；

q_gAnd q is_hEach independently of the others being H, halogen, C₁-C₁₂Alkyl, or substituted C₁-C₁₂An alkyl group.

Methyleneoxy (4' -CH)₂-O-2') BNA monomers adenine and cytosineThe synthesis and production of pyridine, guanine, 5-methyl-cytosine, thymine and uracil, their oligomerization, and their nucleic acid recognition properties have been described (Koshkin et al Tetrahedron, 1998, 54, 3607-3630). BNA and its preparation are also described in WO 98/39352 and WO 99/14226.

Methyleneoxy (4' -CH)₂Analogs of-O-2 ') BNA and 2' -thio-BNA have been prepared (Kumar et al, bioorg. Med. chem. Lett., 1998, 8, 2219-2222). The preparation of locked nucleoside analogues comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al, WO 99/14226). Furthermore, the synthesis of 2' -amino-BNA, a novel conformationally constrained high affinity oligonucleotide analogue, has been described in the art (Singh et al, j.org.chem., 1998, 63, 10035-10039). In addition, 2' -amino-and 2' -methylamino-BNA's have been prepared and their thermal stability with duplexes of complementary RNA and DNA strands has been previously reported.

In certain embodiments, a bicyclic nucleoside having formula VI:

wherein:

bx is a heterocyclic base moiety;

T_aand T_bEach independently is a covalent linkage of H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a support medium;

q_i、q_j、q_kand q is_lEach independently of the others being H, halogen, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₁-C₁₂Alkoxy, substituted C₁-C₁₂Alkoxy radical, OJ_j、SJ_j、SOJ_j、SO₂J_j、NJ_jJ_k，N₃、CN、C(＝O)OJ_j、C(＝O)NJ_jJ_k、C(＝O)J_j、O-C(＝O)NJ_jJ_k、N(H)C(＝NH)NJ_jJ_k、N(H)C(＝O)NJ_jJ_kOr N (H) C (═ S) NJ_jJ_k(ii) a And is

q_iAnd q is_jOr q_lAnd q is_kTogether ═ C (q)_g)(q_h) Wherein q is_gAnd q is_hEach independently of the others being H, halogen, C₁-C₁₂Alkyl, or substituted C₁-C₁₂An alkyl group.

Having 4' - (CH)₂)₃-2 'bridge and alkenyl analogue, bridge 4' -CH ═ CH-CH₂Carbocyclic bicyclic nucleosides of-2' have been described (Freeer et al, Nucleic acids Research, 1997, 25(22), 4429-4443 and Albaek et al, J.org.chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides and their oligomerization and biochemical studies have been described (Srivastava et al, j.am.chem.soc.2007, 129(26), 8362-8379).

In certain embodiments, nucleosides are modified by replacing the ribose ring with a sugar substitute. Such modifications include, but are not limited to, the replacement of the ribosyl ring with an alternative ring system (sometimes referred to as a DNA analog) such as a morpholino ring, cyclohexenyl ring, cyclohexyl ring, or tetrahydropyranyl ring, such as a ring system having one of the following formulae:

many other bicyclic and tricyclic alternate ring systems are also known in the art and may be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review articles: Leumann, Christian J., Bioorganic & medicinal chemistry, 2002, 10, 841-854). Such ring systems may be subject to various additional substitutions to enhance activity. See, for example, compounds having formula VII:

wherein for each of the at least one tetrahydropyran nucleoside analog of formula VII:

bx is a heterocyclic base moiety;

T_aand T_bEach independently is an internucleoside linking group or T linking the tetrahydropyran nucleoside analogue and the antisense compound_aAnd T_bOne is an internucleoside linking group linking a tetrahydropyran nucleoside analogue with an antisense compound and T_aAnd T_bIs H, a hydroxyl protecting group, a linked conjugate group, or a5 'or 3' -terminal group;

q₁、q₂、q₃、q₄、q₅、q₆and q is₇Each independently is H, C₁-C₆Alkyl, substituted C₁-C₆Alkyl radical, C₂-C₆Alkenyl, substituted C₂-C₆Alkenyl radical, C₂-C₆Alkynyl or substituted C₂-C₆An alkynyl group; and R is₁And R₂Each of which is selected from hydrogen, hydroxy, halogen, substituted or unsubstituted alkoxy, NJ₁J₂、SJ₁，N₃、OC(＝X)J₁、OC(＝X)NJ₁J₂、NJ₃C(＝X)NJ₁J₂And CN, wherein X is O, S or NJ₁And J is₁、J₂And J₃Each of which is independently H or C₁-C₆An alkyl group.

