Substance for down-regulating YTHDF2 protein expression and application thereof
阅读说明：本技术 下调ythdf2蛋白表达的物质及其应用 (Substance for down-regulating YTHDF2 protein expression and application thereof ) 是由 季勇 仲艳青 游黛婷 李雪松 于 2021-01-13 设计创作，主要内容包括：本发明涉及基因工程技术领域,尤其涉及一种下调YTHDF2蛋白表达的物质及其应用；该下调YTHDF2蛋白表达的物质包括基于YTHDF2的小干扰RNA或YTHDF2shRNA的内皮特异性腺相关病毒,可应用于制备治疗心血管疾病药物；本发明开拓了动脉粥样硬化相关血管疾病防治药物制备的新方法,对于动脉粥样硬化相关血管疾病的防治提供了新的方向。(The invention relates to the technical field of genetic engineering, in particular to a substance for down-regulating YTHDF2 protein expression and application thereof; the substance for down-regulating YTHDF2 protein expression comprises small interfering RNA based on YTHDF2 or endothelial specific gonadal related virus of YTHDF2shRNA, and can be applied to the preparation of drugs for treating cardiovascular diseases; the invention develops a new method for preparing the medicament for preventing and treating the atherosclerosis related vascular diseases and provides a new direction for preventing and treating the atherosclerosis related vascular diseases.)
1. A substance for down-regulating YTHDF2 protein expression comprises small interfering RNA based on YTHDF2 or endothelial-specific gonadal-associated virus based on YTHDF2 shRNA.
2. The substance for down-regulating YTHDF2 protein expression of claim 1, wherein the nucleotide sequence of the YTHDF 2-based small interfering RNA is shown as SEQ ID NO. 1.
3. The substance capable of down-regulating YTHDF2 protein expression according to claim 1, wherein the nucleotide sequence of the endothelial-specific gonadal-associated virus of YTHDF2shRNA is shown in SEQ ID No. 3.
4. An application of a substance for down-regulating YTHDF2 protein expression in preparing medicine for preventing and treating cardiovascular diseases is disclosed.
5. The use of claim 4, wherein the agent that down-regulates YTHDF2 protein expression is an endothelial-specific gonadal-associated virus based on YTHDF2 small interfering RNA or YTHDF2 shRNA.
6. The use of claim 5, wherein the nucleotide sequence of the small interfering RNA based on YTHDF2 is shown in SEQ ID NO. 1.
7. The use of claim 5, wherein the nucleotide sequence of the endothelial-specific gonadal-associated virus of YTHDF2shRNA is as shown in SEQ ID No. 3.
8. The use of any one of claims 4 to 7, wherein the medicament comprises a medicament for the prevention or treatment of atherosclerosis.
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a substance for down-regulating YTHDF2 protein expression and application thereof in preparing a medicament for treating cardiovascular diseases.
Background
Cardiovascular disease (CVD) is currently the most serious disease threatening human health worldwide. Cardiovascular diseases can be caused by a variety of factors, some undesirable lifestyle habits (smoking, alcohol drinking, lack of physical exercise), and some chronic diseases such as diabetes, hypertension, high cholesterol, and the like. Atherosclerosis is a common pathophysiological process in a variety of cardiovascular diseases.
Atherosclerosis is a chronic inflammatory disease of the blood vessels characterized by plaques formed by the retention of lipids in the wall of the artery, and many studies have found that vascular endothelial damage is the initiating factor in its formation. Vascular Endothelial Cells (ECs) are a layer of flat squamous cells that continuously cover the luminal surface of blood vessels and play an important role in regulating the function of vascular endothelium. In the presence of stimuli such as diabetes, blood lipids and hemodynamic abnormalities, EC damage is dysfunctional (ECD), which includes local permeability enhancement, capture and modification of lipoprotein particles in circulating blood, selective recruitment of monocytes into the subintimal to differentiate into macrophages and internalize the modified lipoproteins into foam cells, while inducing proliferation and migration of adjacent smooth muscle cells overlying the necrotic core surface to form plaques. As the inflammatory environment within the plaque increases and the fibrous cap degrades, eventually the plaque ruptures, triggering a serious CVD event.
N6-methyladenosine (m6A) is one of the most abundant modifications in messenger rna (mrna) of eukaryotes as a post-transcriptional epitope splicing modification. Methyltransferase complexes (METTL3, METTL14, WTAP and KIAA1429) can increase m6A modification of mRNAs, demethylases (FTO and ALKBH5) can decrease m6A modification of mRNAs, and these mRNAs with m6A modification can be recognized and bound by recognition proteins (YTHDF1-3, YTHDC1-2, and HNRNP family proteins). The different post-transcriptional results of m6A methylation were dependent on the protein they recognized. YTHDF2(YTH domain family 2) is the most effective m6A reader, and impairs mRNA stability by recognizing mRNA containing m6A and distributing it to the processing body.
RNA interference (RNAi) refers to the phenomenon in which double-stranded RNA (dsrna), which consists of sense RNA and antisense RNA corresponding to mRNA, is introduced into a cell, and the mRNA is specifically degraded, resulting in the silencing of the corresponding gene. Since the expression of a specific gene can be specifically knocked out or turned off using the RNAi technology, the technology has been widely used in the field of gene therapy for exploring gene functions and infectious diseases and malignant tumors. Small interfering RNA (siRNA), sometimes referred to as short interfering RNA or silencing RNA, is a class of double-stranded RNA molecules that are 20-25 base pairs in length, similar to miRNA, and operate within the RNA interference (RNAi) pathway. It interferes with the post-transcriptional degradation of mRNA of a particular gene expressing a nucleotide sequence complementary thereto, thereby preventing translation.
At present, YTHDF2 has been reported to play a role in the regulation of tumor, the homeostasis of Hematopoietic Stem Cells (HSCs) and hematopoietic regeneration, however, the role and mechanism of YTHDF2 in cardiovascular diseases have not been studied and reported at present.
Disclosure of Invention
In order to solve the problems, the application provides a substance for down-regulating YTHDF2 protein expression and application thereof in preparing a medicament for treating cardiovascular diseases.
First, the present application provides a substance for down-regulating YTHDF2 protein expression, including endothelium-specific gonadal-associated virus based on YTHDF2 small interfering RNA and YTHDF2 shRNA.
Furthermore, the nucleotide sequence of the sense strand of the small interfering RNA based on YTHDF2 is shown as SEQ ID NO.1 (5'-GUUCUGUUCUUGUACAUUAUA-3'), and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.2 (3 '-CAAGACAAGAACAUGUAAUAU-5'). The small interfering RNA is prepared according to a 21nt target sequence GTTCTGTTCTTGTACATTATA (2494-2514) in the YTHDF2 gene. The mRNA (human) sequence of YTHDF2 has been published by the NCBI-Gene website and is shown in SEQ ID NO. 4.
Furthermore, the nucleotide sequence of the endothelial specific gonad-associated virus of the YTHDF2shRNA is shown as SEQ ID NO. 3.
Secondly, the application also provides the application of the substance for down-regulating the expression of YTHDF2 protein in preparing the medicine for treating cardiovascular diseases, in particular the application in preparing the medicine for treating atherosclerosis.
Compared with the prior art, the substance for down-regulating YTHDF2 protein expression provided by the application has the following beneficial effects:
(1) the substance (including small interfering RNA and endothelial specific gonad related virus of YTHDF2 shRNA) for down-regulating YTHDF2 protein expression takes YTHDF2 as a target for inhibiting inflammation, and has the function of regulating and controlling inflammatory signal channels; the peptide has the advantages of easy synthesis, low cost and good specificity to YTHDF2, and can specifically inhibit the expression of YTHDF2, thereby regulating and controlling inflammatory signal pathways and achieving the effect of inhibiting inflammation.
(2) The medicine prepared according to the substance for down-regulating YTHDF2 protein expression can effectively inhibit cardiovascular diseases, has important guiding function for developing new anti-atherosclerosis medicines, and has great social benefit and economic value.
Drawings
FIG. 1 is a graph showing the protein expression levels of YTHDF2 in normal (non-CAD) and Atherosclerotic (CAD) aortic tissues; the detection method comprises extracting proteins from aortic tissues of normal human and atherosclerotic patients, and detecting YTHDF2 expression with Western Blot;
wherein, FIG. 1A is a schematic diagram of Western Blot detection results, FIG. 1B is a schematic diagram of statistical results,**P<0.01。
FIG. 2 shows Normal (NC) and High Fat Diet (HFD) Apoe-/-mRNA expression levels of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 in the mouse aorta are shown schematically: experimental method for extracting Apoe administered with normal and high fat diet-/-After mRNA in mouse aortic tissue, the expression of YTHDF2 related mRNA was detected by qRT-PCR,***P<0.001。
FIG. 3 shows YTHDF2 after administration of Normal (NC) and High Fat Diet (HFD) Apoe-/-Protein expression levels in mouse aorta: extraction of Apoe for administration to normal and high fat diets-/-After the protein in the aortic tissue of the mice, the expression of YTHDF2 was detected by Western Blot;
wherein, FIG. 3A is a schematic diagram of Western Blot detection results, FIG. 3B is a schematic diagram of statistical results,*P<0.05。
FIG. 4 is a graph showing the mRNA expression levels of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 after HUVECs are administered ox-LDL (100. mu.g/mL) stimulation; the detection method comprises the steps of extracting HUVECs mRNA after the control and ox-LDL stimulation are given, and detecting the expression of YTHDF2 related mRNA by qRT-PCR.*P<0.05，**P<0.01，***P<0.001。
FIG. 5 is a graph showing the results of detecting the protein expression levels of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 after ox-LDL (100. mu.g/mL) stimulation of HUVECs: the detection method comprises extracting HUVECs protein after control and ox-LDL stimulation, and detecting the expression of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 by Western Blot;
wherein, FIG. 5A is a schematic diagram of Western Blot detection results, FIG. 5B is a schematic diagram of statistical results,*P<0.05，***P<0.001。
FIG. 6 shows YTHDF2 after Apoe administration with normal and high fat diet-/-Photograph of immunofluorescence assay for expression levels in mouse aortic tissue sections:
the detection method comprises extracting Apoe administered with Normal (NC) and High Fat Diet (HFD)-/-OCT embedding is carried out after mouse aortic tissues are processed, after frozen sections, expression pictures of YTHDF2 are detected by immunofluorescence; wherein, A (red) is CD31, C (green) is YTHDF2, B (blue) is cell nucleus (DAPI), and arrows indicate that YTHDF2 and CD31 co-locate in yellow region.