In certain embodiments, there is provided a modified THP nucleoside of formula VII, wherein q is₁、q₂、q₃、q₄、q₅、q₆And q is₇Each is H (M). In certain embodiments, q is₁、q₂、q₃、q₄、q₅、q₆And q is₇Is not H. In certain embodiments, q is₁、q₂、q₃、q₄、q₅、q₆And q is₇At least one of which is methyl. In certain embodiments, there are provided THP nucleosides of formula VII, whichIn R₁And R₂One is F (K). In certain embodiments, there are provided THP nucleosides of formula VII, wherein R is₁And R₂One is methoxyethoxy. In certain embodiments, R₁Is fluorine and R₂Is H; r₁Is H and R₂Is fluorine; r₁Is methoxy and R₂Is H, and R₁Is H and R₂Is a methoxyethoxy group. Methods for preparing modified sugars are well known to those skilled in the art.

In nucleotides with modified sugar moieties, the nucleobase moiety (natural, modified, or a combination thereof) is maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids comprise one or more nucleotides having a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2' -MOE. In certain embodiments, the 2' -MOE modified nucleotide is disposed in the notch matrix motif. In certain embodiments, the modified sugar moiety is a sugar having (4' -CH (CH)₃) -O-2') a bridging group. In certain embodiments, the amino group is arranged via (4' -CH (CH)₃) -O-2') are located throughout the wings of the notch base motif.

Methods for preparing modified sugars are well known to those skilled in the art.

In nucleotides with modified sugar moieties, the nucleobase moiety (natural, modified, or a combination thereof) is maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids comprise one or more nucleotides having a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2' -MOE. In certain embodiments, the 2' -MOE modified nucleotide is disposed in the notch matrix motif.

Modified nucleobases

Nucleobase (or base) modifications or substitutions can be structurally distinguishable from, but functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications may confer nuclease stability, binding affinity, or some other beneficial biological property to the antisense compound. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of antisense compounds to a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 ℃ (Sanghvi, Y.S., crook, S.T. and Lebleu, eds. B., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp.276-278).

Other modified nucleobases include 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C.ident.C-CH 3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (especially 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties may also include those in which other purine or pyrimidine bases are replaced by other heterocycles such as 7-deaza-adenine, 7-deaza-guanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to ANGPTL3 nucleic acids comprise one or more modified nucleobases. In certain embodiments, a shortened or gap-widened antisense oligonucleotide targeted to an ANGPTL3 nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Compositions and methods for formulating pharmaceutical compositions

The antisense oligonucleotides may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for formulating pharmaceutical compositions depend on a variety of criteria including, but not limited to, the route of administration, the extent of the disease, or the dose administered.

Antisense compounds targeted to ANGPTL3 nucleic acids can be used in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier.

Pharmaceutically acceptable diluents include Phosphate Buffered Saline (PBS). PBS is a suitable diluent for parenteral delivery of the composition. Thus, in one embodiment, used in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to an ANGPTL3 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

Pharmaceutical compositions comprising antisense compounds comprise any pharmaceutically acceptable salt, ester or salt of such ester, or any other oligonucleotide which, when administered to an animal, including a human, is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof. Thus, for example, the disclosure relates to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalent forms. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and salts.

Prodrugs can include incorporation of additional nucleosides at one or both ends of the antisense compound, which are cleaved in vivo by endogenous nucleases to form the active antisense compound.

Conjugated antisense compounds

The antisense compounds can be covalently linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include a cholesterol moiety and a lipid moiety. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups typically attached to one or both ends of the antisense compound to enhance properties such as, for example, nuclease stability. The stabilizing group includes a cap structure. These terminal modifications prevent degradation of antisense compounds having terminal nucleic acids from exonucleases, and can facilitate delivery and/or localization within cells. The cap may be present at the 5 '-end (5' -cap) or the 3 '-end (3' -cap) or may be present at both ends. Cap structures are well known in the art and include, for example, inverted desoxydealkalized caps. Further 3 'and 5' -stabilizing groups, which are used to cover the top of one or both ends of the antisense compound to confer nuclease stability, include those disclosed in WO 03/004602 published on 16/1/2003.

Cell culture and antisense compound treatment

The effect of antisense compounds on the level, activity or expression of an ANGPTL3 nucleic acid can be tested in vitro in a variety of cell types. Cell types for such analysis are available from commercial vendors (e.g., American Type CultureCo., Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics corporation, Walkersville, Md.) and cells are cultured using commercially available reagents (e.g., Invitrogen Life Technologies, Carlsbad, Calif.) according to the specifications of the vendors. Exemplary cell types include, but are not limited to, HepG2 cells, Hep3B cells, Huh7 (hepatocellular carcinoma) cells, primary hepatocytes, a549 cells, GM04281 fibroblasts, and LLC-MK2 cells.

In vitro testing of antisense oligonucleotides

Described herein are methods of treating cells with antisense oligonucleotides that can be appropriately modified to be treated with other antisense compounds.

Generally, cells are treated with antisense oligonucleotides when they reach about 60-80% confluence in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes cationic transfection reagents(Invitrogen, Carlsbad, Calif.). Combining an antisense oligonucleotide withIn that

1(Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide andthe concentration, which is usually 2 to 12ug/mL per 100nM antisense oligonucleotide.

Another reagent commonly used for introducing antisense oligonucleotides into cultured cells includes LIPOFECTAMINE

(Invitrogen, Carlsbad, Calif.). Combining antisense oligonucleotides with LIPOFECTAMINEIn that

1 Low serum Medium (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotides andthe concentration, which is usually 2 to 12ug/mL per 100nM antisense oligonucleotide.

Another reagent commonly used for introducing antisense oligonucleotides into cultured cells includes

(Invitrogen, Carlsbad, Calif.). Combining an antisense oligonucleotide withIn that

1 Low serum Medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotides andthe concentration, which is usually 2 to 12ug/mL per 100nM antisense oligonucleotide.

Another reagent commonly used for introducing antisense oligonucleotides into cultured cells includes Oligofectamine^TM(Invitrogen Life Technologies, Carlsbad, Calif.). Combining antisense oligonucleotides with Oligofectamine^TMIn Opti-MEM^TM-1 mixing in Low serum Medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of oligonucleotide with about 0.2 to 0.8 μ L of Oligofectamine per 100nM^TM: oligonucleotide ratio.

Another reagent commonly used to introduce antisense oligonucleotides into cultured cells includes FuGENE 6(Roche Diagnostics Corp., Indianapolis, IN). The antisense oligomer compound was mixed with FuGENE 6 in 1mL serum-free RPMI to achieve the desired concentration of oligonucleotide with 1 to 4 μ L of FuGENE 6 per 100nM of FuGENE 6: ratio of oligomeric compounds.

Another technique commonly used to introduce antisense oligonucleotides into cultured cells includes electroporation (Sambrook and Russell, Molecular Cloning: organic Manual, 3)^rdEd.，2001)。

Cells are treated with antisense oligonucleotides by conventional methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, when the RNA or protein level of the target nucleic acid is measured by methods known in the art and described herein. In general, when processing is performed in a plurality of copies, the data is presented as an average value of the copy processing.

The concentration of antisense oligonucleotide used varies with the cell line. Methods for determining the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. When in use

In Lipofectin or Cytofectin transfection, antisense oligonucleotides are generally used at concentrations ranging from 1nM to 300 nM. When transfected using electroporation, antisense oligonucleotides are used at higher concentrations in the range of 625 to 20,000 nM.

RNA isolation

RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. Methods for RNA isolation are well known in the art (Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3 rd edition, 2001). RNA according to the manufacturer's recommendations, using methods well known in the art, e.g., usingReagents (Invitrogen, Carlsbad, CA).