FIG. 7 is a diagram showing the detection efficiency of small interfering RNA; the detection method is that after HUVECs are transfected with YTHDF2 small interfering RNA, the interference efficiency of YTHDF2 is detected by Western Blot.
FIG. 8 is a schematic diagram showing the results of detection of the mRNA expression levels of ICAM-1 and VCAM-1;
the detection method comprises the steps of transfecting siYTHDF2 with HUVECs, stimulating with ox-LDL (100 mu g/mL) for 24 hours, and detecting the mRNA expression levels of ICAM-1 and VCAM-1 by qRT-PCR.***P<0.001。
FIG. 9 is a diagram showing the results of detecting the expression level of ICAM-1 protein by Western Blot;
the detection method comprises the steps that HUVECs are transfected with siYTHDF2, the siYTHDF2 is stimulated with ox-LDL (100 mu g/mL) for 24 hours, and the expression level of ICAM-1 protein is detected by Western Blot;
wherein, FIG. 9A is a schematic diagram of the detection result of Western Blot, FIG. 9B is a schematic diagram of the statistical result,*P<0.05，**P<0.01。
FIG. 10 is a diagram showing the results of detecting the expression level of VCAM-1 protein by Western Blot;
the detection method comprises the steps that HUVECs are transfected with siYTHDF2, the siYTHDF2 is stimulated with ox-LDL (100 mu g/mL) for 24 hours, and the expression level of VCAM-1 protein is detected by Western Blot;
wherein, FIG. 10A is a schematic diagram of the detection result of Western Blot, FIG. 10B is a schematic diagram of the statistical result,**P<0.01，***P<0.001。
FIG. 11 is a photograph of fluorescence detection of a red fluorescent dye Dil after staining;
the detection method comprises the steps of transfecting siYTHDF2 with HUVECs, stimulating with ox-LDL (100 mu g/mL) for 24 hours, co-culturing with human peripheral blood mononuclear cells THP1 labeled with a red fluorescent dye Dil (2.5mg/mL) of a living cell membrane for 1 hour, and observing the adhesion condition of the mononuclear cells and endothelial cells by an inverted fluorescence microscope. FIG. 12 is a diagram showing the results of mRNA detection of mouse vascular tissues ICAM-1 and VCAM-1;
the detection method selects 8-week-old male Apoe-/-Mice, tail vein injection of endothelial specific gonadal associated virus (AAV) expressing unloaded and YTHDF2shRNAendo) After 2 weeks, normal feed (control group) or high-fat diet (AS animal model group) is given, and after 16 weeks, the expression level of the inflammatory factors in the vascular tissues of the mice is detected through a qRT-PCR experiment;***P<0.001。
FIG. 13 is a graph of the results of HE staining of aortic vessels in mice;
the detection is to select male Apoe with age of 8 weeks-/-Mice, tail vein injection of endothelial specific gonadal associated virus (AAV) expressing unloaded and YTHDF2shRNAendo) After 2 weeks, normal diet (control group) or high-fat diet (AS animal model group) was given, and after 16 weeks, aortic blood vessels were harvested and examined for plaque area size by HE staining.
Detailed Description
The following examples refer to cells, sources of reagents:
human Umbilical Vein Endothelial Cells (HUVECs): supplied by the women and children health care institute of Nanjing.
Human acute monocyte cell line (THP 1): purchased from Shanghai institute of Biotechnology, and obtained from American Type Tissue Culture Collection (ATCC).
Apoe-/-Mice: purchased from Witonglihua laboratory animal technology, Inc.
Vascular tissues of normal and CAD patients were provided by the drumbeat hospital, tokyo, south.
Endothelial specific gonadal associated virus (AAV) of YTHDF2shRNAendo) Synthesized by Suzhou Jimai Gene medicine Biotech Co.
The following examples refer to cell experiments that were approved by the ethical committee of the university of medical, Nanjing.
Example 1 assay for correlation of YTHDF2 protein expression with atherosclerosis
In order to explore whether YTHDF2 is involved in aortic lesions in normal human aortic tissues and in the aorta of atherosclerotic patients, the expression level of YTHDF2 protein was first examined by Western Blot.
The Western-Blot detection method comprises the following steps:
(1) SDS-PAGE (Polyacrylamide gel) electrophoresis: 12% of separation glue and 3% of concentrated glue are prepared. Take 15. mu.L of sample solution and 3. mu.L of 6 Xloading buffer solution, mix well. The protein was denatured by boiling for 5 minutes and loaded at approximately 30. mu.g per well. Electrophoresis at constant voltage of 110V for about 90 minutes until bromophenol blue completely disappeared.
SDS-PAGE was formulated as follows:
(2) film transfer: after electrophoresis, the concentrated gel is cut off, and the gel is immersed in a protein transfer buffer (3.6g/L Tris, 300mL/L methanol, 17.3g/L glycine) for equilibration for 10-20 minutes. The protein bands were transferred to PVDF membrane (SDS-gel on the negative side and PVDF membrane on the positive side) by wet-transfer, and subjected to 0.3A constant current electrophoresis for 80 minutes.