Analysis of inhibition of target levels or expression

Inhibition of the level or expression of an ANGPTL3 nucleic acid can be determined using a variety of methods known in the art (sambrook and Russell in Molecular cloning.a Laboratory manual. 3 rd edition.2001). For example, target nucleic acid levels can be quantified by, for example, Northern blot analysis, competitive Polymerase Chain Reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly (A) + mRNA. Methods for RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR may use commercially available ABI

7600. 7700 or 7900 sequence Detection System (available from PE-Applied Biosystems, Foster City, Calif.) is conveniently implemented and produced according toThe manufacturer's specifications.

Quantitative real-time PCR analysis of target RNA levels

Quantification of target RNA levels ABI can be used by quantitative real-time PCR according to the manufacturer's instructions7600. 7700 or 7900 sequence detection System (PE-Applied Biosystems, Foster City, Calif.). Methods for quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a Reverse Transcriptase (RT) reaction, which produces complementary DNA (cDNA), which is then used as a substrate for real-time PCR amplification. The RT and real-time PCR reactions were performed sequentially in the same sample well. RT and real-time PCR reagents were obtained from Invitrogen (Carlsbad, Calif.). RT and real-time PCR reactions are carried out by methods well known to those skilled in the art.

The target number of genes (or RNAs) obtained by real-time PCR can be determined using the expression level of a gene expressing a constant, such as cyclophilin A, or by using

(Invitrogen, inc. carlsbad, CA) quantitated total RNA for normalization. Cyclophilin a expression is quantified by real-time PCR, by running simultaneously with the target, multiplex technology, or separately. Total RNA usage

RNA quantification reagent (Invitrogen, inc. carlsbad, CA). By passingMethods for performing RNA quantitation are taught in Jones, L.J. et al (Analytical Biochemistry, 1998, 265, 368-374).

4000 instruments (PE Applied Biosystems) for measuringFluorescence.

Probes and primers were designed to hybridize to ANGPTL3 nucleic acids. Methods for using designed real-time PCR probes and PRIMERs are well known in the art and may include the use of software such as PRIMERSoftware (Applied Biosystems, Foster City, Calif.).

The number of gene targets obtained by RT, real-time PCR can be normalized using the expression level of GAPDH (a gene whose expression is constant), OR by quantifying total RNA using RiboGreenTM (Molecular Probes, inc. GAPDH expression was quantified by RT, real-time PCR, by simultaneous run with target, multiplex, or separately. Total RNA was quantified using RiboGreenTM RNA quantification reagent (Molecular Probes, Inc. Eugene, OR).

Shown in table 2 are primers and probes for measuring GAPDH expression in the cell types described herein. The GAPDH PCR probe has a JOE covalently linked to the 5 'end and a TAMRA or MGB covalently linked to the 3' end, wherein JOE is a fluorescent reporter dye and TAMRA or MGB is a quencher dye. In some cell types, primers and probes designed to the GAPDH sequence from different species are used to measure GAPDH expression. For example, human GAPDH primer and probe sets are used to measure GAPDH expression in monkey cells and cell lines.

TABLE 2

GAPDH primers and probes for real-time PCR

Target name	Species (II)	Description of sequences	Sequences (5 'to 3')	SEQ ID NO
					GAPDH	Human being	Forward primer	CAACGGATTTGGTCGTATTGG	15
GAPDH	Human being	Reverse primer	GGCAACAATATCCACTTTACCAGAGT	16
					GAPDH	Human being	Probe needle	CGCCTGGTCACCAGGGCTGCT	17
GAPDH	Human being	Forward primer	GAAGGTGAAGGTCGGAGTC	18
					GAPDH	Human being	Reverse primer	GAAGATGGTGATGGGATTTC	19
GAPDH	Human being	Probe needle	CAAGCTTCCCGTTCTCAGCC	20
					GAPDH	Human being	Forward primer	GAAGGTGAAGGTCGGAGTC	18
GAPDH	Human being	Reverse primer	GAAGATGGTGATGGGATTTC	19
					GAPDH	Human being	Probe needle	TGGAATCATATTGGAACATG	21
GAPDH	Mouse	Forward primer	GGCAAATTCAACGGCACAGT	22
					GAPDH	Mouse	Reverse primer	GGGTCTCGCTCCTGGAAGAT	23
GAPDH	Mouse	Probe needle	AAGGCCGAGAATGGGAAGCTTGTCATC	24
					GAPDH	Rat	Forward primer	TGTTCTAGAGACAGCCGCATCTT	25
GAPDH	Rat	Reverse primer	CACCGACCTTCACCATCTTGT	26
					GAPDH	Rat	Probe needle	TTGTGCAGTGCCAGCCTCGTCTCA	27

Probes and primers for real-time PCR are designed to hybridize to target-specific sequences. The probes and primers and the target nucleic acid sequences to which they hybridize are shown in table 3. The target-specific PCR probe has a FAM covalently linked to the 5 'end and a TAMRA or MGB covalently linked to the 3' end, wherein the FAM is a fluorescent dye and the TAMRA or MGB is a quencher dye.

TABLE 3

Gene target specific primers and probes for real-time PCR

Analysis of protein levels

Antisense inhibition of ANGPTL3 nucleic acids can be assessed by measuring ANGPTL3 protein levels. The protein level of ANGPTL3 can be assessed or quantified using a variety of methods well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (e.g., caspase activity assays), immunohistochemistry, immunocytochemistry, or Fluorescence Activated Cell Sorting (FACS) (sambrook and Russell, Molecular Cloning: a Laboratory Manual, 3 rd edition, 2001). Antibodies to the target can be identified and obtained from a variety of sources, such as the MSRS catalogue of antibodies (aeire Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody production methods well known in the art.

In vivo assays for antisense compounds

Antisense compounds, e.g., antisense oligonucleotides, are tested in animals to assess their ability to inhibit ANGPTL3 expression and produce phenotypic changes. The test can be performed in normal animals or in experimental disease models. For administration to an animal, the antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate buffered saline. Administration includes parenteral routes of administration. After a period of treatment with antisense oligonucleotides, RNA was isolated from the tissue and changes in ANGPTL3 nucleic acid expression were measured. Changes in ANGPTL3 protein levels were also measured.

Certain indications

In certain embodiments, provided herein are methods of treating an individual comprising administering one or more of the pharmaceutical compositions described herein. In certain embodiments, the subject has a metabolic disease and/or a cardiovascular disease. In certain embodiments, the individual has atherosclerosis, hepatic steatosis or hyperlipidemia.

Thus, provided herein are methods for alleviating a symptom associated with a metabolic disease or a cardiovascular disease. Also provided herein are methods for alleviating a symptom associated with atherosclerosis, hepatic steatosis or hyperlipidemia in a subject in need thereof. In certain embodiments, provided are methods for reducing the rate of onset of symptoms associated with a metabolic disease or a cardiovascular disease. In certain embodiments, provided are methods for reducing the rate of onset of a symptom associated with atherosclerosis, hepatic steatosis or hyperlipidemia. In certain embodiments, provided are methods for reducing the severity of symptoms associated with a metabolic disease or cardiovascular disease. In certain embodiments, provided are methods for reducing the severity of a symptom associated with atherosclerosis, hepatic steatosis or hyperlipidemia. In such embodiments, the method comprises administering to an individual in need thereof a therapeutically effective amount of a compound targeted to an ANGPTL3 nucleic acid.

In certain embodiments, administration of an antisense compound targeted to an ANGPTL3 nucleic acid results in a reduction in ANGPTL3 expression of at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising antisense compounds targeted to ANGPTL3 are useful for the preparation of medicaments for treating patients suffering from or susceptible to metabolic or cardiovascular disease. In certain embodiments, pharmaceutical compositions comprising antisense compounds targeted to ANGPTL3 are useful for the preparation of medicaments for treating a patient suffering from or susceptible to atherosclerosis, hepatic steatosis or hyperlipidemia.

In certain embodiments, the methods described herein comprise administering a pharmaceutical composition comprising a polypeptide having the sequence of SEQ ID NO: 34-182, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobase moieties of the sequence recited in seq id No. 34-182.

Administration of

In certain embodiments, the compounds and compositions described herein are administered parenterally.

In certain embodiments, the parenteral administration is by infusion. Infusion may be chronic or continuous or short-term or intermittent. In certain embodiments, the infused medicament is delivered with a pump.