(3) And (3) sealing: after the membrane transfer was completed, the PVDF membrane was removed, and after 5 minutes of immersion in PBS, the membrane was immersed in 5% nonfat dry milk in PBS (MPBS) for 1 hour.
(4) Primary antibody incubation: after blocking, the membrane was placed in a hybridization bag, antibody was added, and shaking was carried out overnight at 4 ℃.
(5) And (3) binding of a secondary antibody: TBS-T (TBS added with Tween-20, 0.05%) was washed once, then TBS-T was washed 10 min x 3 times. Horseradish peroxidase-labeled rabbit anti-sheep secondary antibody (purchased from Sigma-Aldrich, 1% MPBS 1:2000 dilution) was added and incubated at room temperature for 1 hour. TBS-T was washed once quickly and again 10 min X3 times.
(6) ECL color development: mixing the ECL color developing solution A and the ECL color developing solution B before use, uniformly dripping the mixture on the surface of the membrane, exposing the membrane in a dark place, and observing the result.
The above detection method is a conventional method in the art, and can also be found in the literature "Xie L, et al.analogous Redox signal.2016, 20; 24(6) 329-; xi H, et al. circ Res.2016; 118(10) 1525-39. ").
The results of this example are shown in FIG. 1, and it can be seen that the level of YTHDF2 protein expression in the aortic tissue of atherosclerotic patients (CAD) is significantly increased compared to normal human aortic tissue (FIG. 1A), and in the statistical results of FIG. 1B,**P<0.01。
to further clarify the role of YTHDF2 protein in atherosclerosis, Apoe was reused-/-Mice were given (SPF grade) normal diet (control, NC) and high cholesterol diet (D12108C, experimental, HFD) (feeding methods are described in "Cheng WL, et al. Br J Pharmacol.2015; 172(23): 5676-89"), a model of atherosclerosis of mice was constructed, aortic vascular tissues of mice were extracted after 16 weeks, mRNA expression levels of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 were measured by qRT-PCR (experimental methods are described in "Liu Z, et al. Br J Pharmacol.2013Aug; 169 (1795) 809") and Western Blot, and the expression levels of YTHDF2 proteins were measured, as shown in FIGS. 2 and 3. It can be seen that the expression levels of mRNA (FIG. 2) and protein (FIG. 3) of YTHDF2 in the aortic tissue of mice in the high-fat diet group were significantly increased compared to the normal diet group.
HUVECs cells are cultured at the upper level of the cells (the experimental method is shown in the literature of 'Xie L, et al. Br J Pharmacol.2012; 165(3): 754-64.'), ox-LDL (oxidized low density lipoprotein) is added into the experimental group to stimulate the cells for 24 hours to cause endothelial cell damage, an endothelial cell damage model is constructed, meanwhile, an equivalent PBS group is added into the experimental group to serve as a control group (control), and mRNA expression levels of YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3 in the cells and an YTHDF2 protein expression level are detected by using qRT-PCR.
The qRT-PCR detection steps are as follows:
(1) the sample (endothelial cells obtained in step 1) was added to 1mL of Trizol, lysed by pipetting thoroughly, and then pipetted into a centrifuge tube with RNase Free (RNAase Free) for 5 minutes.
(2) 200 μ L of chloroform was added to each EP tube, vortexed vigorously for several seconds, and then lysed on ice for 10 minutes.
(3) Centrifugation, 4 ℃, 12000rpm, 15 min, carefully pipette the supernatant (500 μ L) into a new EP tube.
(4) Adding isopropanol with the same volume, reversing the mixture up and down, mixing the mixture evenly, and standing the mixture for 10 minutes at 4 ℃.
(5) Centrifugation was carried out at 12000rpm for 15 minutes at 4 ℃ and the supernatant was discarded and washed with 75% ethanol.
(6) Centrifuging at 4 ℃, 12000rpm for 5 minutes, removing supernatant, air-drying, adding appropriate DEPC water (20-50 mu L), and detecting the RNA concentration.
(7) The reverse transcription reaction system of RNA is programmed as follows:
(8) designing a primer: primer Premier 5 software was used to assist in designing primers, all of which were synthesized by the EnxWeiji Biotechnology Ltd.
The results of the detection are shown in FIGS. 4 and 5. It can be seen that the experimental group (ox-LDL) significantly increased the YTHDF2 mRNA (fig. 4) and protein expression levels (fig. 5) compared to the control group (control).
Further, this example continued to detect the expression levels of CD31 and YTHDF2 proteins in mouse vascular tissues by immunofluorescence (for experimental methods see the literature "Wang W, et al. Biochim Biophys Acta Mol Basis Dis.2019Jul 1; 1865(7): 1793-. The aorta blood vessel immunofluorescence staining method comprises the following steps:
(1) frozen sections (mouse aortic tissue frozen embedded sections) were air dried at room temperature for 20 min.
(2) Fixing: xylene for 15 minutes.
(3) The slides were washed 3 times with PBS buffer for 8 minutes each.
(4) And (3) sealing: the tissue was dropped into PBS containing 10% goat serum, and the solution was left at room temperature for 1 hour and then discarded.