In certain embodiments, parenteral administration is by injection. The injection may be delivered with a syringe or pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to the tissue or organ.

Certain combination therapies

In certain embodiments, the first active agent comprises a modified oligonucleotide of the invention co-administered with one or more second active agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition than the first agent described herein. In certain embodiments, such second active agents are designed to treat one or more of the undesirable side effects of the pharmaceutical compositions described herein. In certain embodiments, a second active agent is co-administered with the first active agent to treat the undesired effects of the first active agent. In certain embodiments, a second active agent is co-administered with the first active agent to produce a combined effect. In certain embodiments, the second active agent is co-administered with the first active agent to produce a synergistic effect.

In certain embodiments, the first active agent and the one or more second active agents are administered at the same time. In certain embodiments, the first active agent and the one or more second active agents are administered at different times. In certain embodiments, the first active agent and the one or more second active agents are prepared in a single pharmaceutical formulation. In certain embodiments, the first active agent and the one or more second active agents are prepared separately.

In certain embodiments, the second active agent includes, but is not limited to, ascorbic acid.

Embodiments of various aspects provided by the invention are also described in any of the following paragraphs.

1. A method of reducing expression of ANGPTL3 in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein expression of ANGPTL3 in the animal is reduced.

2. A method of reducing apoC-III expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein expression of apoC-III is reduced in the animal.

3. A method of reducing triglyceride levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein triglyceride levels are reduced in the animal.

4. A method of reducing cholesterol levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein cholesterol levels in the animal are reduced.

5. A method of reducing Low Density Lipoprotein (LDL) levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein the level of Low Density Lipoprotein (LDL) is reduced in the animal.

6. A method of reducing glucose levels in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein glucose levels are reduced in the animal.

7. A method of ameliorating metabolic or cardiovascular disease in an animal comprising administering to the animal a compound comprising a modified oligonucleotide 10 to 30 linked nucleosides in length targeted to ANGPTL3, wherein metabolic or cardiovascular disease is ameliorated in the animal.

8. The method of any of paragraphs 1-7, wherein the modified oligonucleotide has an amino acid sequence identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide.

9. The method of any of paragraphs 1-7, wherein the modified oligonucleotide has a sequence comprising SEQ id no: 34-182 of at least 8 consecutive nucleobases of the sequence set forth in any of the preceding claims.

10. The method of any one of paragraphs 1-7, wherein the animal is a human.

11. The method of any of paragraphs 1-7, wherein the compound is a first active agent, and further comprising administering a second active agent.

12. The method of paragraph 11, wherein the first active agent and the second active agent are co-administered.

13. The method of any of paragraphs 11, wherein the second active agent is a glucose-lowering agent.

14. The method of paragraph 13, wherein the glucose-lowering agent is a therapeutic lifestyle change, a PPAR agonist, a dipeptidyl peptidase (IV) inhibitor, a GLP-1 analog, insulin or an insulin analog, an insulin secretagogue, an SGLT2 inhibitor, a human amylin analog, a biguanide, an alpha-glucosidase inhibitor, or a combination thereof.

15. The method of paragraph 13, wherein the glucose-lowering agent is metformin, a sulfonylurea, rosiglitazone, or a combination thereof.

16. The method of paragraph 13, wherein the glucose-lowering agent is a sulfonylurea selected from the group consisting of: acetohexamide, chlorpropamide, tolbutamide, tolazamide, glimepiride, glipizide, glibenclamide or gliclazide.

17. The method of paragraph 13, wherein the glucose-lowering agent is metformin.

18. The method of paragraph 13, wherein the glucose-lowering agent is meglitinide selected from nateglinide or repaglinide.

19. The method of paragraph 13, wherein the glucose-lowering agent is a thiazolidinedione selected from pioglitazone or rosiglitazone.

20. The method of paragraph 13, wherein the glucose-lowering agent is an alpha-glucosidase inhibitor selected from acarbose or miglitol.

21. The method of paragraph 11, wherein the second active agent is a lipid lowering therapy.

22. The method of paragraph 21, wherein the lipid lowering therapy is a therapeutic lifestyle change, an HMG-CoA reductase inhibitor, a cholesterol absorption inhibitor, an MTP inhibitor, an antisense compound targeted to ApoB, or any combination thereof.