(5) Primary antibody was added drop wise to the tissue overnight in a refrigerator at 4 ℃.
(6) The slides were washed 3 times with PBS buffer for 10 minutes each.
(7) The secondary antibody labeled with fluorescein was added dropwise and incubated in an oven at 37 ℃ for 30 minutes.
(8) The slides were washed 3 times with PBS buffer for 10 minutes each.
(9) DAPI staining solution was added dropwise thereto, and the mixture was left at room temperature for 5 minutes.
(10) And (6) sealing the sheet.
The results of the detection are shown in FIG. 6. It can be seen that the blood vessel tissue of the mice in the high fat diet group (HFD) had an increased expression level of YTHDF2 protein compared to the normal diet group (NC).
The above experimental results suggest: in the cells and animal models of atherosclerosis, the expression level of YTHDF2 protein is obviously increased.
Example 2 si-YTHDF2 interference experiments
To further clarify the role of YTHDF2 protein in atherosclerosis, this example added a substance that down-regulated the expression of YTHDF2 protein to HUVECs to verify the relevance of down-regulating YTHDF2 protein in inhibiting atherosclerosis.
The substance used in this example to down-regulate the expression of YTHDF2 protein is YTHDF2 small interfering RNA (si-YTHDF2), the nucleotide sequences of the sense strand and the antisense strand of which are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.
The specific steps of YTHDF2 small interference transfection of HUVECs are as follows: endothelial cells HUVECs are planted on a 6-well plate overnight, when the density reaches 80%, a control group and siRNA of knockdown YTHDF2 are transfected into the HUVECs respectively by using a LipofectamineTMRNAiMAX (Invitrogen company) transfection reagent according to standard steps, a fresh ECM culture medium containing 5% serum is replaced after 6 hours, transfected endothelial cells with transfected YTHDF2 small interference are obtained after 24 hours of transfection, and protein is extracted to verify the interference efficiency.
The above transfection methods are conventional in the art, and can be specifically referred to in the literature "Xie L, et al.artificial Redox signal.2016, 20; 24(6) 329, 343'.
After HUVECs transfect YTHDF2 small interfering RNA, the interference efficiency of YTHDF2 is detected by Western Blot, and Con, si-YTHDF2-2 and si-YTHDF2-3 are set as a control group. The nucleotide sequence of the sense strand of si-YTHDF2-2 is shown as SEQ ID NO.5 (5'-CGUCAAGGUCGUGGGAAAUAA-3'), and the nucleotide sequence of the antisense strand is shown as SEQ ID NO.6 (3' -GCAGUUCCAGCACCCUUUAUU-5); the sense strand nucleotide sequence of si-YTHDF2-3 is shown in SEQ ID NO.7 (5'-CCGUUCCAUUAAGUAUAAUAU-3'), and the antisense strand nucleotide sequence is shown in SEQ ID NO.8 (3 '-GGCAAGGUAAUUCAUAUUAUA-5'). The interference efficiency of the small interfering RNA is shown in FIG. 7, GAPDH is an internal reference, and it can be seen that si-YTHDF2 group shows obvious interference effect.
After HUVECs transfect YTHDF2 small interfering RNA, ICAM-1 and VCAM-1 mRNA and protein expression level are respectively detected, and the detection results are shown in FIGS. 8-10. The experiment shows that the mRNA and protein expression levels of ICAM-1 and VCAM-1 are increased in HUVECs after ox-LDL stimulation, and the mRNA and protein expression levels of ICAM-1 and VCAM-1 are reduced after the YTHDF2 protein is knocked down by small interfering RNA and then administered with ox-LDL (figure 8-10).
The leukocyte and endothelial cell adhesion experiment comprises the following specific steps:
(1) dil (2.5. mu.g/mL) was added to the prepared human peripheral blood mononuclear cells (THP1) and incubated at 37 ℃ for 10 minutes (protected from light).
(2) Equal volumes of labeled THP1 cells were added to the treated HUVEC (endothelial cells) and incubated at 37 ℃ for 1 hour (protected from light).
(3) Wash 3 times with pre-warmed PBS and wash away non-specifically bound THP1 (protected from light).
(4) The adhesion of monocytes to endothelial cells was observed under an upright fluorescence microscope (protected from light).
As shown in FIG. 11, the adhesion of monocytes to endothelial cells was significantly reduced compared to the control group (con) after transfection of YTHDF2 small interfering RNA (siYTHDF2) with ox-LDL.
The above experimental results can further prove that: the occurrence of atherosclerosis can be effectively inhibited by knocking down YTHDF2 protein.
Example 3 mouse experiments
In the embodiment, a substance for down-regulating YTHDF2 protein expression is injected into the tail vein of a mouse, so that the correlation between down-regulating YTHDF2 protein in an in vivo environment and inhibiting atherosclerosis is verified.
In this example, the endothelial specific gonadal associated virus (AAV) in which YTHDF2 protein expression is down-regulated YTHDF2shRNA was usedendo) The shYTHDF2-2 is called adenovirus for short, and the nucleotide sequence is shown in SEQ ID NO. 3.
Selecting male Apoe with age of 8 weeks-/-Mice, tail vein injection of endothelial specific gonadal associated virus (AAV) expressing unloaded and YTHDF2shRNAendo) After 2 weeks, normal diet (control group, NC) or high fat diet (AS animal model group, HFD) was given, and after 16 weeks, the expression level of inflammatory factors in vascular tissues of mice was measured by qRT-PCR experiment.
The results are shown in FIG. 12, and it can be seen that the endothelial specific gonadal associated virus (AAV) administered with YTHDF2shRNAendo) Can inhibit the expression of inflammatory factors.
Meanwhile, collecting the aorta blood vessel of the mouse, and detecting the area of the aortic blood vessel plaque by HE staining, comprising the following steps:
(1) paraffin sections of mouse aortic blood vessels were placed in a 65 ℃ oven and baked for 30 minutes.
(2) Dewaxing: xylene for 5 minutes, 3 times total. 100% ethanol for 1 minute. 95% ethanol for 1 minute. 70% ethanol for 1 minute.
(3) And (5) washing with distilled water until water drops are not hung on the glass slide, throwing off water on the slide, and dyeing with hematoxylin for 5 minutes.
(4) Washing with tap water to remove floating color on the slices.
(5) 1% hydrochloric acid ethanol for 1-3 seconds. Tap water was washed several times.
(6) Scott solution was washed with tap water several times for 1 minute. Water was drained off, eosin stained, blood vessels for 10 seconds.
(7) After several times of washing with distilled water, the chips were washed off to remove floating color. 70% ethanol was quickly washed with water. The solution was quickly washed with 95% ethanol. 100% ethanol for 30 seconds, 3 times.
(8) Xylene for 2 minutes, 3 times total. Sealing the tablet with neutral gum when the xylene is not dry.
The detection results are shown in fig. 13, and it is found that endothelial specific knockdown YTHDF2 can effectively reduce plaque area.
The above experimental results fully demonstrate that YTHDF2 is involved in the progression of atherosclerosis. The YTHDF2 protein can be used as a new important target for clinically treating atherosclerosis, and has potential clinical application value in the prevention and treatment of atherosclerosis. By transfecting a substance (small interfering RNA or adenovirus of YTHDF2) for down-regulating the expression of YTHDF2 protein, the protein expression of YTHDF2 can be down-regulated, and the development of atherosclerosis can be effectively inhibited.
The above examples are only for illustrating the technical idea and features of the present invention, and the purpose of the present invention is to enable those skilled in the art to understand the content of the present invention and implement the present invention, and not to limit the protection scope of the present invention. All equivalent changes and modifications made according to the spirit of the present invention should be covered within the protection scope of the present invention.
Sequence listing
<110> Nanjing university of medical science
<120> substance for down-regulating YTHDF2 protein expression and application thereof
<141> 2021-01-13
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
guucuguucu uguacauuau a 21
<210> 2
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caagacaaga acauguaaua u 21
<210> 3
<211> 4078
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgggtcagcg actgtgagag tcagcgctcg cgccgcgcgc gccgcccgcc tctgccgctc 60
ggcctccccc attcgggctg cgagggggcg ggcgcgcgct ccggagcata gagacgggcg 120
ttgagctcgg cggcctagag cgtcgccgga tcggagccgg agcccgagtc gcgcgctgtg 180
tctctgctgc gtccgccgag gcgaggctcc gagtgtcagg gacaaaagcc gccgccgcac 240
cctctgctcc cgtcgtcggg gctcatccgc cgccgccgct gtcccgacga ggagtccgcc 300
gccgtcgttc cccgtgagga tccgagagcc atgtcggcca gcagcctctt ggagcagaga 360
ccaaaaggtc aaggaaacaa agtacaaaat ggttctgtgc atcaaaagga tggactaaat 420
gatgatgatt tcgaacctta cttgagccca caggcaaggc cgaataatgc atatactgcc 480