23. The method of paragraph 21, wherein the lipid lowering therapy is an HMG-CoA reductase inhibitor selected from the group consisting of: atorvastatin, fluvastatin, lovastatin, pravastatin, rosuvastatin or simvastatin.

24. The method of paragraph 21, wherein the lipid lowering therapy is the cholesterol absorption inhibitor ezetimibe.

25. The method of any of paragraphs 1-7, wherein administering comprises parenteral administration.

26. The method of any of paragraphs 1-7, wherein the compound consists of a single-stranded modified oligonucleotide.

27. The method of any of paragraphs 1-7, wherein the modified oligonucleotide has an amino acid sequence identical to SEQ ID NO: 1-5, as measured on the integrity of the modified oligonucleotide.

28. The method of any of paragraphs 1-7, wherein the modified oligonucleotide has an amino acid sequence identical to SEQ ID NO: 1-5, as measured on the integrity of the modified oligonucleotide.

29. The method of any of paragraphs 1-7, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

30. The method of paragraph 29, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

31. The method of any of paragraphs 1-7, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

32. The method of paragraph 31, which comprises at least one tetrahydropyran modified nucleoside wherein the tetrahydropyran ring replaces the furanose ring.

33. The method of paragraph 32, wherein each of the at least one tetrahydropyran modified nucleoside has the structure:

wherein Bx is an optionally protected heterocyclic base moiety.

34. The method of paragraph 31, wherein the at least one modified sugar is a bicyclic sugar.

35. The method of paragraph 31 wherein the at least one modified sugar comprises 2 '-O-methoxyethyl or 4' - (CH)₂)_n-an O-2' bridge, wherein n is1 or 2.

36. The method of any of paragraphs 1-7, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

37. The method of paragraph 36, wherein the modified nucleobase is a 5-methylcytosine.

38. The method of any of paragraphs 1-7, wherein the modified oligonucleotide consists of 20 linked nucleosides.

39. The method of any of paragraphs 1-7, wherein the modified oligonucleotide comprises:

a. a gap segment consisting of linked deoxynucleosides;

b. a 5' wing segment consisting of linked nucleosides;

c. a 3' wing segment consisting of linked nucleosides;

wherein the notch segment is located between the 5 'wing segment and the 3' wing segment and each nucleoside in each wing segment comprises a modified sugar.

40. The method of any of paragraphs 1-7, wherein the modified oligonucleotide consists of 20 linked nucleosides having a nucleotide sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 34-182, and comprises:

a. a gap segment consisting of 10 linked deoxynucleosides;

b. a 5' wing segment consisting of 5 linked nucleosides;

c. a 3' wing segment consisting of 5 linked nucleosides;

wherein the notch segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.

41. A method for treating an animal having a metabolic disease or a cardiovascular disease comprising

a. Identifying said animal having a metabolic disease or a cardiovascular disease,

b. administering to the animal a therapeutically effective amount of a compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a nucleotide sequence identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide,

wherein said animal suffering from a metabolic disease or a cardiovascular disease is treated.

42. The method of paragraph 41, wherein administering the therapeutically effective amount of the compound to the animal reduces a metabolic disease or a cardiovascular disease in the animal.

43. The method of paragraph 7 or 41, wherein the metabolic or cardiovascular disease is obesity, diabetes, atherosclerosis, dyslipidemia, coronary heart disease, Non Alcoholic Fatty Liver Disease (NAFLD), high fatty acidemia, or metabolic syndrome, or a combination thereof.

44. The method of paragraph 43, wherein the dyslipidemia is hyperlipidemia.

45. The method of paragraph 44, wherein said hyperlipidemia is hypercholesterolemia, hypertriglyceridemia, hypercholesterolemia, and hypertriglyceridemia.

46. The method of paragraph 43 wherein the NAFLD is hepatic steatosis or steatohepatitis.

47. The method of paragraph 43, wherein the diabetes is type 2 diabetes or type 2 diabetes with dyslipidemia.

48. The method of paragraph 1, wherein the administration results in a reduction in lipid levels, including triglyceride levels, cholesterol levels, insulin resistance, glucose levels, or a combination thereof.