atgtcagact cctacttacc cagttactac agcccctcca ttggcttttc ctattctttg 540
ggtgaagctg cttggtctac tggaggtgac acagccatgc cctatctaac ttcttatgga 600
caactgagca acggagagcc ccactttcta ccagatgcaa tgtttgggca accaggagcc 660
ctaggtagca ctccatttct tggtcagcat ggttttaatt tttttcccag tgggattgac 720
ttctcagcat ggggaaataa cagttctcag ggacagtcta ctcaaagctc tggatatagt 780
agcaattacg cttatgcacc cagctcctta ggtggagcca tgattgatgg acagtcagct 840
tttgccaatg agaccctcaa taaagctcca ggcatgaata ctatagacca agggatggca 900
gcactgaaac taggtagcac agaagttgca agcagtgttc caaaagttgt aggctctgct 960
gttggtagtg ggtccatcac tagtaacatt gtggcttcta gcagtttgcc tccagctact 1020
attgctcctc caaaaccagc atcttgggct gatattgcta gcaagcctgc aaaacaacag 1080
cctaaactga agaccaagaa tggcattgca ggatcaagtc ttccaccacc cccaataaag 1140
cataacatgg atattggaac ttgggataac aagggtcctg tggcaaaagc cccctcacag 1200
gctttggttc aaaatatagg tcagccaacc cagggatctc ctcagcctgt tggacagcag 1260
gccaataata gcccaccagt ggctcaggca tcagtagggc aacagacgca gccattgcct 1320
ccacctccac cacagcctgc tcagctctca gtccagcaac aggcagctca gccaactcgc 1380
tgggtagcac ctcggaaccg tggcagtggg ttcggtcata atggggtgga tggtaatgga 1440
gtaggacagt ctcaggcggg ttctggatct actccttcag agcctcaccc ggtgttggag 1500
aaacttcggt ccattaataa ctataaccct aaagatttcg actggaatct gaaacatggc 1560
cgggttttca tcattaagag ctactctgag gacgatatcc accgttccat taagtataat 1620
atctggtgca gcacagagca tggtaacaag agactggatg ccgcctatcg ttccatgaat 1680
gggaagggtc ccgtgtactt acttttcagt gtcaacggca gtggacactt ctgtggagtt 1740
gcagagatga aatctgctgt ggactacaac acatgtgcag gtgtgtggtc ccaggacaaa 1800
tggaagggtc gtttcgatgt cagatggatt tttgtgaagg acgttcccaa tagccaactg 1860
cgacacattc gtctagagaa caacgagaat aaaccagtga ccaactctag ggacactcag 1920
gaagtgcctc tggaaaaagc taagcaggtg ttgaaaatca tagccagcta caagcacacc 1980
acttccattt ttgatgactt ctcacactat gagaaacgcc aagaggaaga agaaagtgtt 2040
aaaaaggaac gtcaaggtcg tgggaaatag aaagcggttc tgcatagact gcagcaacgg 2100
ttgcatctcc ttatcctaag aggacacgat gacctgcaag aaaattagga ctttttttct 2160
taatttcatt gacttcagag acaattgcaa acttgcagtt tatgtattgg aatttcacaa 2220
aagacatagg acttaactgg aaaatggaaa aaaaaaagga aaaaaagaaa aagaaaaaac 2280
ctaaacaaaa attccctcta ggtagtttag gtaaaaaaat gtccctttta ttttggcttt 2340
ggttgtgatt cagagcataa tgctttggtt tttttttttg tttttttttt tttttttgtc 2400
tttttactct atttttcgga tttttaagtc cgtaagtgca tacaattttc tcttaatttt 2460
taaacccttt cctcccccat tttgacattt gcacttggag aacacttgag ttgcgcagat 2520
tttgggtgtc caccccagaa agtgggaatt tgatttttcc cttccgaact ggaagaaaat 2580
ttttatgaag aatttttgtc taggaaagtt taataacagt gttacccaag gttgtgtctg 2640
taagggtggc tcattttctc tgaccctttg ttactcaaag taaagtacta ggagtcctaa 2700
gaaatgttct gttcttgtgt attatactga ttaagtcagg attaatttga tttcaaagct 2760
aagaacagtg ataaaaactt gttttcagaa atgcattttg gaagagaaaa cattgtaaaa 2820
catgtagtga atgtttcttc agtttcttgt tcagccaatg aggaaagggc attgcctttc 2880
tttttcccat taatcacttc tcaataaacg tgagagcctg tcgagcatca ctccagtacc 2940
acttagtatt atttgagtct ctgtgtttgg ggagagattt tggagtctaa ggagttttga 3000
gaggtgacct agtgactcac tttagacagt ttgtgttaat ggccctgcat ggtgttgcat 3060
gcctgtaatc cttgcattta ggagacggga gcaggatgga tgaggtcaga ggttatcctc 3120
aggccagttg ggctacatga gaccctgtca acaaaaaggt tgtattggaa ggacattgct 3180
ttgtacccaa ggactagaaa cctgctgtga cgatattcat aatgcctgtt tctggttctt 3240
tatatagaga aaacacagca ctgctaaacc attcagcagt atttgtgtgt atggtgccag 3300
gtactgtgct aattccatag gaacctcacc ctgtaaaaag aggtggcacc cactatccca 3360
gtatgtaagt gtctgatcca gtatatggct gatttagaca gtatgcccca gagatgtagg 3420
tcccaaaaat gaaattctag tggaactcac agaggaattt gtttctttcc ctaaggctta 3480
attaaaaggc ttttctgctt tagagagtct ttactcttaa gatgtcctaa ttctagaggg 3540
ttaaatgttc aaaaactcta tactaagaga ttctggaaat aaagcttaat actgtggaca 3600
gtgttacact ggaatgcagg gccgtgctca cacagccaga ctgctaagaa aggcagctca 3660
gggatgctgg gatatcgctc agtcagccgg tgtgccctgc gccatcaagg aaaagcagtg 3720
ttggtttcta gcattgtagc cagcaaaggc acggcaaagg cttgtgcata tttgtttctg 3780
ccaagttttt ttttttttaa aggtttattt atgcatatga gcacgctctc ttcatgcaca 3840