49. The method of paragraph 48, wherein the level is independently reduced by 5%, 10%, 20%, 30%, 35%, or 40%.

50. The method of any of paragraphs 1-7, wherein the administration results in increased insulin sensitivity.

51. The method of paragraph 50, wherein the administration results in increased insulin sensitivity.

52. A method of reducing one or more of ANGPTL3 levels, LDL levels, apoC-III levels, triglyceride levels, cholesterol levels, glucose levels, fat pad weight, cardiovascular disease, and metabolic disease in a human by administering an ANGPTL3 inhibitor comprising a modified oligonucleotide consisting of 20 linked nucleosides and having an amino acid sequence that is identical to SEQ ID NO: 1-5 nucleobase sequences that are at least 90% complementary, as measured on the integrity of the modified oligonucleotide.

53. The method of any one of paragraphs 1-52, wherein the administering results in atherosclerotic plaques, obesity, glucose, lipids, glucose resistance, cholesterol reduction, or increased insulin sensitivity, or any combination thereof.

54. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleotide sequence comprising an amino acid sequence selected from SEQ ID NO: 34-182 of at least 8 consecutive nucleobases of the nucleobase sequence of any one of the nucleobase sequences.

55. The compound of paragraph 54, wherein the nucleobase sequence of the modified oligonucleotide has a sequence that is complementary to a nucleobase sequence of SEQ ID NO: 1-5 are at least 95% complementary.

56. The compound of paragraph 54, wherein the nucleobase sequence of the modified oligonucleotide has a sequence that is complementary to a nucleobase sequence of SEQ ID NO: 1-5 are at least 100% complementary.

57. The compound of paragraph 54, wherein the modified oligonucleotide is a single stranded oligonucleotide.

58. The compound of paragraph 54 wherein at least one internucleoside linkage is a modified internucleoside linkage.

59. The compound of paragraph 58 wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

60. The compound of paragraph 54 wherein at least one nucleoside comprises a modified sugar.

61. The compound of paragraph 60, wherein at least one modified sugar is a bicyclic sugar.

62. The compound of paragraph 60 wherein the at least one modified sugar comprises 2 '-O-methoxyethyl or 4' - (CH)₂)_n-an O-2' bridge, wherein n is1 or 2.

63. The compound of paragraph 54 wherein at least one nucleoside comprises a modified nucleobase.

64. The compound of paragraph 63, wherein the modified nucleobase is a 5-methylcytosine.

65. The compound of paragraph 54, wherein the modified oligonucleotide comprises:

a gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides;

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is located between the 5 'wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar.

66. The compound of paragraph 54, wherein the modified oligonucleotide consists of 20 linked nucleosides and comprises:

a gap segment consisting of 10 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides;

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar; and wherein each internucleoside linkage is a phosphorothioate linkage.

67. The compound of paragraph 54, wherein the modified oligonucleotide consists of 20 linked nucleosides.

68. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a sequence comprising a sequence selected from SEQ ID NOs: 34-182 of at least 8 consecutive nucleobases of the nucleobase sequence of any one of the sequences recited in claims 34-182.

69. The compound of paragraph 68, wherein the modified oligonucleotide is a single stranded oligonucleotide.

70. The compound of paragraph 68, wherein the modified oligonucleotide consists of 20 linked nucleosides.

71. A compound comprising a modified oligonucleotide consisting of 20 linked nucleosides and having a sequence comprising a sequence selected from seq id NOs: 34-182, wherein the modified oligonucleotide comprises a nucleobase sequence of at least 8 consecutive nucleobases of the nucleobase sequence of any one of the nucleobase sequences:

a gap segment consisting of 10 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides;

a 3' wing segment consisting of 5 linked nucleosides;

wherein the notch segment is located between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2' -O-methoxyethyl sugar, wherein each internucleoside linkage is a phosphorothioate linkage, and wherein each cytosine is a 5-methylcytosine.

Examples

Non-limiting disclosure and incorporation by reference

While certain compounds, compositions, and methods described herein have been described selectively according to certain embodiments, the following examples are illustrative of the compounds described herein and are not intended to be limiting. Each reference cited in this application is incorporated herein by reference in its entirety.