ccagaagaga gcatcagatc ccattacaga tagctagctg tgagccacct tgtggtttcg 3900
gggaattgaa ctcagaatct ctggaagagc agtcagtgct cctgaccgct gagccactct 3960
ccagccacct ctgccaaact ttttattata aaatatatct tcaatattgg agttctcagt 4020
gtttttgtta gttggaatat acaaattttt tacatttaat taaaaaaaat gtatgtgc 4078
<210> 4
<211> 2719
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agagcgtcgc cgagtcggag ccggagcctg agccgcgcgc tgtgtctccg ctgcgtccgc 60
cgaggccccc gagtgtcagg gacaaaagcc tccgcctgct cccgcagacg gggctcatct 120
gccgccgccg ccgcgctgag gagagttcgc cgccgtcgcc gcccgtgagg atctgagagc 180
catgtcggcc agcagcctct tggagcagta caaaatggat ctgtacatca aaaggatgga 240
ttaaacgatg atgattttga accttacttg agtccacagg caaggcccaa taatgcatat 300
actgccatgt cagattccta cttacccagt tactacagtc cctccattgg cttctcctat 360
tctttgggtg aagctgcttg gtctacgggg ggtgacacag ccatgcccta cttaacttct 420
tatggacagc tgagcaacgg agagccccac ttcctaccag atgcaatgtt tgggcaacca 480
ggagccctag gtagcactcc atttcttggt cagcatggtt ttaatttctt tcccagtggg 540
attgacttct cagcatgggg aaataacagt tctcagggac agtctactca gagctctgga 600
tatagtagca attatgctta tgcacctagc tccttaggtg gagccatgat tgatggacag 660
tcagcttttg ccaatgagac cctcaataag gctcctggca tgaatactat agaccaaggg 720
atggcagcac tgaagttggg tagcacagaa gttgcaagca atgttccaaa agttgtaggt 780
tctgctgttg gtagcgggtc cattactagt aacatcgtgg cttccaatag tttgcctcca 840
gccaccattg ctcctccaaa accagcatct tgggctgata ttgctagcaa gcctgcaaaa 900
cagcaaccta aactgaagac caagaatggc attgcagggt caagtcttcc gccacccccg 960
ataaagcata acatggatat tggaacttgg gataacaagg gtcccgttgc aaaagccccc 1020
tcacaggctt tggttcagaa tataggtcag ccaacccagg ggtctcctca gcctgtaggt 1080
cagcaggcta acaatagccc accagtggct caggcatcag tagggcaaca gacacagcca 1140
ttgcctccac ctccaccaca gcctgcccag ctttcagtcc agcaacaggc agctcagcca 1200
acccgctggg tagcacctcg gaaccgtggc agtgggttcg gtcataatgg ggtggatggt 1260
aatggagtag gacagtctca ggctggttct ggatctactc cttcagaacc ccacccagtg 1320
ttggagaagc ttcggtccat taataactat aaccccaaag attttgactg gaatctgaaa 1380
catggccggg ttttcatcat taagagctac tctgaggacg atattcaccg ttccattaag 1440
tataatattt ggtgcagcac agagcatggt aacaagagac tggatgctgc ttatcgttcc 1500
atgaacggga aaggccccgt ttacttactt ttcagtgtca acggcagtgg acacttctgt 1560
ggcgtggcag aaatgaaatc tgctgtggac tacaacacat gtgcaggtgt gtggtcccag 1620
gacaaatgga agggtcgttt tgatgtcagg tggatttttg tgaaggacgt tcccaatagc 1680
caactgcgac acattcgcct agagaacaac gagaataaac cagtgaccaa ctctagggac 1740
actcaggaag tgcctctgga aaaggctaag caggtgttga aaattatagc cagctacaag 1800
cacaccactt ccatttttga tgacttctca cactatgaga aacgccaaga ggaagaagaa 1860
agtgttaaaa aggaacgtca aggtcgtggg aaataaaagg cagttctaca cagactgcag 1920
caacggttgc atctgcatat cctaagagga aaaaatgacc ttcaagagaa ttaggacttt 1980
tttcttaatt tcactgactt cagagacgat tgcagacttg cagtttaagt attggaattt 2040
cacaaaagac ataggactta actggaaaat gaaaaaaaaa agaaaaagaa aaaactaaac 2100
aaaaaatccc tctaggtagt ttaggtgaaa aatgtccctt ttattttggc tttggttgtg 2160
atttcagagc ataatgctat gtttttttgt ctttttacta tgtttttcgg atttttaagt 2220
ccgtaagtgc atacagtttt ctctaatttt taaacccttt cctcctccca ttttgacatt 2280
tgcacttgga gaacacttga gttgtgaagg ttttgggcat ccaccccaga aagtgggaat 2340
ttgattttat ccttccgaac tggaagaaca tttttatgaa gaatttttgt ctaggagaat 2400
ataacagtgt tacccaaggt tgtgtcttta agggtggttc attttctctg accttttgtt 2460
actcaaagta aagtactagg agtcctaaga aatgttctgt tcttgtacat tatactgatt 2520
aagtcaggat taatttgatt tcaaagctga gaacagtggt aaaaactcgt ttacagaaat 2580
gcattttgga agagaaaaat actgtaaaac gtgtcgtgaa tgtttcttca gtttcttgtt 2640
cagccaatga ggaaagggca ttgcctttct ttttaccatt aatcacttct caataaacgt 2700
gagatcctgt tgagcatca 2719
<210> 5
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgucaagguc gugggaaaua a 21
<210> 6
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gcaguuccag cacccuuuau u 21
<210> 7
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ccguuccauu aaguauaaua u 21
<210> 8
<211> 21
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggcaagguaa uucauauuau a 21